ID: 1190402021

View in Genome Browser
Species Human (GRCh38)
Location X:50046595-50046617
Sequence ATCTAGTTAGAAATCTAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 175}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190402021 Original CRISPR ATCTAGTTAGAAATCTAGGT GGG Intronic
900072473 1:782721-782743 ATCTTGTTAGAAATGTAGAAAGG - Intergenic
901734998 1:11306659-11306681 ATCTAGGGATAATTCTAGGTGGG + Intergenic
904356209 1:29941707-29941729 ATCTAGTTAGAGATCAGGGAAGG - Intergenic
907997470 1:59647487-59647509 TTCAGGTCAGAAATCTAGGTTGG + Intronic
909809299 1:79911481-79911503 GGCTAGTTAGATATGTAGGTTGG - Intergenic
909926635 1:81445337-81445359 ATTTTGTAAGAAATCTAGATAGG - Intronic
912915978 1:113815372-113815394 ATCTAGTTATACCTCTATGTCGG + Intronic
912951617 1:114124301-114124323 ATTCAGTTAGAAATCTTGTTGGG + Intronic
913941606 1:125114209-125114231 ATCTAGATAGATATCTACTTTGG + Intergenic
917022512 1:170604185-170604207 ATGTAGTTAAAAATCTTGCTAGG + Intergenic
919327689 1:196129782-196129804 AGCTAGTAAGAAGTGTAGGTGGG - Intergenic
922267414 1:223996678-223996700 ATCTTGTTAGAAATGTAGAAAGG - Intergenic
924079511 1:240379496-240379518 ATACAGATAGAAGTCTAGGTAGG - Intronic
1064665947 10:17651391-17651413 ATCAAGTTAGAAATAGATGTGGG + Intronic
1065539735 10:26750810-26750832 ATCTATTAAGAAATATAGGTGGG - Intronic
1066726296 10:38398923-38398945 ATCTTGTTAGAAATGTAGAAAGG + Intergenic
1066782310 10:38965755-38965777 ATCTAGATAGATATCTACTTTGG + Intergenic
1066951090 10:42117334-42117356 ATCTAGATAGATATCTACTTTGG - Intergenic
1066954810 10:42154883-42154905 ATCTAGATAGATATCTACTTTGG - Intergenic
1068414734 10:56705352-56705374 ATCTGTGTACAAATCTAGGTAGG + Intergenic
1076930770 10:133530314-133530336 AACAGGTTAAAAATCTAGGTTGG - Intronic
1079526584 11:21396898-21396920 ATTTGGTTTGAAAGCTAGGTGGG + Intronic
1080517956 11:33040611-33040633 AAGAAGTTCGAAATCTAGGTGGG + Intronic
1081251565 11:40841795-40841817 TTCTATTTAGCAATCTTGGTTGG - Intronic
1081340617 11:41922620-41922642 AGCTAGTGAGAAATAGAGGTAGG + Intergenic
1085024246 11:73227531-73227553 CTCTAGATAGAAACCTAGCTTGG + Intronic
1085693423 11:78683797-78683819 ATTTAGTTAAGAATCTAGGGAGG - Intronic
1086198762 11:84174417-84174439 ATTTAGCTAGAAAGGTAGGTTGG - Intronic
1087324487 11:96704651-96704673 GTCTTCATAGAAATCTAGGTTGG + Intergenic
1088990752 11:114951371-114951393 ATGTAGTAAGGAATCTAGCTAGG - Intergenic
1089704851 11:120270610-120270632 ATCTAGATGGAAGTCTAGGATGG + Intronic
1092002050 12:5040880-5040902 AGCTAGCTAGAAAGGTAGGTAGG + Intergenic
1094589795 12:31809448-31809470 GTCTAGGTAGAAATCTAGGAGGG - Intergenic
1100457945 12:94770559-94770581 ATCAGGTTAGAGATGTAGGTGGG + Intergenic
1100488459 12:95054726-95054748 ATCTAGTTAGATATGTTGCTAGG - Intronic
1100847358 12:98673576-98673598 ATCTAAATAGAAGTCCAGGTTGG + Intronic
1108746794 13:53404297-53404319 GTCTAGGGAGAAATCTGGGTGGG + Intergenic
1109418422 13:62075600-62075622 TTCTGATTAGAAATCTAGGATGG - Intergenic
1110691889 13:78440532-78440554 AACTAGTTAGAAATGCAGATGGG + Intergenic
1113053716 13:106243423-106243445 CTGTTGTTAGACATCTAGGTTGG - Intergenic
1114592346 14:23877721-23877743 ATCTCGTCAGAAATGGAGGTAGG - Intergenic
1115064262 14:29237571-29237593 ATATAGTTAGATACATAGGTAGG + Intergenic
1115688638 14:35823051-35823073 ATTAAATTACAAATCTAGGTTGG + Intergenic
1119973821 14:79002903-79002925 ATTTAATTAGAAACCTAAGTAGG + Intronic
1120763118 14:88303689-88303711 ATCTAGAGAGGAATCAAGGTGGG + Intronic
1121218774 14:92269218-92269240 ATATATATAGAATTCTAGGTGGG + Intergenic
1126302237 15:47210471-47210493 ATCTATTTAGAAATCCAAGCCGG + Intronic
1129064734 15:72892174-72892196 TCCTAGTTAAAAATGTAGGTGGG - Intergenic
1132259826 15:100413703-100413725 ATTTGGTTAGAAAAATAGGTTGG + Intronic
1133830685 16:9320708-9320730 GTTTAGATAGAAATCTATGTAGG - Intergenic
1137084846 16:36106610-36106632 ATCTAGATAGATATCTACTTTGG - Intergenic
1137219473 16:46432934-46432956 ATCTAGATAGATATCTACTTTGG - Intergenic
1138070939 16:53992377-53992399 ATCTCAGCAGAAATCTAGGTAGG - Intronic
1140839127 16:78822554-78822576 AAATATTTAGAATTCTAGGTGGG - Intronic
1144551067 17:16241184-16241206 ATCCACCTAGATATCTAGGTGGG - Intronic
1145689726 17:26727085-26727107 ATCTAGATAGATATCTACTTTGG + Intergenic
1145693588 17:26769337-26769359 ATCTAGATAGATATCTACTTTGG + Intergenic
1146918348 17:36692542-36692564 ACCTTGTCAGAAATCCAGGTGGG - Intergenic
1203190939 17_KI270729v1_random:188496-188518 ATCTAGATAGATATCTACTTTGG + Intergenic
1153352029 18:4092044-4092066 ATCTAGTTAGAAGTTGAGCTGGG + Intronic
1154516267 18:15169288-15169310 ATCTAGATAGATATCTACTTTGG - Intergenic
1156000779 18:32381787-32381809 ATGAAGTTAGAAACCTAGTTTGG - Intronic
1159373899 18:67566201-67566223 AACTAGTAAGAACTCTAAGTAGG + Intergenic
1162877516 19:13631701-13631723 ATCCAGTTAGAAAACTGGGAGGG + Intergenic
1163982964 19:20918816-20918838 ATCTATTTAGATATCCAGTTAGG - Intergenic
1163990744 19:20997106-20997128 AACTGGTTAGAAATTTAGGCTGG - Intergenic
1164564747 19:29317786-29317808 ATTTAATTACAAAGCTAGGTGGG - Intergenic
928744886 2:34400655-34400677 ATATAGGGAGAAATCTATGTAGG + Intergenic
931968775 2:67563114-67563136 ATCTAGTTAGAACTGTAATTTGG - Intergenic
933076160 2:77929750-77929772 ATCTAGTTGGTCATCTAGTTAGG - Intergenic
933152879 2:78935821-78935843 ATATATTTAGGCATCTAGGTTGG + Intergenic
933531904 2:83521112-83521134 AGCTAGGCAGAAATGTAGGTAGG + Intergenic
934252123 2:90364934-90364956 ATCTAGTTAGATATCTACTTTGG - Intergenic
934257320 2:91438012-91438034 ATCTAGTTAGATATCTACTTTGG + Intergenic
934330960 2:92068588-92068610 ATCTAGATAGATATCTACTTTGG + Intergenic
935017397 2:99196878-99196900 ATCTAATTATAAATCTAATTTGG + Exonic
936026722 2:109036709-109036731 ATCTATTTAAAAACCTAGGCTGG + Intergenic
936737829 2:115468138-115468160 ATCCATTTAGAAGTCAAGGTTGG - Intronic
938982174 2:136537345-136537367 ATCAAGAGAGAAGTCTAGGTGGG - Intergenic
940032596 2:149280288-149280310 ATCTCGTTAGAACCCAAGGTTGG - Intergenic
940490132 2:154348933-154348955 ATCTAGTGAGAAATGTAGAAAGG - Intronic
942754808 2:179328109-179328131 ATCTAGTTACATAGCTAGTTAGG + Intergenic
943156182 2:184181330-184181352 ATCTAATTACAAAGATAGGTTGG + Intergenic
945019913 2:205559893-205559915 AACTATTTAGAAATCTGGGCTGG - Intronic
946472776 2:219978179-219978201 TTCGAGTTACAAATTTAGGTTGG + Intergenic
1170798475 20:19570497-19570519 ATCTATTTAGCAATCTGGGTTGG - Intronic
1173186423 20:40843812-40843834 AACTATTTAGTAATCTAAGTGGG + Intergenic
1176674107 21:9761072-9761094 ATCTAGTTGGTTATCTAGGAGGG - Intergenic
1176863208 21:14025813-14025835 AGCTGGTTAGAAATTTAGGCTGG - Intergenic
1177429572 21:20974410-20974432 ATCTACTTATCAATCTAGTTAGG - Intergenic
1178069935 21:28953308-28953330 ATCCAATTAGAAAAATAGGTGGG + Exonic
1180520926 22:16203128-16203150 ATCTATTTAGGAATCTATTTTGG - Intergenic
1203325475 22_KI270738v1_random:10417-10439 ATCTAGATAGATATCTACTTTGG - Intergenic
951272350 3:20641641-20641663 ATCTAGTTAGAAAGTTATTTGGG + Intergenic
951756639 3:26097990-26098012 ATATAGTTGGAAATGTAGGTGGG + Intergenic
952463241 3:33551909-33551931 ATCAAGGTAGCAATCAAGGTGGG + Intronic
953986136 3:47444584-47444606 AGCTACTTGGAAAACTAGGTGGG - Intronic
957467304 3:80610102-80610124 ATCCAGTTCGAAATCTAAGGTGG - Intergenic
959427732 3:106213583-106213605 ATTAAATTAGAAATCTAGTTGGG + Intergenic
959496165 3:107054678-107054700 CTCTAGTTAGAAAACTTGGCTGG - Intergenic
960647242 3:119900032-119900054 ATCTACATAGATATCTAGGTTGG + Intronic
961060588 3:123825255-123825277 ATCTATTAAGAAATGTTGGTAGG + Intronic
964033029 3:152161878-152161900 ATTTACTTAGAACTTTAGGTAGG - Intergenic
964687942 3:159418305-159418327 ATCTAGATAGATATCTATCTGGG - Intronic
967749351 3:193095856-193095878 ATGTAGTTAGAAATATAGTGAGG + Intergenic
968393306 4:211073-211095 AGCTGGTTAGAAATTTAGGCTGG - Intergenic
968402273 4:308019-308041 AGCTGGTTAGAAATTTAGGCTGG + Intergenic
968410118 4:383279-383301 AGCTGGTTAGAAATTTAGGCTGG - Intronic
968421318 4:487487-487509 AGCTGGTTAGAAATTTAGGCTGG - Intronic
968717883 4:2175274-2175296 AGATAGTTAGAAATATAGATAGG + Intronic
972627143 4:40810796-40810818 AACCAGATAGAAATCTGGGTGGG - Intronic
975126754 4:70791441-70791463 AACCAGTTGGAAATATAGGTTGG + Intronic
975937076 4:79594670-79594692 ATCTAATTATAATTCTATGTAGG + Intergenic
976055774 4:81064238-81064260 ATCTAGGTAGATATGCAGGTAGG + Intergenic
976716944 4:88133302-88133324 ATCTAAGTAGAAATCGAGGCTGG + Intronic
977405730 4:96595991-96596013 ATCTAGTATTAAACCTAGGTAGG + Intergenic
979335686 4:119458752-119458774 ATCTTGTTAGAAATGTAGAAAGG - Intergenic
979387122 4:120079755-120079777 ATCTAGCTGGGAATCTAGTTGGG + Intergenic
979568806 4:122190760-122190782 ATCTAGTTAGAATTCTTGACAGG + Intronic
979639434 4:122996543-122996565 AGCTAGGTAGATAGCTAGGTAGG + Intronic
981050430 4:140304377-140304399 TTCTAGTTAGATATCCTGGTAGG + Intronic
982507007 4:156231834-156231856 ATATAGTTAGAAATATAAATTGG - Intergenic
983415879 4:167453650-167453672 AGCTACTTAGGAATCTAAGTTGG - Intergenic
986118628 5:4806743-4806765 ATCCAGTTGGAAACATAGGTAGG - Intergenic
987378286 5:17258505-17258527 AGCTTGTTAAAAATATAGGTGGG - Intronic
988255437 5:28813675-28813697 ATCTAAATAGAAATATTGGTGGG + Intergenic
994520747 5:100831453-100831475 ATCTGGTTAAGAATCCAGGTGGG - Intronic
994848344 5:105020375-105020397 ATCAAGTTTGAAAGTTAGGTGGG + Intergenic
995859917 5:116630062-116630084 ATCTAGTGAGACATCTAGGAGGG + Intergenic
995976438 5:118041605-118041627 AACTATTTAGACATCTTGGTCGG + Intergenic
996870736 5:128190367-128190389 TTATAGTTAGAAATATAGGTTGG + Intergenic
998712167 5:144839240-144839262 ATATAGATAGAAATGTAGGTAGG - Intergenic
1001626659 5:173141689-173141711 ATCTATTTTGAAATATATGTTGG - Intergenic
1003624900 6:7732076-7732098 ATCTAGTTACAAATACAAGTAGG - Intronic
1003866808 6:10370999-10371021 ATCTATTCAAAAATCTAGGCCGG + Intergenic
1004557714 6:16715828-16715850 ATCTAGTTGGAAAAGTAAGTTGG - Intronic
1006887259 6:37392706-37392728 CTTTTGATAGAAATCTAGGTTGG + Exonic
1009460701 6:63909412-63909434 ATCCAGTCAGAAATATATGTCGG - Intronic
1011013526 6:82728750-82728772 ATTAAGTTAAAAATCTAGGGTGG - Intergenic
1011299970 6:85863623-85863645 ATGTAGTTAGAAATCTTCTTAGG - Intergenic
1013589800 6:111610417-111610439 CTCTTGTTAGAAATCTAGAAGGG + Intergenic
1013626557 6:111943272-111943294 ATCTAGTAAGAATACTATGTTGG + Intergenic
1014041576 6:116833257-116833279 ATCTAGTGAGAACTATAGCTTGG - Intergenic
1016146685 6:140686131-140686153 AGCTAGAAAGAAATCTAAGTTGG - Intergenic
1020468872 7:8512859-8512881 ATGTAGTTAGAATTCTAATTTGG - Intronic
1023406569 7:39839955-39839977 ATCTAGTTGCAAATCTTGTTAGG + Intergenic
1024068405 7:45765005-45765027 ATCTTGTTAGAAATGTAGAAAGG + Intergenic
1025319687 7:58082480-58082502 ATCTAGATAGATATCTACTTTGG + Intergenic
1025554026 7:62280993-62281015 ATCTAGATAGATATCTACTTTGG - Intergenic
1025560755 7:62372281-62372303 ATCTAGATAGATATCTACTTTGG + Intergenic
1026759348 7:73114832-73114854 ATCAAGCTAAAAATCTAGGCTGG - Intergenic
1026914872 7:74113842-74113864 AGCTAGTTGGAAGGCTAGGTGGG + Intronic
1027088061 7:75278642-75278664 ATCAAGCTAAAAATCTAGGCTGG + Intergenic
1027642745 7:80757400-80757422 ATCCAAGTAGAATTCTAGGTGGG - Intronic
1028940038 7:96511569-96511591 ATATGGCTAGAAATTTAGGTTGG + Intronic
1029394171 7:100295769-100295791 ATCAAGGTAAAAATCTAGGCTGG + Intergenic
1030998716 7:116389726-116389748 ATATATTTAGAAGTTTAGGTGGG + Intronic
1033445524 7:141418367-141418389 TTCTAGTTATAAATCTAGTAGGG + Intronic
1036391081 8:8324798-8324820 ATCTAGACAGAATTCTAGTTTGG - Intronic
1038668165 8:29559623-29559645 AGATAGGTAGGAATCTAGGTGGG + Intergenic
1042141037 8:65678771-65678793 ATCTAGCTAGAATTATAGGCAGG - Intronic
1042950178 8:74192985-74193007 ATCTTGTCAAAAATCTAGATGGG - Intergenic
1043167786 8:76925992-76926014 ATGAAGTTAGAAAGGTAGGTTGG + Intergenic
1044250003 8:89995414-89995436 ATCTAGTGAGACATGTAGCTTGG + Intronic
1044807258 8:96021109-96021131 ATCTACTTACAAATCTAAGAGGG + Intergenic
1046212692 8:111099329-111099351 GTCTATTTAGAAATGTAGATAGG + Intergenic
1046461776 8:114547867-114547889 ATCTAGTTAGAAATTGAGTTGGG + Intergenic
1047388392 8:124430562-124430584 TTCTGGTTAGAAATCTGGGCAGG + Intergenic
1047758197 8:127934677-127934699 ATCCTGTTAGAAATCTATGAAGG - Intergenic
1050816396 9:9818503-9818525 ATATAAGTAGAAATGTAGGTAGG + Intronic
1050971217 9:11877754-11877776 ATATAGTTAGATATTTAAGTGGG + Intergenic
1051773043 9:20600594-20600616 ATCTAGTTGGATTTCAAGGTGGG - Intronic
1053945575 9:43306661-43306683 ATCTAGATAGATATCTACTTTGG + Intergenic
1058183792 9:101829982-101830004 ATCTTGTTAGAAATATAAATCGG + Intergenic
1058214019 9:102210010-102210032 ATCTATTTAGATATTTAGCTTGG + Intergenic
1060429077 9:123533306-123533328 ATCAAGATAAAAATCCAGGTGGG - Intronic
1061337780 9:129953188-129953210 ATTTAGTTAGAAATCTTGCCAGG + Intronic
1203588710 Un_KI270747v1:35239-35261 ATCTAGATAGATATCTACTTTGG + Intergenic
1187315043 X:18184864-18184886 ATCTATTTTGAAATCTGTGTTGG - Intronic
1187349061 X:18494920-18494942 ATCTAGAAAGAAAACTAAGTAGG + Intronic
1187943745 X:24406874-24406896 AACTACTTAGGAATCGAGGTAGG - Intergenic
1188413857 X:29907740-29907762 ATTTATTTAGAAATTTAAGTAGG - Intronic
1190402021 X:50046595-50046617 ATCTAGTTAGAAATCTAGGTGGG + Intronic
1194392052 X:93331166-93331188 ATAAAGCTAGAAATCTAGGTAGG - Intergenic
1196778227 X:119360331-119360353 AACCAGTTACAAATTTAGGTAGG + Intergenic
1200917755 Y:8586216-8586238 ATCTACCTAGAAATCAAAGTGGG - Intergenic
1202179029 Y:22123714-22123736 CTGTAGTTAGAAATCAAAGTGGG + Intergenic
1202212332 Y:22462680-22462702 CTGTAGTTAGAAATCAAAGTGGG - Intergenic