ID: 1190393838

View in Genome Browser
Species Human (GRCh38)
Location X:49959873-49959895
Sequence TTGCTGAAGCAGAGTGAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 536
Summary {0: 1, 1: 0, 2: 5, 3: 61, 4: 469}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190393838_1190393843 -6 Left 1190393838 X:49959873-49959895 CCATTTTCACTCTGCTTCAGCAA 0: 1
1: 0
2: 5
3: 61
4: 469
Right 1190393843 X:49959890-49959912 CAGCAACCTCTTCATATGGGGGG 0: 1
1: 0
2: 0
3: 8
4: 104
1190393838_1190393840 -9 Left 1190393838 X:49959873-49959895 CCATTTTCACTCTGCTTCAGCAA 0: 1
1: 0
2: 5
3: 61
4: 469
Right 1190393840 X:49959887-49959909 CTTCAGCAACCTCTTCATATGGG 0: 1
1: 0
2: 0
3: 8
4: 176
1190393838_1190393845 22 Left 1190393838 X:49959873-49959895 CCATTTTCACTCTGCTTCAGCAA 0: 1
1: 0
2: 5
3: 61
4: 469
Right 1190393845 X:49959918-49959940 TTATTAATCATGTCACCATCTGG 0: 1
1: 0
2: 0
3: 22
4: 163
1190393838_1190393841 -8 Left 1190393838 X:49959873-49959895 CCATTTTCACTCTGCTTCAGCAA 0: 1
1: 0
2: 5
3: 61
4: 469
Right 1190393841 X:49959888-49959910 TTCAGCAACCTCTTCATATGGGG 0: 1
1: 0
2: 1
3: 12
4: 117
1190393838_1190393839 -10 Left 1190393838 X:49959873-49959895 CCATTTTCACTCTGCTTCAGCAA 0: 1
1: 0
2: 5
3: 61
4: 469
Right 1190393839 X:49959886-49959908 GCTTCAGCAACCTCTTCATATGG 0: 1
1: 0
2: 1
3: 12
4: 125
1190393838_1190393842 -7 Left 1190393838 X:49959873-49959895 CCATTTTCACTCTGCTTCAGCAA 0: 1
1: 0
2: 5
3: 61
4: 469
Right 1190393842 X:49959889-49959911 TCAGCAACCTCTTCATATGGGGG 0: 1
1: 0
2: 0
3: 7
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190393838 Original CRISPR TTGCTGAAGCAGAGTGAAAA TGG (reversed) Intronic
900791016 1:4680861-4680883 TGGCTGAAGTAGAGTAGAAATGG + Intronic
900920920 1:5669885-5669907 TTGATGAAGACGAGTGAAGACGG + Intergenic
902098994 1:13969558-13969580 TGGCTGAAGCAGAGTGACTAGGG - Intergenic
902185856 1:14724846-14724868 TTGATGAACCAGAGTGAGGAAGG - Intronic
902999281 1:20253272-20253294 TGGCAGAAGCAGAGTAAAGAGGG + Intergenic
903024163 1:20415413-20415435 TGGCTGCAGCAGAGTGACCAAGG + Intergenic
903681821 1:25102556-25102578 TGGCTGGAGCAGAGTGAATGGGG - Intergenic
904272985 1:29362580-29362602 TTGCTGGAGAAGAGGGAAAAAGG + Intergenic
904424550 1:30415050-30415072 TTGCTGGAGAAGAAGGAAAAGGG - Intergenic
905451347 1:38058814-38058836 TTGCTGGAGCAGAGTGGCAGAGG + Intergenic
905649094 1:39644674-39644696 TTGCGGAAGCAGGTTTAAAAAGG + Intergenic
905705857 1:40056983-40057005 TGACTTAAGCAGAATGAAAAAGG - Intronic
905938713 1:41845470-41845492 TAGGTGAAGAAGAGAGAAAAGGG - Intronic
906876487 1:49544112-49544134 TTCCTGAAAAACAGTGAAAACGG - Intronic
907184311 1:52598120-52598142 TGGCTGGAGCAGAGTGAGCAAGG - Intergenic
907477470 1:54715272-54715294 GGGCTGAAGCAGAGTGAGGAAGG - Intronic
907541895 1:55223138-55223160 TTGTTGAAGCAGAGGTAAAACGG - Intergenic
907615750 1:55924556-55924578 TGGCTGGAGCAGAATGAACATGG + Intergenic
907848617 1:58232732-58232754 TTGCTGATAGAGAGTGACAAGGG + Intronic
908031574 1:60005677-60005699 TGGGTGAGGCAGAATGAAAAGGG + Intronic
908342197 1:63193085-63193107 TAGCTGGAGCACAGTGAACAAGG + Intergenic
908701802 1:66910388-66910410 TGGCTGAAGCAGAGTAAACAAGG - Intronic
910672092 1:89783771-89783793 TAGCTGAAGTGGAGTGAACAAGG + Intronic
910865318 1:91782984-91783006 TTGCTGGAGCAAATTCAAAATGG + Intronic
911264985 1:95732720-95732742 TTGCTCAAGCAGCTTGAAGATGG + Intergenic
912149135 1:106835076-106835098 TTGAAGAATCAGAGTGAAATGGG - Intergenic
912509899 1:110182171-110182193 TTTCAGAAGCAGAGTCAAAAGGG + Intronic
912738664 1:112173683-112173705 CTGCTGAAGCAGAGTGGGAAAGG - Intergenic
913149116 1:116022743-116022765 TTTCTGTAGCAAAGTGAAAAGGG + Intronic
914667763 1:149845598-149845620 TGGCTGAAGCACAGTGACCAAGG + Intronic
914697230 1:150095741-150095763 TGGCTGGAGCATAGTGAATAAGG + Intronic
916757883 1:167790525-167790547 GTGCTGAGGCACAGGGAAAAGGG - Exonic
916948092 1:169749528-169749550 ATGATGAAGCTTAGTGAAAAAGG - Intronic
917917516 1:179718286-179718308 ATGCAGAAGCCAAGTGAAAATGG + Intergenic
917994734 1:180424469-180424491 TGGTTGGAACAGAGTGAAAAAGG + Intronic
918124861 1:181574450-181574472 TTGTTGAAGCAGAGGTCAAAAGG - Intronic
919432415 1:197512740-197512762 TTGCTGAAGAACACTGTAAAAGG + Intronic
919860037 1:201733794-201733816 TGGCTGAAGCAGAGTTAGCAAGG + Intronic
921164857 1:212499648-212499670 TGGCTGGAGCAGAGTGAGCAGGG + Intergenic
921234521 1:213112123-213112145 GTGCTGAAGTAGAGAGGAAATGG + Intronic
922349081 1:224721218-224721240 TTGCTGAATGAGTGTGAAAATGG + Intronic
922434852 1:225594021-225594043 TTCCTAAGGCAGATTGAAAAGGG - Intronic
922758929 1:228112532-228112554 TTGCTGAAGCAAACTAAATATGG - Intergenic
923333498 1:232947137-232947159 TGACTGAAGCAGAGGGACAAGGG - Intergenic
923401927 1:233624131-233624153 TCAGTGAAGCAGAGTGAATAGGG - Intronic
1063376033 10:5554974-5554996 CTGCTGAAGTGGAGAGAAAAGGG + Intergenic
1063613827 10:7585451-7585473 GAGCTGCAGCAGAGTGAAACAGG - Intronic
1063739936 10:8806397-8806419 TTCCTGTAACAGAGTGACAAAGG + Intergenic
1065068695 10:22000486-22000508 TGGCTGGAGCAGAGTGATCAAGG - Intronic
1065681951 10:28244959-28244981 TTGCTTAAGGAGAGTAAAAAAGG - Intronic
1066041167 10:31549109-31549131 TTTTTATAGCAGAGTGAAAATGG + Intergenic
1066565935 10:36722137-36722159 TGGTTGAAACAGAGGGAAAATGG - Intergenic
1067286020 10:44908214-44908236 TTCATGAAGCAGAGTGGACAGGG - Intergenic
1068757540 10:60671462-60671484 GTGCTGAATTAGAGTGTAAATGG - Intronic
1069132702 10:64726729-64726751 TTGCTCAAGGAGAGTGAAACAGG - Intergenic
1069333258 10:67318588-67318610 TAGCTGGAGCAGAGTGAACATGG - Intronic
1069498912 10:68931851-68931873 CTGCTGGAACAGACTGAAAAGGG - Intronic
1069806565 10:71128986-71129008 TTGATGGTGCAGAGTGAAACCGG + Intergenic
1070311172 10:75275278-75275300 ATGCTGCAGCAGAGTGACAAAGG - Intergenic
1070341269 10:75500561-75500583 TTTTTGTAGCAGTGTGAAAACGG - Intronic
1070529205 10:77321770-77321792 TTACTGAAGCAGAAAGAACATGG - Intronic
1070605876 10:77898304-77898326 TTGGAGAAGGAGAGAGAAAAAGG + Intronic
1071409650 10:85376417-85376439 TGGCTGAAGCATGGTGAACAGGG - Intergenic
1071778296 10:88813820-88813842 TTGCTGCAGCCTTGTGAAAAGGG - Intronic
1071982914 10:91021915-91021937 ATGCTGAGGCTGAGTGAAGAAGG - Intergenic
1072289579 10:93951850-93951872 TTGCTCCAGCAGACTGCAAAGGG + Intronic
1072512377 10:96140376-96140398 TTTCTGAAGCTGAGTAAGAATGG + Intronic
1072737118 10:97886587-97886609 CTGCAGAAGCGGGGTGAAAATGG + Intronic
1073575424 10:104618789-104618811 TTTCTGAAGCACAATGAGAATGG - Intergenic
1076260445 10:129060750-129060772 TTGGGGAAGCAAAGTGAACAAGG - Intergenic
1078141506 11:8696567-8696589 TTTCTGACACAGAGTGAGAAGGG - Exonic
1079586747 11:22135109-22135131 TCTCTGTAGCAGAGTGAAAATGG - Intergenic
1079955452 11:26857535-26857557 ATGGTAAAGTAGAGTGAAAAAGG + Intergenic
1080214976 11:29830033-29830055 TAGCTAAAGCAGTGTGAAGAGGG + Intergenic
1081388590 11:42502674-42502696 TTTCTATAGCAGTGTGAAAATGG - Intergenic
1081468328 11:43345898-43345920 TGGCTGCAGCAGAGTGATCAAGG - Intergenic
1081528084 11:43940721-43940743 TGGCTAAAGCAGAGTGAGAGAGG - Intronic
1081552754 11:44129403-44129425 TGGCTGGAGCAGAGTAAAGAAGG - Intronic
1081866173 11:46361840-46361862 TTCCTGAAGCTGATGGAAAAGGG + Intronic
1085446815 11:76606298-76606320 TTGCAGCAGAAGAGTGAGAAGGG - Intergenic
1086980743 11:93195699-93195721 TGGCTGAAGCAGAGTGATGGAGG - Intronic
1087194369 11:95290539-95290561 CTGTTGAAGGAGAGGGAAAATGG + Intergenic
1087777433 11:102269120-102269142 TTGCTGAATCAGACTGAATTTGG - Intergenic
1088432041 11:109769220-109769242 GTGCAGAAGCAGAGTGATACAGG + Intergenic
1089397042 11:118143074-118143096 GTGCAGAAGCAGAGAGAAAAAGG - Intronic
1089419260 11:118319067-118319089 TTGCTGAAATACAGTGAATATGG + Intergenic
1089781085 11:120873763-120873785 TCCCTGGAGCAGAGAGAAAAGGG + Intronic
1090641542 11:128733488-128733510 TGGCTGATGCTGAGTGAACACGG + Intronic
1091275011 11:134344188-134344210 TTGTTGATGCAGAGGGAAGAGGG + Intronic
1091992198 12:4964394-4964416 TGGCTGAAGCAGTGTGAATGAGG - Intergenic
1092519236 12:9250314-9250336 CAGCTGAAGCAGTGTGAAGAGGG + Intergenic
1092564879 12:9654192-9654214 TAGGTGAAGCAAAGTGAAGATGG + Intergenic
1092836456 12:12493610-12493632 TGGCTGGAGCAGAGTGAGCATGG - Intronic
1094022179 12:25926210-25926232 TTCCTGAGGCAGAGTGGTAAGGG - Intergenic
1094138188 12:27151595-27151617 ATGGTGAAGCAGAGTTAATAGGG + Intergenic
1094248046 12:28325732-28325754 TTGCTGAAGCAGAATGAATGAGG + Intronic
1094398958 12:30040362-30040384 TGGCTGAAGCAGAGTGTCAGGGG - Intergenic
1095362202 12:41356077-41356099 TTGCTGTATCAGAGAGATAATGG - Intronic
1095641003 12:44484634-44484656 TTGCTGTAGCCGTGTGAAGAAGG - Intergenic
1095881282 12:47139533-47139555 TAGCTCAAGTACAGTGAAAAGGG + Intronic
1096011198 12:48216917-48216939 TTGCTGAAGAAAAGGGAAATGGG + Intergenic
1096449511 12:51726185-51726207 TTGCTGAAGCAGAAGATAAAGGG + Intronic
1096925872 12:55145695-55145717 ATGCTGAACAAGAGAGAAAAGGG - Intergenic
1097069725 12:56346089-56346111 TCACTGAAGCAGAGCCAAAAAGG + Intronic
1097861434 12:64522379-64522401 ATGCTAAAGGACAGTGAAAAGGG - Intergenic
1097921234 12:65076425-65076447 TTGCTTAACCAGGGTAAAAATGG + Intronic
1098636657 12:72792506-72792528 TTGATGACTAAGAGTGAAAAAGG - Intergenic
1099540015 12:83896045-83896067 TTGTTATAGCAGAGTGAAAATGG + Intergenic
1100037731 12:90274319-90274341 TTGTTGAAGGATAGTGAAAGGGG - Intergenic
1100642357 12:96494165-96494187 TAGCAGAAGCAGAGTGAAAGAGG + Intronic
1101168560 12:102063905-102063927 TAGCTGAAGCAGAGTGAGCAAGG + Intergenic
1101752229 12:107591427-107591449 TAGCTGAAGCAGGCGGAAAAGGG + Intronic
1102119327 12:110428761-110428783 ATGCTGCAGCAGAGTGAGCAAGG - Intergenic
1102247945 12:111367087-111367109 TGGCTGGAGCTGAGTGAACAAGG - Intronic
1102649351 12:114427143-114427165 TTGCTGAAGATGACTTAAAACGG + Intergenic
1102885440 12:116518238-116518260 TTTCTGAATTAGATTGAAAAGGG - Intergenic
1103643280 12:122370216-122370238 TAGCTGAAGCAGAGTGAGAAAGG + Intronic
1103660184 12:122508248-122508270 TTGCTGAACAAGAGAAAAAAAGG - Exonic
1104228076 12:126856607-126856629 TCGATGAGCCAGAGTGAAAAGGG - Intergenic
1104588115 12:130063618-130063640 TTGCTGCAGCCGTGTGAAGAAGG + Intergenic
1105581442 13:21700420-21700442 TTGCTGAATCAGAGTTTTAAAGG + Intronic
1106036202 13:26047681-26047703 TTGCTAAGGAAGAGTGAAGAGGG - Intronic
1106657264 13:31759547-31759569 TGGCTCAAGCAGAGTGAACAGGG + Intronic
1106785212 13:33100576-33100598 TTGCTGAAAGAGATTTAAAATGG - Intergenic
1107355562 13:39561828-39561850 TTGTTGAATCAGAGTGAATATGG + Intronic
1107626650 13:42293520-42293542 TTGCTAAAGTAAAATGAAAAAGG - Intronic
1107649185 13:42527213-42527235 TTTTGGAGGCAGAGTGAAAACGG + Intergenic
1107760667 13:43674973-43674995 TGGCTAAAGCACAGTGAACAAGG + Intronic
1107798454 13:44079690-44079712 TGGCTGAAGCAGAGCGAGCAAGG + Intergenic
1107799200 13:44088298-44088320 TGGCTGAAGCAGAGCGAGCAAGG - Intergenic
1107829640 13:44362939-44362961 TTGATGGAGCAGAGCGGAAAGGG + Intergenic
1108347856 13:49564134-49564156 TTGAAGAGGCAGAGTAAAAAAGG + Intronic
1108745949 13:53393937-53393959 TTGCTGAAGATGAGTGAAATTGG + Intergenic
1109286473 13:60414928-60414950 CTGCTTAAACAGAGGGAAAAGGG + Intronic
1109418445 13:62075990-62076012 TTGATGAAGCAAAGTGTAGAAGG - Intergenic
1109741930 13:66564743-66564765 TTCCTGATGCAGAGTCAATAGGG + Intronic
1109864225 13:68241536-68241558 TTTCTAAAGCAGTGTGTAAATGG + Intergenic
1110709326 13:78632746-78632768 TTGGTGATGCAGAGTAAACAAGG + Intronic
1111035228 13:82663280-82663302 TTGCTCAAGCACAGTTAAAAGGG + Intergenic
1111254920 13:85654004-85654026 TGGCTGGAGCAAAATGAAAAAGG - Intergenic
1111644514 13:91014540-91014562 TTGATGAAGCAGATTTGAAAAGG - Intergenic
1111716292 13:91883623-91883645 TAGCTGAAGCAGAGTGAGGAAGG + Intronic
1113447655 13:110381733-110381755 TTTCTGAAAGGGAGTGAAAAAGG - Intronic
1113498227 13:110750753-110750775 TTGCTGAAGCAGGCTGGAAATGG + Intergenic
1114406784 14:22464184-22464206 TGGCTGAAAAAGAGTGAAGAGGG - Intergenic
1115037448 14:28875872-28875894 TTGAGGAAGGAGAGTGGAAAAGG + Intergenic
1115427529 14:33277744-33277766 TTGCTGGAGCAGAATGAGAAAGG + Intronic
1116120416 14:40716576-40716598 TTTATGAAGCAGCATGAAAATGG + Intergenic
1116721038 14:48495820-48495842 TTGCTGATACAGAATGAACAAGG - Intergenic
1117478662 14:56120644-56120666 TTGCTGATGCAGTGAGAACAGGG + Intronic
1117537430 14:56715142-56715164 CTCCTGCTGCAGAGTGAAAAGGG - Intronic
1118832855 14:69451158-69451180 TTGCTGGCGCAGAGTGATTAGGG + Intronic
1118966853 14:70595124-70595146 TAGCTGAAGCCGAGTGACACTGG - Intronic
1120571564 14:86124163-86124185 TTGTAGAAGCTGAGTGAGAAAGG + Intergenic
1120689605 14:87577874-87577896 TTGCAGAAGCAGAGAGAAAATGG + Intergenic
1121960917 14:98258643-98258665 TGGTTGAAGCAGAATGAGAAAGG - Intergenic
1122492852 14:102131510-102131532 TGGCTGGAGCAGAGTGAGCAGGG - Intronic
1122611724 14:102988581-102988603 GTGCAGAGGCAGAGAGAAAATGG + Intronic
1122735740 14:103839744-103839766 TGGCTGGAGCAGAGTGAGTAAGG - Intronic
1124813404 15:32964662-32964684 ATTCTGAAGGAGACTGAAAATGG + Intronic
1125207242 15:37167601-37167623 TTGCTGCAGGAGAGGGAAGATGG - Intergenic
1126012567 15:44317124-44317146 TTTCAGAAGCAGATTTAAAATGG + Intronic
1126362750 15:47863176-47863198 TTGCTTAAGCAAAGGGGAAAGGG - Intergenic
1126423213 15:48497936-48497958 TTCCTGACACAGAGTGAAGAGGG - Intronic
1127012953 15:54649952-54649974 TAGCTGAAACAATGTGAAAAAGG - Intergenic
1127169653 15:56287707-56287729 TTACAGAAACAGAGAGAAAATGG - Intronic
1127745817 15:61971084-61971106 TGGCTGAAGCAGAGTGAGCAAGG + Intronic
1127923523 15:63515080-63515102 TTACTAAATCAGAGTCAAAATGG - Intronic
1127931983 15:63602842-63602864 TGGCTGGAGCAGAGTGAATGAGG + Intergenic
1128243005 15:66114264-66114286 TTGCTGTGGCAGAGAGAAGAGGG - Intronic
1130078512 15:80710623-80710645 TTGCTGATGCAGAGTGGTGAAGG + Intronic
1130573003 15:85065737-85065759 CTTCAGAAGCAGACTGAAAATGG - Intronic
1131329676 15:91485412-91485434 ATGAGGAAGCAGAGTGAGAAAGG + Intergenic
1132762479 16:1517050-1517072 TTTCAGAAGCAGAGGAAAAAAGG + Intronic
1133791644 16:9013579-9013601 GTGCTGGAGCAGAGCGAACACGG + Intergenic
1133919102 16:10136117-10136139 ATGGTGGAGCAGAGTGTAAAAGG - Intronic
1134225732 16:12388613-12388635 TTGCTGATGCAGCCTGAAAGCGG + Intronic
1135388479 16:22067266-22067288 TTCCTGAAGAAGAGAGAAAAAGG + Intronic
1135492104 16:22918403-22918425 TTGCTGAAACAGACACAAAATGG + Intergenic
1136080411 16:27848882-27848904 ATGCTGTAGCAGAGTGAGCAAGG + Intronic
1139282822 16:65784810-65784832 AGGCAGAAGCAGAGTGGAAAGGG + Intergenic
1140873824 16:79131752-79131774 TTTATCAAGCAGTGTGAAAATGG - Intronic
1141339270 16:83188028-83188050 TGGCTGAAGCAGAGGGAGCAAGG + Intronic
1143182472 17:4992125-4992147 TTATTGAAGCTGACTGAAAAGGG + Intronic
1143764050 17:9126046-9126068 TTGCAGAAGCAGAGTCAGGATGG + Intronic
1144133305 17:12268438-12268460 TGCCAGAAGCAGAGTGAAGATGG - Intergenic
1145827590 17:27888834-27888856 TAGCTTGAGCAGAGCGAAAATGG - Intronic
1146634513 17:34494233-34494255 TAGTGGAAGCAGAGTGAACATGG + Intergenic
1146948841 17:36891997-36892019 GTGGAGAAGCAGAGTGAAAGAGG + Intergenic
1148112880 17:45156647-45156669 TTTCTCAAGCAAAGTGTAAATGG + Intergenic
1148638662 17:49168723-49168745 TTGCTGGAACAGAGTGAGAATGG + Exonic
1150119146 17:62585103-62585125 TTGCTATAGCACAGTGAAAAAGG - Intronic
1151284543 17:73100508-73100530 TGGATGAAGCAGAGTGAGGAAGG - Intergenic
1154087049 18:11316874-11316896 GTGAAGAAGCAGAATGAAAAAGG - Intergenic
1155403166 18:25460525-25460547 TTGCAGAAGCAGAAAGAGAATGG + Intergenic
1155457072 18:26029171-26029193 TGACTGAAGCAGAGTGAATGAGG + Intronic
1155584606 18:27350596-27350618 TTGCTGAGTCAGAGAGTAAAAGG - Intergenic
1155622506 18:27795361-27795383 TTGATGAAGCTGAGAGAAACGGG + Intergenic
1156726721 18:40137355-40137377 TTTCAGAGGCAGAGTGAACAGGG + Intergenic
1157956363 18:52101882-52101904 TGGCTGCAGTAGAGTAAAAAGGG - Intergenic
1158069334 18:53452218-53452240 TCTCTGAAGCAGAGTTAAGAGGG + Intronic
1158092308 18:53728414-53728436 TTGCTGAAGAAGAAGGAAGAGGG + Intergenic
1159071529 18:63628169-63628191 TTTCTGAAGAAGAAAGAAAAAGG + Intergenic
1159434781 18:68401905-68401927 TTGCTTGAGCAGAGTGAAGAAGG + Intergenic
1159918158 18:74204083-74204105 TTTCTGAAGCAGAGCCAAAGAGG - Intergenic
1161226158 19:3146918-3146940 TGGCTGGAGCAGAGTGAGGAGGG - Intronic
1161243053 19:3233655-3233677 TGGCTGGAGCAGAGTGAGGAGGG + Intronic
1161253090 19:3291727-3291749 TGGCTGGAGCAGAGTGAGGAGGG + Intronic
1161257915 19:3320138-3320160 TGGCTGGAGCAGAGTGAGGAGGG + Intergenic
1161302981 19:3551839-3551861 TGGCTGGAGCAGAGAGAGAAGGG - Intronic
1161533854 19:4806651-4806673 TGGCTGGAGCAGAGTGACAAAGG + Intergenic
1161620913 19:5296680-5296702 TTGCTGGAGCAGAGTGAGGAAGG + Intronic
1161623205 19:5310064-5310086 TGGCTGGAGCAGAGTGAGGAGGG - Intronic
1161634217 19:5377170-5377192 TGGCTGGAGCAGAGTGAGGAAGG + Intergenic
1161642950 19:5435715-5435737 TGGCTGGAGCAGAGTGAGGAGGG - Intergenic
1161649338 19:5474753-5474775 TGGCTGGAGCAGAGTGAGGAAGG + Intergenic
1161649887 19:5477958-5477980 TGGCTGCAGCAGAGTGAGGAGGG - Intergenic
1161663815 19:5563082-5563104 TGGCTGGAGCAGAGTGAGGAAGG + Intergenic
1161719745 19:5896218-5896240 TGGCTGGAGCAGAGTGAGGAGGG + Intronic
1161756423 19:6137447-6137469 TGGCTGCAGCAGAGTGAGGAGGG + Intronic
1161854624 19:6756804-6756826 TAGCTGAAGCAGAGGGAATGAGG - Intronic
1161857043 19:6772138-6772160 TGGCTGGAGCACAGTGAAGAGGG + Intergenic
1162589807 19:11584115-11584137 TGGCTGGAGCAGAGTGAGCAAGG + Intronic
1162605005 19:11699884-11699906 CTGCTGAAACAGAGGAAAAAGGG - Intergenic
1162844470 19:13381799-13381821 TGGCTGAAGCAGAGCGAGCAAGG + Intronic
1162854892 19:13460661-13460683 TTGCTGTAGCTGAGTGACTAAGG - Intronic
1164270246 19:23666349-23666371 ATGCTGAAGCAAAGTTAAAAAGG - Intronic
1164557248 19:29263173-29263195 TTCCAGAACCAGAGAGAAAAGGG + Intergenic
1164791681 19:30990942-30990964 TTGCTGAAAGAGAGAGAAGAGGG - Intergenic
1164860668 19:31559859-31559881 TGGCTGAAACCGAGTGAGAAAGG - Intergenic
1166171695 19:41032198-41032220 TGGCTGAAATAGAGTGAAGAAGG + Intergenic
1166569642 19:43785301-43785323 CTGGTGAAGGAGAGTGAAGAGGG + Intergenic
1168468975 19:56625645-56625667 TGGCTGAAGCAGAGTGAGCAGGG - Exonic
1168472923 19:56654334-56654356 TGGCTGGAACAGAGTGAGAAAGG + Intronic
925626793 2:5849378-5849400 TTCCTGAATTAGAGTGAAGATGG - Intergenic
927238317 2:20898456-20898478 TAGCCGCAGCAGAGTTAAAAAGG - Intergenic
927553723 2:24018550-24018572 ATGCTGCAGCAGAGTGAGCAAGG + Intronic
928673661 2:33628524-33628546 TTGTTGTAGCAGAGGGAGAATGG - Intergenic
930997293 2:57735580-57735602 GAGTTGAAGTAGAGTGAAAATGG - Intergenic
931743072 2:65266426-65266448 TGGCTGGAGCAGAGTGAGCAAGG + Intronic
932254288 2:70270496-70270518 CAGCTGAAGCAGAGTGATATGGG - Intronic
932311313 2:70744600-70744622 TGGCTGAAGCTGAGTGGCAAAGG + Intronic
932610086 2:73192299-73192321 CTGCAAAAGGAGAGTGAAAAAGG + Intergenic
932741425 2:74293736-74293758 TTGGGGAAGCAGAGAGAGAAGGG - Intronic
935097154 2:99956365-99956387 TTCCTGAAGCAGAGCTGAAATGG + Intronic
935212756 2:100952522-100952544 TTGCCCAGGCAGAGTGCAAATGG - Intronic
936231371 2:110702491-110702513 TTGCAGAAGCTAAGTGTAAATGG - Intergenic
937420321 2:121748955-121748977 TTTCTGAAGAAGAGAGAGAAGGG + Intronic
937616819 2:123934103-123934125 TTCCTGAAGCACATTGAAAATGG + Intergenic
938509945 2:131930680-131930702 TTTCTGAAGAAGTGTAAAAATGG + Intergenic
938954689 2:136286794-136286816 TGACTGAAGCAGAATGAAAGAGG - Intergenic
939014467 2:136886107-136886129 ATGCAGGAGCAGAGTGAACATGG + Intronic
939523192 2:143258940-143258962 TTGCTGAAGCACCTTGAAAACGG + Intronic
940267738 2:151857804-151857826 TTGCTGGTGCAGAGTAAATAAGG - Intronic
940810486 2:158237384-158237406 TTGGAGAGGCAGAGTGGAAATGG + Intronic
941037920 2:160587728-160587750 TTGTTTAAGCAGAGTGCAAGAGG + Intergenic
941344774 2:164354511-164354533 TTGCAGAAGGAGAGTGCTAATGG - Intergenic
941422529 2:165300676-165300698 TGGCTGGAGCAGAGTGGGAAAGG + Intronic
941883994 2:170509739-170509761 TTACAGAAGCAGGGTGACAATGG - Intronic
942047165 2:172106472-172106494 GTGAGGAAGGAGAGTGAAAATGG - Intergenic
942324100 2:174760937-174760959 TGGCTGATGAAGATTGAAAAGGG - Intronic
942954559 2:181759119-181759141 TTGCAGAAGGTGAGTGAGAATGG + Intergenic
943185056 2:184597776-184597798 TTGCTAAAGCTGAGGGGAAAGGG - Intergenic
943493026 2:188580710-188580732 TTCTGGAAGCAGAGAGAAAAAGG - Intronic
944207176 2:197169098-197169120 TGGCTGAAGGAGAGTGAAGGAGG - Intronic
944586976 2:201181141-201181163 ATGCTGCAGCAGAGTGAGGAGGG - Intergenic
944866192 2:203864944-203864966 TTGCTTTAGCATAGTGATAAAGG + Intergenic
945286396 2:208086996-208087018 GTGCTGTAACAGAGTGAAATGGG + Intergenic
945684183 2:212949315-212949337 TGGCTGAAGCAGAGTCAAGTTGG - Intergenic
946105280 2:217363748-217363770 TTTCTGAGGGAGATTGAAAAAGG + Intronic
946364681 2:219241623-219241645 TGGCTGGAGCAGAGTGAACATGG + Intronic
946685999 2:222270589-222270611 TTGCCAAAATAGAGTGAAAAAGG + Intronic
947012989 2:225586856-225586878 TCTTTGTAGCAGAGTGAAAATGG - Intronic
948484005 2:238268438-238268460 TTGGTAAAGCAGACAGAAAAGGG + Intronic
1168809407 20:694445-694467 TGGCTGGAGCACAGTGAACAAGG + Intergenic
1169432094 20:5545603-5545625 TGGCTGAAGCAGGGTGTAAAAGG + Exonic
1170073327 20:12392230-12392252 TAGCAGAGGCAGAGTGAAAGTGG + Intergenic
1170731690 20:18981741-18981763 TTGCTGGACAAGAGTTAAAATGG + Intergenic
1171298868 20:24041998-24042020 TGGCTGAAACAGAGTGAGCAAGG - Intergenic
1171773758 20:29347294-29347316 TTGATGAAGATGAGTGAAGATGG - Intergenic
1171815770 20:29784843-29784865 TTGATGAAGATGAGTGAAGACGG - Intergenic
1171902596 20:30871194-30871216 TTGATGAAGATGAGTGAAGATGG + Intergenic
1173694986 20:45002682-45002704 TTGCTGAAGCTGAGTGATATAGG - Intronic
1173729703 20:45319701-45319723 TTGCTAATGCAAAGTGAAACCGG + Intergenic
1173860062 20:46277565-46277587 ATGGTGAAGGTGAGTGAAAAGGG + Intronic
1173888572 20:46484067-46484089 TTGCTGATTCAGACTGAAACTGG - Intergenic
1175644846 20:60662433-60662455 TGGCAGAAGCAGAGTTAAAGGGG - Intergenic
1175659568 20:60800983-60801005 TTGCTCCAACACAGTGAAAATGG - Intergenic
1175764336 20:61582340-61582362 TTGTTCAAGCGCAGTGAAAAAGG + Intronic
1176904731 21:14485854-14485876 TAGCTCAAGAAGAGTTAAAATGG + Exonic
1176987333 21:15453004-15453026 TTGCTAAAGTAGTGTGAAGAGGG - Intergenic
1177981584 21:27921703-27921725 TTTCTGAAGAAGTGTAAAAATGG - Intergenic
1178601567 21:33999203-33999225 TGGCTGGAGCAGGGTGACAAGGG - Intergenic
1179224536 21:39442268-39442290 TGGCTGAAGCCCAGTGAGAAGGG + Intronic
1180319221 22:11305410-11305432 TTGATGAAGATGAGTGAAGACGG - Intergenic
1180335986 22:11577162-11577184 TTGATGAAGATGAGTGAAGATGG + Intergenic
1180747054 22:18096854-18096876 TCTCTAAAGCAGTGTGAAAATGG - Exonic
1180933475 22:19608971-19608993 TGGCTGCAGCACAGTGAGAATGG - Intergenic
1180987471 22:19913299-19913321 CAGCTGAAGCTGAGTGAGAATGG + Intronic
1182263485 22:29093569-29093591 TTGATGAGGCACATTGAAAATGG - Intronic
1182761971 22:32729745-32729767 CTAGTGAAGCACAGTGAAAATGG - Intronic
1184320872 22:43741334-43741356 TAACTGAGGCAGAGTGAAAAGGG - Intronic
1184339032 22:43875494-43875516 TTCCTGAAGCTGTGTGAAGAAGG + Intergenic
1184982770 22:48105913-48105935 TTCCTGAAAAAGAGAGAAAAGGG - Intergenic
949109305 3:239408-239430 ATGCTGCAGCAGAGAAAAAAGGG - Intronic
949326431 3:2870452-2870474 TTTCTGAAGATGAGAGAAAAGGG + Intronic
950682665 3:14595769-14595791 ATGCTGAAGCTCAGGGAAAATGG - Intergenic
950924642 3:16728407-16728429 TTGGTGCAGGAGGGTGAAAAGGG + Intergenic
950983442 3:17333582-17333604 ATGCTTAAGCAGAGGGATAAGGG + Intronic
951092683 3:18593139-18593161 TTGCAGAAGTAGAGAAAAAAAGG + Intergenic
952163283 3:30717882-30717904 TTGGTGAAAAAGAGAGAAAAGGG + Intergenic
952197367 3:31090034-31090056 TTGCTGAAACAAAGTTCAAATGG + Intergenic
952235230 3:31472499-31472521 TGGCTGAAGCTGAGTGAGCAAGG - Intergenic
952254328 3:31682407-31682429 TGGCTGGAGCAGGGTGAACAGGG - Intronic
952461925 3:33536527-33536549 TGGCAGGAGCAGAGTGAACAAGG + Intronic
953276327 3:41502453-41502475 TTGCTCAAGAAAAATGAAAACGG + Intronic
953605628 3:44411441-44411463 TGGCTGGAGCAGAGGGAGAATGG - Intergenic
953711571 3:45275575-45275597 ATGCTGAAGCAGGGAGGAAATGG + Intergenic
954945065 3:54416373-54416395 TTGCTGGAGGAGACAGAAAAGGG - Intronic
955018566 3:55096310-55096332 TGGCTGCAGCAGAGTGAGCAAGG - Intergenic
955376242 3:58399716-58399738 TTGCTGATGCAGGGTCAGAAAGG - Intronic
955735362 3:62033133-62033155 AAGCTGGAGCAGAGAGAAAAGGG - Intronic
956373441 3:68588782-68588804 TGGCAGAAGCAGAGTGAATGAGG + Intergenic
956576692 3:70760047-70760069 TGGCTGGAGCAGAGTGAACAAGG + Intergenic
956697089 3:71927810-71927832 TTGGAGAAGCAAAGTGAAGATGG - Intergenic
957617391 3:82548037-82548059 TGGCTGCAACAGAGAGAAAAAGG + Intergenic
957631706 3:82724125-82724147 TTGCTGAAGTAGCTTGAACATGG + Intergenic
957824351 3:85421618-85421640 ATTCTGAAGCAGAGATAAAAAGG - Intronic
957980316 3:87501220-87501242 TTTCTGAATCAGACTGAGAAGGG - Intergenic
959166597 3:102787518-102787540 TTCCTGAAGAAGAGTGAAGCAGG - Intergenic
959270910 3:104208422-104208444 TTTCTATAGCAGCGTGAAAATGG + Intergenic
959399849 3:105886637-105886659 TTGCTGGAGCAGAGAGCAAGGGG - Intergenic
959439573 3:106359614-106359636 TTCCTGAAGGACAGTGGAAAAGG + Intergenic
959685763 3:109144235-109144257 TTGATCAGGCAGAATGAAAAAGG + Intergenic
960294591 3:115927635-115927657 TGGCCGAAGCAGAGTGAGCAAGG - Intronic
960520737 3:118652066-118652088 TTGTCAAAGCAGAGGGAAAAGGG + Intergenic
962100372 3:132335768-132335790 TTGCTGGAGAGGAGTGACAAGGG + Intronic
962220574 3:133561381-133561403 TTGCTGAAGTAGGTTAAAAATGG + Intergenic
962994666 3:140613979-140614001 TTGCTTAAGCAGGGAGGAAAAGG - Intergenic
963626335 3:147678752-147678774 TTGCTGAAGAAAAGGTAAAATGG - Intergenic
964081407 3:152763078-152763100 TGGCTGGAGCAGAGTGATTAAGG - Intergenic
964682829 3:159361419-159361441 TGGCTGAAGCAGAGAGAGCAAGG + Intronic
964809977 3:160652947-160652969 ATTCAAAAGCAGAGTGAAAATGG + Intergenic
964944338 3:162201379-162201401 ATGCTGAATTAGAATGAAAAAGG + Intergenic
965165625 3:165192638-165192660 TTGCTGAAGCTGAAGCAAAAGGG + Intronic
965232013 3:166066236-166066258 TTTGTGAACCAGAGTGAAGAAGG + Intergenic
966211974 3:177462975-177462997 TTCCTTAAGAAGAGGGAAAAGGG + Intergenic
966238367 3:177727954-177727976 TTGTTAAAGCACAGTGAGAAAGG + Intergenic
966247343 3:177824153-177824175 TTGCTGAAGAACAGTGGCAAAGG + Intergenic
966385589 3:179394264-179394286 TTTCTGATGCACAGTGAAATTGG + Exonic
966605853 3:181820929-181820951 TGGCTGGAGCAGAGTGAGCAGGG - Intergenic
966704537 3:182896372-182896394 TTGCTGTTGCACAGTAAAAATGG - Intronic
967805056 3:193708400-193708422 TGTCTGAAGCACAGGGAAAAAGG - Intergenic
969587372 4:8102163-8102185 TGGCTGAAGCAGAATGACCAAGG - Intronic
969698432 4:8749108-8749130 TCTCTGAAGCACAGTGCAAAAGG + Intergenic
969980902 4:11153139-11153161 TTTCTGTAACAGACTGAAAATGG + Intergenic
970276016 4:14402155-14402177 CTGCTGAAGCAGAAGGAAAAGGG + Intergenic
970873397 4:20842377-20842399 TGGCTGGAGCAGAGTAAATAGGG + Intronic
971091951 4:23355958-23355980 TGGCTGGAGTAGAGTGAGAAAGG + Intergenic
971482303 4:27125578-27125600 TGGCTGGAGCAGAGGGAAAGGGG - Intergenic
971507879 4:27386257-27386279 TAGCTGAAGCAGAGTGAATAGGG - Intergenic
971864357 4:32150187-32150209 TTGTTGAAGAGTAGTGAAAATGG + Intergenic
972130313 4:35824896-35824918 TTGCTGCTGCCGTGTGAAAAAGG - Intergenic
972133879 4:35866940-35866962 TTTCTGAGTCAGAGGGAAAATGG - Intergenic
972600800 4:40570612-40570634 TTCCTGAAGCAGAAGGAAAATGG + Intronic
972623037 4:40767654-40767676 TTGCTCAAGCTAAGTGAAGATGG - Intronic
972715248 4:41639644-41639666 TTTCTGAAGCAGAGTTAATGTGG - Intronic
973167658 4:47097243-47097265 TGGCTGGAGCAGAGTGAGAAAGG - Intronic
973270528 4:48257936-48257958 ATGCTGAAGCAACATGAAAATGG + Intronic
973294508 4:48502125-48502147 TTGATAAAGCAAAGTGAAACCGG + Intronic
973604269 4:52571053-52571075 TAGCTGAATCAGGGAGAAAATGG + Intergenic
975329850 4:73100310-73100332 ATGCTGCAGCAGAGTGAGCAAGG + Intronic
975344001 4:73273414-73273436 TTGCTGAAACAGAATTAATAAGG - Intergenic
976229401 4:82825596-82825618 TAGCTGGAGCAGAGAGAACAAGG + Intronic
976254449 4:83085398-83085420 TAGCTGAAGCAGAGAGAAGGTGG - Intergenic
976458991 4:85285439-85285461 TTGCTGAAGCAGAGTGTTAGAGG - Intergenic
976534930 4:86201305-86201327 TTGCTGCAGGAGATTGAAAATGG - Intronic
976757288 4:88512371-88512393 ATTCTCAAGCAGAGAGAAAATGG + Intergenic
977086177 4:92601522-92601544 TAGCTGAAGCAGTGTCAAGAGGG + Intronic
977106967 4:92898598-92898620 TTGCAGAAGAGGAGAGAAAAAGG + Intronic
978270154 4:106878967-106878989 GTGCTCAAGCAGGGTGAGAAGGG - Intergenic
978312409 4:107399039-107399061 TGGCTAAAACAGAGTGAACAAGG + Intergenic
978337004 4:107680110-107680132 TCCCAGAAGAAGAGTGAAAAAGG + Intronic
979527766 4:121735547-121735569 TTGCTGATGCAGAATGTGAAAGG - Intergenic
980091431 4:128447242-128447264 TGGCTGAAGCAGAGTGAATGAGG + Intergenic
980279477 4:130700891-130700913 TTGATGAAGCAGGAAGAAAACGG + Intergenic
980326325 4:131352056-131352078 TTTCTGAAGCAGAGAGAAAGCGG + Intergenic
981184373 4:141783556-141783578 TTGCTGCTGCCAAGTGAAAAAGG - Intergenic
981195382 4:141913890-141913912 TTACTGAAGTAGAGTGAGACTGG + Intergenic
982195388 4:152906789-152906811 TGACTGCAGCAGAGTGAATAAGG - Intronic
982344692 4:154344644-154344666 TTGCAGAAACAGAAGGAAAAAGG + Intronic
982346481 4:154366053-154366075 ATGCTGAAGTATATTGAAAATGG - Intronic
982413496 4:155105837-155105859 TGGATGAAGCAGAGTGAAGCGGG + Intergenic
982834780 4:160109951-160109973 TTGCTAAAGTATAGTGAAAGTGG + Intergenic
983671313 4:170241043-170241065 TGGCTGAAGTAGAGTGAGCAGGG - Intergenic
983987588 4:174078917-174078939 GTGATGGAGCACAGTGAAAATGG - Intergenic
984412569 4:179413506-179413528 TATCTGAAGCTGATTGAAAATGG + Intergenic
987008983 5:13740477-13740499 TGGCTAGAGCAAAGTGAAAAAGG - Intronic
987797260 5:22644195-22644217 ATGGTGAAGCATAGTGAAGAAGG + Intronic
988714051 5:33807111-33807133 TTGCTGAAACAGACAGAGAAAGG - Intronic
990231650 5:53718965-53718987 TAGCTAAAGCAGAGTTAAGAGGG + Intergenic
990327416 5:54692102-54692124 TCTCTGTAGCAGTGTGAAAATGG - Intergenic
990711078 5:58581667-58581689 TAACGGAGGCAGAGTGAAAAAGG - Intergenic
992992356 5:82297261-82297283 TAGCGGAAGCAGAGAGAGAAGGG + Intronic
993206459 5:84887253-84887275 TTTTAGAAGCATAGTGAAAAAGG - Intergenic
993668524 5:90731072-90731094 TTTCTAAAGCAGTGTGAGAATGG - Intronic
994844576 5:104970933-104970955 AAGGTGAAGCATAGTGAAAATGG + Intergenic
994966128 5:106673262-106673284 TTGATAAAGTAGAGAGAAAATGG - Intergenic
995329038 5:110926085-110926107 TTGCTAAGGCTGAGTGAAAGGGG - Intergenic
996037173 5:118771404-118771426 TTACTGAACAGGAGTGAAAATGG - Intergenic
998672659 5:144371174-144371196 TTGTTGAAGCAGAGTGAGGCAGG - Intronic
1000157019 5:158562266-158562288 TTACTGGAGAAGAGTGAACAGGG - Intergenic
1001956054 5:175848908-175848930 TGGCTGAAGCAGAGTGAGCCGGG + Intronic
1002408680 5:179056007-179056029 TTGCTGAAGCAGAAAGAAAAGGG - Intergenic
1002776023 6:327943-327965 ATGCTGAAGCACTGTGAAAATGG + Intronic
1003096990 6:3149957-3149979 TAGAAGAAGCAGAATGAAAAAGG + Intronic
1003336790 6:5180969-5180991 TTGCTTGAGAAAAGTGAAAAGGG - Intronic
1003715289 6:8639548-8639570 TTGCTGGAGCTGTGTGATAATGG + Intergenic
1004057773 6:12158436-12158458 TTTCTGAGGCATAGTGCAAAAGG - Intronic
1004549403 6:16632164-16632186 TTGGGGAAGAAGAGTGAATAGGG - Intronic
1004956262 6:20731086-20731108 TGGCTGAAACAGAGTGAATGAGG + Intronic
1005236985 6:23775627-23775649 GACCTGGAGCAGAGTGAAAATGG + Intergenic
1006127096 6:31846035-31846057 TGGCTGAAGCAGAGTGGAAATGG - Intergenic
1006191132 6:32210267-32210289 TTGCTGGAGCAGAGAGTAGAAGG + Intronic
1006470784 6:34227466-34227488 TGGTTGAATGAGAGTGAAAAGGG - Intergenic
1006474599 6:34246062-34246084 ATGCTGCAGCAGAGTGAGCAAGG + Exonic
1007703193 6:43776148-43776170 ATGCTGAAACAGGCTGAAAAAGG - Intronic
1008069124 6:47081590-47081612 TTTCTGAAACACAGTGAATACGG - Intergenic
1008661353 6:53671325-53671347 TTGTTGAAACAGAATGCAAACGG - Intergenic
1008705775 6:54157353-54157375 CTGCAGGAGCAGAGTGAAGAGGG - Intronic
1008838713 6:55870348-55870370 TTGTTGAAGAAGAGAGAAAAAGG + Intronic
1009822803 6:68826433-68826455 TGGCTGGAGCAGAGTGATCATGG + Intronic
1010114195 6:72282300-72282322 TTCCTGAAGCACAGGGAAGAAGG - Intronic
1010126838 6:72442351-72442373 TTACAGAAGCAAAGGGAAAAAGG - Intergenic
1011388922 6:86829397-86829419 TACCTGAAGCAGAGTGAATGAGG + Intergenic
1011589740 6:88960801-88960823 TTCCTGAATCAGAAAGAAAATGG - Intronic
1012880939 6:104788719-104788741 TTTTTGAAGCACAGTGAACATGG - Intronic
1013070399 6:106723946-106723968 TGGCTGGAGTAGAGTGAAGAGGG + Intergenic
1014599490 6:123392076-123392098 TTGATGAAGCACAGTGAACAAGG - Intronic
1015519124 6:134114122-134114144 ATGCTGCAGCAGAGTGAGGAGGG - Intergenic
1015851238 6:137574787-137574809 TTGGGAAAGAAGAGTGAAAAAGG + Intergenic
1016157723 6:140833493-140833515 ATTCTGAAGCAGAGTCATAAAGG + Intergenic
1016599672 6:145843992-145844014 TTGCTATGGCAGTGTGAAAACGG - Intergenic
1016663498 6:146608524-146608546 CTGCTAAAGCAGTGTTAAAAGGG - Intronic
1016817604 6:148317951-148317973 TTCCTGAAGCTGAGAGACAAGGG - Intronic
1017207329 6:151817508-151817530 TTTCAGAAGCAGAGGGTAAAAGG + Intronic
1021241637 7:18209169-18209191 TTGTTGAATCAGAATGTAAAAGG - Intronic
1021372604 7:19868090-19868112 TTTCTCAAGCACAGTGAACAAGG - Intergenic
1022364841 7:29702423-29702445 TTGGGGAAGCAGAGAGTAAATGG + Intergenic
1023483764 7:40662504-40662526 TGGCAGAAGCACAGTGAACAAGG - Intronic
1023680698 7:42684489-42684511 AGGCTGAAGCAGAGTAAATAGGG + Intergenic
1024340953 7:48258763-48258785 TAGCTAAAGCAGTGTGAAGAGGG - Intronic
1024825062 7:53381568-53381590 GTGCAGAAGCTGAGGGAAAAAGG - Intergenic
1025633957 7:63305104-63305126 TGTCTGTAGCAGTGTGAAAATGG + Intergenic
1025648740 7:63443064-63443086 TGTCTGTAGCAGTGTGAAAATGG - Intergenic
1026543161 7:71298525-71298547 TTTCTGAACCAGAAAGAAAAAGG - Intronic
1028276389 7:88863104-88863126 TTGCTGTAGCATAGTGAGCACGG - Intronic
1028661542 7:93283042-93283064 TTGATGATCCAGAGAGAAAATGG - Intronic
1030303279 7:107995413-107995435 TTGCTGCTGCATAGAGAAAAAGG - Intronic
1032445138 7:131975889-131975911 TGGATGGAGCAGAGTGAACAAGG - Intergenic
1032550283 7:132778368-132778390 TGGCCCCAGCAGAGTGAAAAAGG - Intergenic
1033871432 7:145758735-145758757 TGGCTGAAGCTGAGTGAGTAGGG - Intergenic
1035077273 7:156189004-156189026 TCGCTGCAGCAGAGTGACAGAGG - Intergenic
1036741283 8:11363956-11363978 TTGTGAAAGTAGAGTGAAAAAGG - Intergenic
1037252887 8:16918134-16918156 TTGCTGAAATAAAGTGAAAATGG + Intergenic
1038142133 8:24857336-24857358 TAACTCAAGCAGAGTAAAAAGGG - Intergenic
1038359500 8:26863694-26863716 ATTCTGTAGCAGAGTGAAAATGG + Intronic
1039580002 8:38657727-38657749 CAGCTCAAGCAGAGTGAGAATGG - Intergenic
1039662243 8:39480194-39480216 TTGCTTAAGCAGGGTGCTAAGGG - Intergenic
1040257040 8:45686726-45686748 TTTCTGAACTATAGTGAAAAAGG + Intergenic
1041365243 8:57095838-57095860 TGGCTGAAGAAAAGGGAAAATGG - Intergenic
1042101834 8:65282538-65282560 TTGTTATAGCAGTGTGAAAATGG + Intergenic
1042351556 8:67782502-67782524 TTGCTGCAGCCATGTGAAAAAGG - Intergenic
1043284188 8:78509199-78509221 TCCCAGAAGCAAAGTGAAAAGGG - Intergenic
1044186253 8:89255263-89255285 TCGCTGTAGCAGTGTGAAAATGG - Intergenic
1044576287 8:93773268-93773290 TGGCTGGAGCAGAGTGAGCAGGG + Intronic
1045657336 8:104400289-104400311 TTTCTGAGGCAGAGTTCAAAAGG + Intronic
1046412071 8:113858854-113858876 GTGCTGTAGGAGAATGAAAAAGG - Intergenic
1046949283 8:120004389-120004411 CTGCTAAAGTAGAATGAAAAAGG + Intronic
1046956610 8:120068937-120068959 TTGTTAAAGCAGATTGCAAAGGG - Intronic
1047236817 8:123048900-123048922 AGGCTGGAGCAGAGTGACAAGGG - Intronic
1047799696 8:128295977-128295999 TTGCTGACATAGACTGAAAAGGG + Intergenic
1047879748 8:129180207-129180229 TGGGTGAAGAAGGGTGAAAATGG - Intergenic
1048477162 8:134754097-134754119 CTGGGGAAGCAGGGTGAAAAAGG + Intergenic
1049137470 8:140916367-140916389 TGGCTGGAACAGAGTGAATACGG - Intronic
1050040935 9:1492708-1492730 TTGCTGAAGCACAAAGAAAAGGG - Intergenic
1050438630 9:5635948-5635970 TTGTTATAGCAGTGTGAAAATGG + Intronic
1050659694 9:7870769-7870791 TTGTTGAAACAGTGTGCAAATGG + Intronic
1051100541 9:13515881-13515903 TAGCTGGAGCAGAGAGAATAAGG + Intergenic
1051718649 9:20011603-20011625 TTCCTGAAGGAGAGAGAAAAGGG + Intergenic
1052030109 9:23618936-23618958 TTGCTGGAGCAGAGTGAGCAGGG - Intergenic
1052348592 9:27435216-27435238 TTGCTGAAACAAATTAAAAAAGG - Intronic
1053008214 9:34618407-34618429 TTGGTGAAGGAGGGTAAAAAGGG - Intronic
1055064648 9:72106692-72106714 TTGCTGATGCTGAGTGAAATAGG + Intergenic
1056023827 9:82470051-82470073 TTTCTTAAGAAGAGAGAAAAGGG + Intergenic
1056128260 9:83558364-83558386 TTGGAGAAGTAAAGTGAAAATGG + Intergenic
1056339763 9:85615262-85615284 TTGCTGAAGACTAGGGAAAATGG - Intronic
1056493107 9:87127263-87127285 TGGCTGGAGCAGAGTGAATGTGG - Intergenic
1057500180 9:95590622-95590644 TGGCTGGAGCAGAGTAAACAAGG - Intergenic
1057997412 9:99830755-99830777 ATGCTGAAGGACAGTGAAACTGG + Intronic
1058045763 9:100354951-100354973 TGACTGGAGCAGAGTAAAAAAGG - Intergenic
1058201667 9:102050012-102050034 TGCCTGAAGCACAGTGAGAAAGG - Intergenic
1058353040 9:104049416-104049438 TAGATGGAGCACAGTGAAAATGG + Intergenic
1060952028 9:127610067-127610089 GTGCTGAAGCAGATGGAGAAGGG - Intergenic
1203367448 Un_KI270442v1:271159-271181 TTGATGAAGATGAGTGAAGACGG - Intergenic
1187765462 X:22636920-22636942 TAGCTGGAGCTGAGTGAGAAAGG + Intergenic
1188020688 X:25153897-25153919 TAGCTGAATCAGAGTGAATTAGG + Intergenic
1189131491 X:38502687-38502709 GTGCAGAAGCACAGAGAAAAGGG - Intronic
1190393838 X:49959873-49959895 TTGCTGAAGCAGAGTGAAAATGG - Intronic
1190632683 X:52403008-52403030 TTTCTGTAGCAGAGTAAAATAGG + Intergenic
1190981880 X:55463618-55463640 CTGCTGAAGCAGAGGAGAAATGG + Intergenic
1190986818 X:55509562-55509584 CTGCTGAAGCAGAGGAGAAATGG - Intergenic
1192273824 X:69610115-69610137 TGACTGGAGCAGAGTGAACAAGG + Intergenic
1192322081 X:70098119-70098141 TGGCTGGAGCAGAGTGAACAAGG + Intergenic
1193193949 X:78607488-78607510 TGGCTGAAGCAGTGTTTAAAGGG + Intergenic
1193714354 X:84920409-84920431 TCTCTGTAGCAGTGTGAAAATGG - Intergenic
1193996187 X:88367771-88367793 TTTTTGTAGCAGTGTGAAAATGG - Intergenic
1193997804 X:88388130-88388152 TGGCAAAAGCAGAATGAAAAAGG + Intergenic
1194352062 X:92833235-92833257 TCTCTTGAGCAGAGTGAAAAAGG + Intergenic
1194700082 X:97103405-97103427 TTAAGGAAGCAGAGAGAAAAAGG - Intronic
1196940235 X:120768434-120768456 AGGCTGAAGCAGAGTGAATGAGG + Intergenic
1197157827 X:123289565-123289587 TTTCTGAGGCACAGTGAAATTGG + Intronic
1197881736 X:131173772-131173794 TGGCTAAAGCAGAGTGATTAAGG + Intergenic
1198886750 X:141347220-141347242 TAGCTGAAACAGTGTGAAAGAGG + Intergenic
1199177060 X:144801633-144801655 TGGCTGAAGCATAATGAGAAAGG - Intergenic
1199293740 X:146134376-146134398 TTGTTATAGCAGTGTGAAAATGG - Intergenic
1199570093 X:149258646-149258668 TTGCTGCAGCACAATAAAAATGG - Intergenic
1199639323 X:149845087-149845109 TCTTTGAAGCAGAGTCAAAAAGG - Intergenic
1199762520 X:150916112-150916134 TTTCTGAAGCAGAGTGAATGAGG - Intergenic
1200405338 Y:2804921-2804943 CAGCTAAAGCAGAGTTAAAAGGG - Intergenic
1200660369 Y:5949921-5949943 TCCCTTGAGCAGAGTGAAAAAGG + Intergenic
1200699774 Y:6392174-6392196 TGGCTCAAGCAGAGCCAAAAGGG + Intergenic
1201034337 Y:9772524-9772546 TGGCTCAAGCAGAGCCAAAAGGG - Intergenic
1201330072 Y:12809050-12809072 TGGCTGAGGCAGGATGAAAAAGG + Intronic
1201737459 Y:17284162-17284184 TTGCTCTAGCAGAGCTAAAATGG + Intergenic
1202039182 Y:20664888-20664910 TTCCTGAAGCAGCCTGAAAAAGG - Intergenic