ID: 1190394214

View in Genome Browser
Species Human (GRCh38)
Location X:49963423-49963445
Sequence ATGTACACACATATGGATTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 386
Summary {0: 1, 1: 0, 2: 3, 3: 24, 4: 358}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190394214_1190394221 30 Left 1190394214 X:49963423-49963445 CCCCAATCCATATGTGTGTACAT 0: 1
1: 0
2: 3
3: 24
4: 358
Right 1190394221 X:49963476-49963498 AAGGTACTTTACTTGTTATCTGG 0: 1
1: 0
2: 0
3: 18
4: 175
1190394214_1190394219 11 Left 1190394214 X:49963423-49963445 CCCCAATCCATATGTGTGTACAT 0: 1
1: 0
2: 3
3: 24
4: 358
Right 1190394219 X:49963457-49963479 AACCAGGCAGCTTCTTTTGAAGG 0: 1
1: 0
2: 0
3: 25
4: 241
1190394214_1190394218 -5 Left 1190394214 X:49963423-49963445 CCCCAATCCATATGTGTGTACAT 0: 1
1: 0
2: 3
3: 24
4: 358
Right 1190394218 X:49963441-49963463 TACATATGTGTACATAAACCAGG 0: 1
1: 0
2: 4
3: 18
4: 318

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190394214 Original CRISPR ATGTACACACATATGGATTG GGG (reversed) Intronic
900536476 1:3180313-3180335 ACGTACACACAGGTGGAGTGAGG + Intronic
902563859 1:17296890-17296912 ATGTTCATATATATGGAGTGAGG - Intergenic
903184019 1:21619382-21619404 ATCTACACAGATATGTGTTGAGG + Intronic
903199048 1:21718170-21718192 ATGTACACACAGATGCAGTGAGG - Intronic
904075837 1:27841601-27841623 ATGTAGTCACATATGGCTAGTGG + Intronic
908504537 1:64783178-64783200 ATGCACACATATATTTATTGCGG - Intronic
908942220 1:69449108-69449130 GTGTACTCACATGTGCATTGGGG - Intergenic
910213009 1:84813189-84813211 ATATACACACACATGCATGGAGG + Exonic
910531693 1:88243461-88243483 ATGCACACACATGTTTATTGTGG + Intergenic
911120142 1:94287950-94287972 ATGTACACGCATGTTTATTGCGG - Intergenic
911791312 1:102018956-102018978 ATGCACACATATATTTATTGTGG + Intergenic
911891388 1:103377003-103377025 ATGTACACATATGTTTATTGAGG + Intergenic
912742850 1:112217337-112217359 ATGCACACATATATTTATTGTGG + Intergenic
912866172 1:113258948-113258970 ATATACACACATATATTTTGAGG - Intergenic
912872207 1:113318708-113318730 ATGCACACATATATTTATTGCGG + Intergenic
915682260 1:157592779-157592801 ATGTACACATATGTTTATTGTGG + Intronic
916274289 1:162977126-162977148 ATGTACACACAATTGGTTGGGGG + Intergenic
916624998 1:166546008-166546030 GTGTACATATATATGAATTGTGG + Intergenic
917746459 1:178013151-178013173 ATGTACACACATGTTTATAGTGG - Intergenic
918946920 1:191078202-191078224 ATGCACACGTATATGTATTGTGG - Intergenic
919063415 1:192663407-192663429 ATGCACACATATATTTATTGTGG - Intergenic
919376579 1:196801814-196801836 ATGTACAGACACATGGATTATGG - Intergenic
919386279 1:196926725-196926747 ATGTACAGACACATGGATTATGG - Intronic
920088729 1:203437187-203437209 ATGCACACATATATTTATTGAGG + Intergenic
921267189 1:213430993-213431015 ATGGACACAGAAATGGGTTGGGG + Intergenic
1063308578 10:4931275-4931297 AGGTACACACATATACATGGAGG + Intronic
1063728037 10:8661284-8661306 ATATATACACATATGTATTCGGG + Intergenic
1063748843 10:8918959-8918981 ATCTATAAACATATGGATTGAGG - Intergenic
1064105698 10:12499370-12499392 ATGCATGCAGATATGGATTGTGG - Intronic
1064469367 10:15619823-15619845 ATGTCAACAGATATGGATTCAGG - Intronic
1066155842 10:32676913-32676935 ATGCACACATATATTTATTGCGG + Intronic
1066821043 10:39490049-39490071 ATGCACACATATATTTATTGTGG - Intergenic
1067515891 10:46943016-46943038 ATGTAAAAACATGTGGTTTGTGG + Intronic
1067646359 10:48108794-48108816 ATGTAAAAACATGTGGTTTGTGG - Intergenic
1068209940 10:53908393-53908415 ATGTGCATGCAGATGGATTGAGG - Intronic
1069040648 10:63692296-63692318 ATGTTCACACATATGAATTGAGG - Intergenic
1069224866 10:65930049-65930071 ATGTGCACACAAATGTGTTGTGG - Intronic
1069346603 10:67477267-67477289 AGGTACAAACATCTGGACTGAGG - Intronic
1071163655 10:82780169-82780191 ATGTACACATATGTTTATTGTGG - Intronic
1072872813 10:99138434-99138456 ATGCACACACATGTTTATTGTGG + Intronic
1075491310 10:122872479-122872501 ATGCACACATATATTTATTGTGG + Intronic
1075497978 10:122944068-122944090 ATGCACACATATATTTATTGTGG + Intronic
1078690511 11:13575450-13575472 ATGTACACATATGTTTATTGTGG + Intergenic
1080864765 11:36183742-36183764 AGGTTAACAGATATGGATTGAGG - Intronic
1082056621 11:47823017-47823039 ATGCACACATATATTTATTGTGG - Intronic
1082208495 11:49468259-49468281 ATGTACACACATATATATGCAGG - Intergenic
1082298557 11:50475406-50475428 ATGCACACATATATTTATTGTGG + Intergenic
1082903059 11:58277240-58277262 ATATACACACATATATATAGTGG + Intergenic
1084164319 11:67367927-67367949 ATGTACACACATATACATGTTGG - Intronic
1086661528 11:89425363-89425385 ATGCAAAGACATATGGATGGGGG + Intronic
1086777699 11:90860051-90860073 ATGCACACATATATTTATTGCGG + Intergenic
1086779382 11:90883115-90883137 ATGCACACATATATTTATTGTGG + Intergenic
1087995027 11:104795177-104795199 ATGTTTACACATATGGCTTGAGG + Intergenic
1088939672 11:114440091-114440113 ATGTTCTCACTTATGGAATGAGG - Intronic
1090022441 11:123139954-123139976 ATTTACACTCACATGAATTGGGG - Intronic
1090266755 11:125358270-125358292 ATGTGCACACACAGGGATTCTGG + Intronic
1092314395 12:7395137-7395159 ATGTACACATATGTTTATTGCGG + Intronic
1092451464 12:8606228-8606250 ATGTAAACCCATCTGGATTTTGG + Intronic
1093406096 12:18806610-18806632 AGGAACACACATCTAGATTGTGG - Intergenic
1093988032 12:25559493-25559515 ATGCACACACATGTTTATTGCGG - Intronic
1095239302 12:39838034-39838056 ATGCACACATATATTTATTGTGG + Intronic
1096029146 12:48396339-48396361 ATGCACACACATGTTTATTGCGG + Intergenic
1096150762 12:49310445-49310467 ATGTACACATATGTTTATTGCGG - Intergenic
1096619691 12:52856157-52856179 ATGCACACATATGTGTATTGTGG + Intergenic
1097471884 12:60003510-60003532 ATGTACCCATATGTTGATTGTGG - Intergenic
1097562199 12:61221335-61221357 ATGCACACATATATTTATTGTGG - Intergenic
1097927750 12:65148530-65148552 ATACACACACATATTGCTTGTGG - Intergenic
1099045103 12:77707509-77707531 ATGCACACATATATTCATTGTGG - Intergenic
1099106004 12:78497122-78497144 ATGCACACATATATTTATTGCGG - Intergenic
1099377428 12:81908827-81908849 ATGCACACATATGTGTATTGCGG - Intergenic
1099486416 12:83233784-83233806 ATGCACACACATGTTTATTGCGG - Intergenic
1100876351 12:98966592-98966614 ATGCACACATATGTGTATTGTGG + Intronic
1101315566 12:103625806-103625828 ATGCACACACATGTTTATTGCGG - Intronic
1102503973 12:113372369-113372391 CTGAACACACATATAGATTGGGG + Intronic
1104210043 12:126679904-126679926 ACACACACACATATGCATTGTGG - Intergenic
1105445398 13:20450754-20450776 ATGCACACACATGTTCATTGTGG + Intronic
1106853689 13:33823335-33823357 ATGTACAGAGATATTAATTGTGG + Intronic
1106937697 13:34741256-34741278 ATATACACACATATATATTATGG - Intergenic
1107810386 13:44194663-44194685 ATGCACACATATATTTATTGCGG - Intergenic
1108170841 13:47740427-47740449 ATGTACACATATGTTTATTGCGG + Intergenic
1108170919 13:47741153-47741175 ATGTACACATATGTTTATTGCGG + Intergenic
1108791825 13:53978588-53978610 ATGCAAAGACATATGGAGTGAGG + Intergenic
1109050858 13:57479476-57479498 ATGCACACATATATTTATTGTGG + Intergenic
1110064339 13:71084357-71084379 ATATACACACATATATATAGAGG + Intergenic
1111002507 13:82204686-82204708 TTGTTCACACACATGTATTGTGG - Intergenic
1111216505 13:85149607-85149629 ATATATACACATATGTATTCTGG - Intergenic
1111370165 13:87307007-87307029 ATGTGCACACATGTTTATTGCGG + Intergenic
1111694192 13:91602947-91602969 ATTCAAACAAATATGGATTGAGG - Intronic
1111705257 13:91740559-91740581 ATATAAACAGAAATGGATTGGGG - Intronic
1112087884 13:96051025-96051047 ATGCACACACATGTTTATTGCGG + Intronic
1112779191 13:102879479-102879501 ATGTATACACAGATGAATCGAGG - Intergenic
1112801686 13:103118241-103118263 ATGCACACATATATTTATTGTGG - Intergenic
1112886783 13:104183495-104183517 ATGCACACATATATTTATTGCGG - Intergenic
1113016077 13:105829633-105829655 TTGTACACGCATATTGATAGAGG - Intergenic
1113640899 13:111956054-111956076 ATTTACACACATTTTAATTGGGG + Intergenic
1114044210 14:18707812-18707834 ATGCACACATATATTTATTGTGG + Intergenic
1114396387 14:22366403-22366425 ATGAACACATATGTGTATTGTGG + Intergenic
1115048126 14:29023280-29023302 ATGCACACATATATTTATTGTGG - Intergenic
1116533529 14:46002413-46002435 ATGTACACTTATATGTATTTTGG - Intergenic
1116615984 14:47139896-47139918 ATATATACACATATGGAGAGAGG + Intronic
1117281934 14:54249504-54249526 ATGTACACACAAATGTATATTGG - Intergenic
1120094196 14:80369303-80369325 ATGTACACGCATGTTTATTGAGG + Intronic
1121056057 14:90854017-90854039 GTGTATACACACATGTATTGGGG - Exonic
1121568415 14:94927987-94928009 ATACACACACATATGTATAGTGG + Intergenic
1121849130 14:97203289-97203311 ATGTACACACATGTGCATCCAGG - Intergenic
1125490678 15:40146482-40146504 ATGTATACACATATAGAGAGAGG + Intergenic
1125984547 15:44037435-44037457 ATGTACACGTATGTGTATTGAGG - Intronic
1129610180 15:77047338-77047360 ATGTAGACACATGTGGCTAGTGG + Intronic
1130845228 15:87737750-87737772 ATGCACACATATATTTATTGTGG - Intergenic
1131581052 15:93644016-93644038 ATAATCAGACATATGGATTGTGG - Intergenic
1131740192 15:95381467-95381489 ATGCAGACACCCATGGATTGGGG + Intergenic
1132031523 15:98441920-98441942 ACACACACACATATGGATTTGGG - Intronic
1133333773 16:4992845-4992867 ATGTACACACATATGTGTGTGGG - Intronic
1134592773 16:15469335-15469357 AAGAATACACATATAGATTGAGG - Intronic
1136192644 16:28626271-28626293 ATGTACACATATGTTTATTGCGG - Intergenic
1136908427 16:34124765-34124787 ATGCACACATATGTTGATTGCGG - Intergenic
1141538186 16:84698235-84698257 ATGTACACACATAAACATTCAGG - Intergenic
1146500814 17:33362940-33362962 ATTTACACACATATAGTTTTAGG - Intronic
1148601504 17:48897811-48897833 ATGTACCCACATATACAATGAGG - Intergenic
1149743647 17:59073178-59073200 ATGTACACACATAGTAATTGTGG - Intronic
1149981164 17:61312555-61312577 TTGAACAAACATATGTATTGTGG + Intronic
1152285824 17:79412806-79412828 ATATACACACACATGCATAGAGG - Intronic
1153017028 18:592578-592600 ATATACACACATATGTATGTGGG + Intergenic
1153633782 18:7096678-7096700 ATATATACACATATGGAATGGGG - Intronic
1153721277 18:7905948-7905970 CCATACACACATTTGGATTGTGG - Intronic
1155385433 18:25272455-25272477 ATGTACACATATGTTTATTGTGG + Intronic
1155790335 18:29959901-29959923 ATGTACACGTATATTTATTGTGG - Intergenic
1156002499 18:32400867-32400889 ATGTACACATATGTTTATTGTGG + Intronic
1156084449 18:33382240-33382262 ATGTATACATATATCTATTGGGG - Intronic
1157008566 18:43617950-43617972 ATGCACACACATGTTTATTGTGG + Intergenic
1157987019 18:52449650-52449672 ATGTACTCTGATATGGTTTGGGG + Intronic
1158286296 18:55887861-55887883 ATGCACACACATGTTTATTGCGG - Intergenic
1159705482 18:71680541-71680563 GTGTCCAAACATATGGATTTGGG - Intergenic
1160010393 18:75102982-75103004 ATGCAAACACATGTGGACTGTGG + Intergenic
1160294841 18:77628389-77628411 TTGTACACACATGGGGATTATGG + Intergenic
1162135502 19:8552739-8552761 AGGTAAACAGATATGGATTCAGG - Intronic
1164132534 19:22378215-22378237 ATGCACACATATGTGTATTGCGG - Intergenic
1164904164 19:31953430-31953452 GTGTACACACATAGGGGCTGGGG + Intergenic
1165261208 19:34620221-34620243 ATGTACACATATGTTTATTGTGG + Intronic
1168555944 19:57339985-57340007 ATGTAGACACAAATGGATTAGGG + Intergenic
925095463 2:1195175-1195197 ATGCACACACATGTTTATTGTGG - Intronic
925553978 2:5108114-5108136 ATGTACACGTATATTTATTGCGG - Intergenic
926761638 2:16283528-16283550 AGGTACACACATTTGCCTTGTGG - Intergenic
928376935 2:30782864-30782886 AAGTATCCACATATGGCTTGTGG - Intronic
929237462 2:39621487-39621509 AGGTACACAAATAAGGATTCAGG + Intergenic
929413058 2:41719101-41719123 ATACACAGACAAATGGATTGTGG - Intergenic
930440391 2:51397166-51397188 ATGCACACATATATTTATTGCGG + Intergenic
930557797 2:52921898-52921920 ATGAAGGCACATCTGGATTGAGG + Intergenic
930862058 2:56084778-56084800 GTGTATAGACATATGGTTTGTGG - Intergenic
932868221 2:75369337-75369359 ATGCACACATATATTTATTGTGG - Intergenic
933072058 2:77871292-77871314 ATGCACACATATATTTATTGCGG - Intergenic
933547881 2:83738358-83738380 ATGTACACACATGTTTATTGTGG - Intergenic
933603670 2:84359510-84359532 ATGTACACATATGTTTATTGTGG + Intergenic
934693908 2:96384661-96384683 ATGTACACATATGTTTATTGCGG + Intergenic
934701620 2:96446136-96446158 ATGTACACATATGTTTATTGCGG + Intergenic
937602843 2:123759728-123759750 ATGTACACATATGTTTATTGTGG + Intergenic
938155969 2:128940324-128940346 TTGTATACACATATGTTTTGGGG - Intergenic
938567685 2:132534532-132534554 ATGCACACACATGTTTATTGTGG + Intronic
938932399 2:136098335-136098357 CTGCACACAAATTTGGATTGTGG - Intergenic
939455718 2:142432325-142432347 ATGCACACATATATTTATTGCGG + Intergenic
940069696 2:149671963-149671985 ATGTACACATATGTTTATTGTGG - Intergenic
940104060 2:150077710-150077732 ATGGACACATATATGTATTGCGG - Intergenic
940771826 2:157846997-157847019 ATATACATACATATCGATTCTGG - Intronic
941128711 2:161619509-161619531 ATGTAAACACATGTGAATTGTGG + Intronic
941756556 2:169192791-169192813 AGCTACACATACATGGATTGTGG - Intronic
943007445 2:182403216-182403238 ATGCACACATATATTTATTGCGG + Intronic
943088919 2:183351118-183351140 AAGAACACAGATATGGATTCAGG - Intergenic
943282292 2:185951242-185951264 GTGTACACATATACGTATTGTGG - Intergenic
943914678 2:193614809-193614831 ATGCACACACATGTTTATTGAGG - Intergenic
943915175 2:193622643-193622665 ATGTACACATATGTTTATTGTGG - Intergenic
943916054 2:193633836-193633858 ATGTACACATATGTTTATTGTGG + Intergenic
943920767 2:193705350-193705372 ATGTACACATATGTTTATTGTGG - Intergenic
944329633 2:198450257-198450279 ATGCACACACATGTTTATTGTGG - Intronic
945473812 2:210258104-210258126 ATGCACACATATATTTATTGTGG + Intergenic
946216829 2:218190575-218190597 ATGTACACACTGATGTATTTAGG + Intergenic
946513185 2:220382663-220382685 ATGCACACATATATTTATTGTGG - Intergenic
946932950 2:224689621-224689643 ATGTACACAGATACTCATTGTGG - Intergenic
1168873925 20:1156939-1156961 ATCTACATACATATGTATTGGGG + Intronic
1171006789 20:21474088-21474110 ATGTACAAAAATGTGTATTGTGG + Intergenic
1172363099 20:34328277-34328299 ATGCACACACATGTTTATTGTGG + Intergenic
1173179141 20:40789037-40789059 ATGAACAAGCATATGCATTGTGG - Intergenic
1174565824 20:51463843-51463865 ATGTACCCACAGATGCACTGAGG - Intronic
1175398657 20:58686151-58686173 ATGCACACACGTATGGGCTGTGG + Intronic
1175613067 20:60367991-60368013 ATGCACACACATGTTTATTGCGG - Intergenic
1177058923 21:16346696-16346718 ATGAACAGAGATATAGATTGGGG - Intergenic
1177581754 21:23032349-23032371 ATGCACACAAATATTCATTGAGG - Intergenic
1177646609 21:23906817-23906839 ATGCACACATATATTTATTGTGG - Intergenic
1177670027 21:24212921-24212943 ATGCACACATATATTTATTGTGG + Intergenic
1178197784 21:30368053-30368075 ATGCACACATATATTTATTGCGG - Intronic
1179333243 21:40426052-40426074 CTGTGAACACACATGGATTGGGG + Intronic
949425791 3:3914481-3914503 ATGCACACATATATTTATTGCGG + Intronic
949726201 3:7048654-7048676 ATGGACACATATATGCATTGTGG + Intronic
950823389 3:15787612-15787634 ATGTACACACATATGGTTTTAGG + Intronic
951426726 3:22554864-22554886 ATGTACACATATGTTTATTGCGG + Intergenic
952088854 3:29859862-29859884 ACATACACACATATGCATGGGGG + Intronic
952272603 3:31847570-31847592 GTCAACACAGATATGGATTGGGG - Intronic
952614998 3:35260407-35260429 ATGCACACACATGTTTATTGTGG - Intergenic
955593936 3:60568150-60568172 ATGCACACACATGTTTATTGCGG + Intronic
956354004 3:68370512-68370534 ATATACCCACATATGTATTTTGG + Intronic
956541020 3:70339947-70339969 ATGCACACACATGTTTATTGTGG + Intergenic
956569297 3:70676115-70676137 ATGCACACACATGTTTATTGTGG - Intergenic
957375586 3:79353570-79353592 ATGTCCACACGCTTGGATTGAGG - Intronic
957661811 3:83165893-83165915 ATGTACAAACATATGAATAATGG - Intergenic
957730480 3:84126581-84126603 ATGTACACACATAGAGTTTGGGG - Intergenic
957766218 3:84628504-84628526 ATGTACACGCTGATGGAATGTGG - Intergenic
957887204 3:86302712-86302734 ATGCACACATATATTTATTGCGG + Intergenic
958204852 3:90376508-90376530 ATGTACACATATGTTTATTGGGG + Intergenic
958881728 3:99679854-99679876 AGATACATAAATATGGATTGGGG + Intronic
958953987 3:100447142-100447164 ATGTACACATATATTTATTATGG + Intronic
959835302 3:110911886-110911908 ATGTACACATATGTTTATTGTGG - Intergenic
960518120 3:118624454-118624476 ATGCACACACATGTTTATTGCGG - Intergenic
961337934 3:126195655-126195677 ATGCACACATATATTTATTGTGG + Intronic
962331023 3:134478460-134478482 ATGTACACCCATTTAGTTTGTGG - Exonic
963039580 3:141058960-141058982 CAGAACACACATATGGACTGTGG - Intronic
963379412 3:144508424-144508446 ATATACACACATATATATTAAGG + Intergenic
964686558 3:159402474-159402496 ATGCACACATATATTTATTGTGG + Intronic
965496874 3:169409501-169409523 ATGTACTCACCTGTGGTTTGGGG - Intronic
965565719 3:170115454-170115476 ATGTGTATACATATGTATTGTGG - Intronic
965954856 3:174357531-174357553 ATGTACACACACATGAAGAGGGG - Intergenic
967268965 3:187717432-187717454 ATGTAAATACATATGGAGTTGGG - Intronic
969648796 4:8450659-8450681 ATAAACACACAGATGTATTGGGG - Intronic
970260454 4:14218884-14218906 CTGTACACACAGAGGCATTGTGG + Intergenic
970425227 4:15939723-15939745 ATATAAACACATCTGGATTTGGG - Intergenic
970969673 4:21967165-21967187 ATGTTCACACATATGGATGATGG + Intergenic
971480163 4:27107775-27107797 ATGCACACATATATTTATTGCGG + Intergenic
972000524 4:34026395-34026417 ATATACATACATATGGATTTAGG + Intergenic
972001959 4:34048754-34048776 ATGTAGTGACATATGGTTTGTGG + Intergenic
972140875 4:35957890-35957912 ATTTACACACACATGCATGGTGG + Intronic
972417208 4:38852924-38852946 ATGCACACACATGTTTATTGTGG + Intronic
974536239 4:63179282-63179304 ATGTACACATATGTTTATTGTGG - Intergenic
975791905 4:77962026-77962048 ATGCACACATATATTTATTGCGG - Intergenic
976030251 4:80743393-80743415 ATGTAACCACATATGATTTGTGG + Intronic
976334992 4:83875270-83875292 GTGTACTCACATATGAATAGAGG + Intergenic
976664382 4:87574442-87574464 ATGCACACATATATTTATTGTGG + Intergenic
977158749 4:93608150-93608172 ATATATACACATATGTATTCTGG + Intronic
977404297 4:96576339-96576361 ATGCACACATATGTGTATTGCGG - Intergenic
977662025 4:99600005-99600027 CTGTTCACACATATTCATTGTGG + Intronic
978611883 4:110550709-110550731 ATGTATAGATATATAGATTGTGG + Intronic
978738656 4:112113036-112113058 ATGTACTTAAATATGAATTGGGG - Intergenic
978771688 4:112463498-112463520 ATGAACATATATATGTATTGTGG - Intergenic
979014136 4:115410724-115410746 ATGTACATACATATGTAATATGG + Intergenic
979817626 4:125129507-125129529 ATGCACACATATATTTATTGCGG - Intergenic
980278201 4:130683307-130683329 ATGCATACACCTATGTATTGAGG - Intergenic
980684668 4:136211391-136211413 ATGCACACATATATTTATTGCGG - Intergenic
981065706 4:140482889-140482911 ATGTACACAGATTTGGACTAAGG + Intronic
981223031 4:142258897-142258919 ATGCACACATATATTTATTGTGG + Intronic
982324394 4:154114526-154114548 ATGCACACATATGTGTATTGTGG + Intergenic
982576657 4:157119926-157119948 ATGCACACATATGTGTATTGCGG + Intronic
982853302 4:160346791-160346813 ATGTACACACATATTCATTGTGG + Intergenic
982970948 4:161986019-161986041 ATGTAGACATACATGGAATGAGG + Intronic
983418683 4:167490349-167490371 ATGCACACATATATTTATTGTGG + Intergenic
983953753 4:173673542-173673564 ATGCACACATATGTGTATTGCGG - Intergenic
984125966 4:175811086-175811108 ATGTACACACACATACTTTGAGG - Intronic
984299477 4:177896519-177896541 ATGCACACACATGTTTATTGCGG + Intronic
984445040 4:179826054-179826076 ATGTACAAAAATGAGGATTGTGG + Intergenic
986582192 5:9277508-9277530 ATGCACACATATATTTATTGTGG + Intronic
986918906 5:12661406-12661428 ATGGACACACATGAGGATTTAGG + Intergenic
989779653 5:45248587-45248609 GTACACACACATATGTATTGTGG + Intergenic
990664449 5:58055725-58055747 ATTTACAGGCATATGGATTTTGG - Intergenic
990928480 5:61057486-61057508 ATGTATTCACAGATGGACTGGGG + Intronic
991442253 5:66663202-66663224 ATGTATACACACATGCACTGAGG - Intronic
992012658 5:72544670-72544692 ATGTACACATATGTTTATTGCGG - Intergenic
993039746 5:82800474-82800496 ATATACAAACATGTGGTTTGGGG - Intergenic
993362045 5:86989715-86989737 ATATATACATATATGGTTTGGGG - Intergenic
993483884 5:88458197-88458219 ATGTACACATATGTTTATTGCGG + Intergenic
994548018 5:101193141-101193163 ATTTAAAGACATATGAATTGAGG + Intergenic
994863312 5:105228217-105228239 GTGTACACAAATATAAATTGAGG - Intergenic
994889093 5:105606092-105606114 ATGTACACATATGTTTATTGTGG + Intergenic
995024682 5:107406238-107406260 ATGTATACAAATATTAATTGTGG + Intronic
995069687 5:107905061-107905083 ATATATATATATATGGATTGTGG + Intronic
995659042 5:114460800-114460822 ATGTACATACATATGCATCATGG + Intronic
995729457 5:115222668-115222690 ATGTACACATATGTTTATTGTGG + Intronic
996596687 5:125211206-125211228 ATGTATTCACATATGTGTTGGGG + Intergenic
996763952 5:127016799-127016821 ATGAACACCTATATGTATTGCGG + Intronic
999262948 5:150248783-150248805 ATGCACACATATATTTATTGCGG - Intronic
1000130636 5:158294457-158294479 ATATAAATACATATAGATTGGGG - Intergenic
1001073931 5:168609957-168609979 ATTTACTCACATGTGGCTTGAGG + Intergenic
1003727607 6:8782993-8783015 ATATACACACATATGGACCATGG - Intergenic
1003755476 6:9114592-9114614 ATGCACACACATGTTTATTGCGG - Intergenic
1004505541 6:16243990-16244012 CTGTGCACACATAAGGATTTGGG + Intronic
1007229117 6:40335926-40335948 GTGTACACACATCTGCAATGCGG + Intergenic
1009062022 6:58408435-58408457 ATGCACACATATATTTATTGTGG - Intergenic
1010163817 6:72891870-72891892 ATGTCCACACATTTGGATATAGG + Intronic
1010672269 6:78700001-78700023 ATGTACACATATGTTTATTGTGG + Intergenic
1011220088 6:85045812-85045834 ATGCACACATATATTTATTGTGG + Intergenic
1011849350 6:91606241-91606263 ATGTATCCACAAATAGATTGGGG + Intergenic
1011908345 6:92402471-92402493 ATGTACACATATGTTTATTGTGG - Intergenic
1012487124 6:99734682-99734704 ATGTACACAAATGTTTATTGTGG - Intergenic
1013003404 6:106047426-106047448 ATGGACAGACACATGAATTGTGG + Intergenic
1013039414 6:106418764-106418786 ATGGACACACATGTGGAATGAGG + Intergenic
1013041520 6:106438604-106438626 AAGCAAACACATATGGATTATGG - Intergenic
1014725823 6:124970741-124970763 ATGTTCACAAATATGGAGTCTGG + Intronic
1015571057 6:134621874-134621896 ATGTGCACACCTGTGGACTGTGG - Intergenic
1015834816 6:137408984-137409006 ATGCACACATATGTGTATTGTGG - Intergenic
1016844228 6:148555403-148555425 ATGCACACACATGTTTATTGCGG + Intergenic
1018175291 6:161173091-161173113 ATGTACACATATGTTTATTGTGG - Intronic
1018220031 6:161568754-161568776 ATGTACACACATATATAGTATGG - Intronic
1018773924 6:166997592-166997614 ATGTACACACATATCACATGTGG - Intergenic
1019067988 6:169318556-169318578 ATGTACACAAATTATGATTGAGG + Intergenic
1020130312 7:5555657-5555679 ATTTACACCTATAGGGATTGGGG + Intronic
1021223928 7:18006171-18006193 ATGCACACATATATTTATTGCGG - Intergenic
1021321577 7:19219142-19219164 ATGCACACATATATTTATTGCGG + Intergenic
1021936635 7:25637993-25638015 ATGTACTCACATAAGGCTTGGGG + Intergenic
1022130592 7:27401200-27401222 ATGCACACATATATTTATTGCGG - Intergenic
1027722353 7:81760650-81760672 ATAGACACACATATGTATTTGGG - Intronic
1027859659 7:83560887-83560909 ATTTTCAAACATATGGATTGGGG + Intronic
1028339792 7:89704611-89704633 ATGTAAAAACACATAGATTGAGG - Intergenic
1029006023 7:97210506-97210528 ATGTACACATATGTTTATTGTGG - Intergenic
1029798362 7:102920014-102920036 ATGAACACACATATTATTTGTGG - Intronic
1030942902 7:115677679-115677701 ATGTATACATATATGTAATGGGG + Intergenic
1031671075 7:124546468-124546490 ATGTACATACATATTTATTAGGG - Intergenic
1031858301 7:126948382-126948404 ATGTACACACAGATGTGTTTGGG + Intronic
1032587541 7:133161386-133161408 ATGTACACACACATAAAGTGTGG - Intergenic
1036566900 8:9945483-9945505 ATGTCAACACATATGTTTTGGGG + Intergenic
1036898055 8:12651309-12651331 ATGTACACACGTCTGGGCTGGGG - Intergenic
1037221538 8:16528605-16528627 ACTCAGACACATATGGATTGAGG + Intronic
1038747125 8:30264255-30264277 ATGTTCACACAATTGGCTTGAGG + Intergenic
1039146737 8:34455694-34455716 ATGGACACACACATGTACTGAGG + Intergenic
1039158247 8:34587498-34587520 ATGCACACATATATTTATTGTGG - Intergenic
1040625919 8:49149918-49149940 ATGTACATAGATATGAATTATGG - Intergenic
1040657536 8:49528958-49528980 ATGCACACATATGTTGATTGTGG - Intergenic
1041051366 8:53938077-53938099 ATGTACACATATGTTTATTGAGG + Intronic
1042465798 8:69129316-69129338 ATGCACACACATGTTTATTGCGG + Intergenic
1042579500 8:70261145-70261167 ATGTACACATATGTTTATTGCGG + Intronic
1042937307 8:74072919-74072941 ATATACACATATAAGGATTTGGG + Intergenic
1043573978 8:81635854-81635876 ATGTGCATACATATGGACAGAGG + Intergenic
1044470125 8:92557273-92557295 ATGAACACATATATTTATTGTGG - Intergenic
1044812315 8:96076090-96076112 ATGCACACATATATTTATTGCGG + Intergenic
1045609071 8:103813850-103813872 ATGCACACATATATTTATTGCGG - Intronic
1046292459 8:112180756-112180778 ATGTACACATATGTTTATTGTGG - Intergenic
1047054613 8:121150394-121150416 ATGCACACACATGTTTATTGTGG + Intergenic
1048109421 8:131451783-131451805 ATGGACACACATGTTTATTGTGG - Intergenic
1048503718 8:135001921-135001943 ATGGACACACACATGGCTTTAGG + Intergenic
1050475743 9:6039201-6039223 ATGTACAAAAATAAGAATTGAGG - Intergenic
1051081733 9:13301946-13301968 ATGTACACATATGTCTATTGTGG - Intergenic
1051085188 9:13340592-13340614 ATGTACACATATGTCTATTGCGG - Intergenic
1051230989 9:14955405-14955427 ATGCACACACATGTTTATTGTGG + Intergenic
1051673368 9:19534806-19534828 ATGTACACATATGTTTATTGTGG - Intronic
1052144442 9:25030282-25030304 TTTTACACACATATGGGATGGGG + Intergenic
1053042285 9:34884981-34885003 ATGTACACACATCTTGGTTTAGG - Intergenic
1053128617 9:35602770-35602792 ATATACACAAATATGGAGTGGGG + Intergenic
1053426323 9:38012514-38012536 ATTTACTTACATATGGAATGAGG - Intronic
1053646846 9:40126239-40126261 ATATACACACATATGTATATAGG - Intergenic
1053646847 9:40126266-40126288 ATATACACACATATGTATATAGG - Intergenic
1053646848 9:40126293-40126315 ATATACACACATATGTATATAGG - Intergenic
1053646849 9:40126320-40126342 ATATACACACATATGTATATAGG - Intergenic
1053646850 9:40126347-40126369 ATATACACACATATGTATATAGG - Intergenic
1053646851 9:40126374-40126396 ATATACACACATATGTATATAGG - Intergenic
1053646852 9:40126401-40126423 ATATACACACATATGTATATAGG - Intergenic
1053646853 9:40126428-40126450 ATATACACACATATGTATATAGG - Intergenic
1053646854 9:40126455-40126477 ATATACACACATATGTATATAGG - Intergenic
1053646855 9:40126482-40126504 ATATACACACATATGTATATAGG - Intergenic
1055117486 9:72621437-72621459 ATGTCCACACTTTTGGATTGAGG - Intronic
1056244807 9:84683638-84683660 ATGCACACATATATTTATTGCGG - Intronic
1058105212 9:100962683-100962705 ATGCACACATATATTTATTGTGG - Intergenic
1058814996 9:108674915-108674937 ACGTACAAACCTATGGCTTGTGG + Intergenic
1059360421 9:113737870-113737892 AGATACACACATATGGGATGAGG - Intergenic
1059962011 9:119574772-119574794 GTGTACACGCATATGAAGTGGGG - Intergenic
1059997910 9:119931559-119931581 ATGTACACACATGTTTATTGCGG + Intergenic
1060450183 9:123730799-123730821 ATGCACACATATATTTATTGCGG + Intronic
1060510165 9:124225982-124226004 ATGTATACACATATGCATGCAGG - Intergenic
1185987180 X:4848097-4848119 ATGCACACATATGTGTATTGTGG + Intergenic
1186178331 X:6948490-6948512 ATGTGCACACATATCCACTGGGG + Intergenic
1186845532 X:13527066-13527088 ATGCACACATATATTTATTGTGG - Intergenic
1188817554 X:34733725-34733747 ATATACACACATATAAAATGAGG + Intergenic
1189073745 X:37893262-37893284 ATATATACATATATAGATTGTGG - Intronic
1189651200 X:43191582-43191604 ATATACAAATATATGGATAGTGG - Intergenic
1190394214 X:49963423-49963445 ATGTACACACATATGGATTGGGG - Intronic
1191122012 X:56915722-56915744 ATGCACACACATGTTTATTGCGG - Intergenic
1191658348 X:63624075-63624097 ATGTACACATATGTTTATTGCGG + Intergenic
1192788677 X:74358309-74358331 ATGCACACATATATTTATTGTGG - Intergenic
1192843281 X:74879633-74879655 ATGTACTGACATTTGGAATGGGG + Intronic
1193728819 X:85077555-85077577 ATGTACACATATGTTTATTGTGG - Intronic
1193854736 X:86585861-86585883 ATGCACACACATATTCATTACGG - Intronic
1194608950 X:96017066-96017088 ATATACATATATATGCATTGTGG - Intergenic
1194907353 X:99594437-99594459 ATGCACACATATATTTATTGTGG - Intergenic
1195350491 X:103991478-103991500 ATGTACACATATGTGTATAGCGG + Intergenic
1195810133 X:108819686-108819708 ATGCACACATATATTTATTGTGG - Intergenic
1197478500 X:126952419-126952441 ATGTACACATATGTTTATTGCGG + Intergenic
1198050289 X:132945548-132945570 ATGCACACATATATTTATTGCGG + Intronic
1198524617 X:137488512-137488534 ATGCACACATATATTTATTGCGG + Intergenic
1198738195 X:139810762-139810784 GTGTGAAAACATATGGATTGGGG - Intronic
1199707879 X:150446521-150446543 ATGTGCACAGATGTGGATGGAGG + Intronic
1201052519 Y:9951738-9951760 ATATACACACATATGTATGTTGG + Intergenic
1201491134 Y:14542674-14542696 ATGCACACATATATGTATTGCGG + Intronic
1201957445 Y:19641273-19641295 ATGTACACATATGTTTATTGAGG - Intergenic