ID: 1190403054

View in Genome Browser
Species Human (GRCh38)
Location X:50058179-50058201
Sequence GCATTCAAAGAAATGGGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 230}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190403054_1190403059 -6 Left 1190403054 X:50058179-50058201 CCCTGCCCCATTTCTTTGAATGC 0: 1
1: 0
2: 3
3: 20
4: 230
Right 1190403059 X:50058196-50058218 GAATGCTTATTTATTTCTTTAGG 0: 1
1: 1
2: 4
3: 81
4: 885

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190403054 Original CRISPR GCATTCAAAGAAATGGGGCA GGG (reversed) Intronic
901219614 1:7575939-7575961 GCGATCAAGGAAATGGAGCAAGG + Intronic
902590563 1:17471326-17471348 CCATTTAAAAAAATGGGGCTGGG + Intergenic
902624977 1:17671300-17671322 GCCTTCAAGGAAGTAGGGCAGGG + Intronic
903061796 1:20673827-20673849 CCAGTCTAAGAAATGGAGCAGGG - Intronic
904866752 1:33585365-33585387 GCCTTCAGAGAAGTGGGGCTTGG + Intronic
905481685 1:38266145-38266167 GCATTCTAGGCAATGGAGCAAGG - Intergenic
906867443 1:49437924-49437946 ACATTCTTAGAAATGGGGGATGG - Intronic
906950584 1:50332186-50332208 GCTTCCTAAGAAATTGGGCAGGG - Intergenic
909884488 1:80923881-80923903 GCATTCAAAAAAATGAAGTAAGG - Intergenic
910525157 1:88169348-88169370 TCATTAAAAGAAATGGGTTATGG + Intergenic
911071847 1:93838060-93838082 TCATCCAGAGAAATGGGGGAAGG + Intronic
911663289 1:100527449-100527471 GAATACAAATAAATGGGACAAGG + Intergenic
912310950 1:108620922-108620944 GCTTTCAAAGAACTGTGGCTAGG - Intronic
913145975 1:115990362-115990384 GCAATGAAAAACATGGGGCAAGG - Intronic
915986340 1:160469204-160469226 GCATTCCAAGGAAGGGGCCAAGG - Intergenic
916479645 1:165203243-165203265 GCACTCAAAGCTATGGGGCTAGG + Exonic
916712593 1:167425111-167425133 ACATTCAAAGAAAAGGTGAAAGG - Exonic
917245025 1:172991392-172991414 GCATGCAAAGAAAAGGAGTATGG + Intergenic
919956404 1:202421249-202421271 GCATTCAAAGAACTGGCAGATGG - Intronic
920754935 1:208720510-208720532 GCATGTATAGAAATGAGGCAAGG - Intergenic
921204648 1:212838003-212838025 GAAGACAAAGAAATGGGGCTGGG + Intronic
921389425 1:214603965-214603987 GCGTTCAAATAAATGTGGAAGGG - Intronic
922173142 1:223173755-223173777 AATTTCAAAGAAATGGGGAAAGG + Intergenic
923256300 1:232224311-232224333 GCATTCCAAGGGATGGGCCAGGG - Intergenic
923442583 1:234035174-234035196 GCATACAGAGAAAGGGGGCATGG + Intronic
1064943656 10:20763053-20763075 GCATTCAGGTAAATGGAGCAAGG + Intergenic
1065227327 10:23557459-23557481 GCATGCAAAGAATTGGGACATGG + Intergenic
1068094417 10:52472528-52472550 ACATTCAAAGAAATGGTGGGTGG + Intergenic
1069661357 10:70125765-70125787 TCATACAAAGAAATGGGGACTGG - Intronic
1069692251 10:70361610-70361632 GCATACAAAGATTTGGGGAAAGG + Intronic
1070007950 10:72443630-72443652 GCAATCAAAGCAATGGGGAAAGG - Intronic
1071166604 10:82815325-82815347 GAAATCAATGAAATGGGGCCAGG - Intronic
1073154062 10:101332652-101332674 GAACTGAGAGAAATGGGGCAAGG - Intergenic
1075039790 10:119098980-119099002 GCATTAAAAGAAATAGTTCATGG - Intergenic
1075913757 10:126148547-126148569 GCATTCAAAGGAATGGGGGAAGG + Intronic
1076191783 10:128488268-128488290 GCATTCAAAGAAAGAGGGAGGGG + Intergenic
1077057418 11:601506-601528 GGACTCACAGGAATGGGGCAGGG + Intronic
1078825278 11:14923690-14923712 GAATTCCAAGGAATGGGTCAGGG + Intronic
1079011450 11:16831884-16831906 ACTTTCAAAAAATTGGGGCAAGG - Intronic
1080003442 11:27378104-27378126 ACATTCTAAGAAATGTGTCATGG - Intronic
1081901252 11:46630111-46630133 GCTTAAAAAGAAATGGGGCCTGG - Intronic
1084508055 11:69582388-69582410 TTATTCAAAGAAAGGGAGCAGGG - Intergenic
1084629310 11:70335879-70335901 CCATACACACAAATGGGGCATGG - Intronic
1085857689 11:80194351-80194373 ACCTTCAAAGAAATGTGACAAGG + Intergenic
1086962183 11:92989656-92989678 ACACTCCAAGAAATGGGACAGGG + Intergenic
1087207834 11:95416103-95416125 GTGTTCCAAGAAATGGGTCAGGG - Intergenic
1088179017 11:107088181-107088203 GAGTTCAAAGAGATGGGGAAAGG - Intergenic
1088476618 11:110246472-110246494 GCATTCAAAGAAAATGCCCAGGG + Intronic
1088680382 11:112236501-112236523 GCATTAAAAAAAATGTGGCAGGG - Intronic
1090712660 11:129401663-129401685 GCATTCAAAGAAGCCGGGCACGG + Intronic
1091430386 12:428555-428577 CCATTCAGAGAAAAGGGGCCAGG - Intronic
1091945465 12:4537169-4537191 GCATTCAAAAAGATTCGGCATGG - Intronic
1092881393 12:12890519-12890541 GCATATGAAGAAATGGGGGAAGG - Intergenic
1092995686 12:13948287-13948309 GCATTTAAACATATGGGGCAGGG - Intronic
1094063510 12:26340138-26340160 GCATTCAGGGAGATGGGGCTGGG - Intronic
1095909297 12:47409558-47409580 TCATTCAAAAAGCTGGGGCATGG - Intergenic
1098674969 12:73278244-73278266 TAATTCCCAGAAATGGGGCAAGG - Intergenic
1099263509 12:80414622-80414644 GTATTCAAGGAAACGGTGCAAGG + Intronic
1101042655 12:100772361-100772383 GCATTTAAAGAAAAGAGGTAGGG - Intronic
1103876343 12:124130441-124130463 AAATTCAAAAAAATGAGGCAGGG - Intronic
1104342306 12:127961934-127961956 GAATTTAAGGAAATGGAGCAAGG - Intergenic
1104598136 12:130133764-130133786 GCATTCCAGGAAGTGTGGCAGGG - Intergenic
1105563023 13:21513413-21513435 TCATTAAAACAAATAGGGCAGGG - Intronic
1107000349 13:35537016-35537038 TCAATCAGGGAAATGGGGCAGGG + Intronic
1107372310 13:39766352-39766374 GCACTCAAGGAAACTGGGCATGG + Intronic
1108511880 13:51163641-51163663 GCATTCCAAGGAATGGGCCAGGG + Intergenic
1110391099 13:74975191-74975213 TCATTGAAAGCAATGAGGCAGGG - Intergenic
1112475283 13:99726451-99726473 GCATTCCAAGAACTAGGGGAAGG - Intronic
1112748584 13:102555501-102555523 TCATTAAAAGAATTGAGGCAGGG + Intergenic
1118769042 14:68929429-68929451 GCATTCAAACAAAGGGTACAGGG + Intronic
1119274569 14:73342190-73342212 AAATTTAAAGAAATGGGGCCAGG - Intronic
1122685765 14:103505347-103505369 GAACTCACTGAAATGGGGCAAGG + Intergenic
1124649023 15:31461413-31461435 GCATTCCAAGGGATGGGCCAGGG + Intergenic
1126051999 15:44694640-44694662 GCATTCATCGAAATGAGTCAAGG + Intronic
1127956374 15:63857391-63857413 ACATTCAAAGAAAAGCAGCAGGG + Intergenic
1128558947 15:68651839-68651861 GCTTTGAAGGAAATGGAGCAAGG - Intronic
1129943775 15:79521452-79521474 GCAGTAACAGAAATGGGCCATGG - Intergenic
1130167593 15:81479510-81479532 GCATTAAGAGATATGGGGCCGGG + Intergenic
1130727968 15:86460733-86460755 GCATTTAAGGAAAAGCGGCAAGG - Intronic
1131570553 15:93531025-93531047 GAATTCAAAGAGAAGGTGCAAGG + Intergenic
1131723807 15:95201393-95201415 GCAGTCACTGAAAGGGGGCAAGG + Intergenic
1132993758 16:2811992-2812014 GCATTCCAGGAAATGGTGCCAGG - Intergenic
1134201759 16:12205053-12205075 GCCTTCCAAAGAATGGGGCAGGG + Intronic
1135002057 16:18785032-18785054 GCATGCAAAGAGATGGAACAAGG + Intronic
1136593084 16:31229463-31229485 GCATTGAAGGAAATGGCCCATGG + Intergenic
1136671217 16:31860049-31860071 GTATACAAGGAAAGGGGGCAGGG - Intergenic
1137764377 16:50966809-50966831 GCATTCATACAAAGGGGTCAAGG - Intergenic
1138525051 16:57600344-57600366 CCCTTCAATGAAATGGGGTAAGG + Intergenic
1139288384 16:65835431-65835453 GCATTCACAGAGATTGGGAAAGG - Intergenic
1141152241 16:81572313-81572335 TCATTCACAGAAACAGGGCAAGG - Intronic
1141371713 16:83492963-83492985 GGCTTCAGAGAAATGGGCCAAGG + Intronic
1141540573 16:84717433-84717455 GCCTTCAAAGAACTGGGGTCAGG - Intronic
1143364748 17:6399264-6399286 GCTTTCTAAGAAAAGGTGCATGG - Intronic
1143569936 17:7750488-7750510 GCTTCCTAAGAAATGGTGCAGGG + Intronic
1144339827 17:14302021-14302043 GCGATCGAAGAAATGGGGCTCGG - Exonic
1144355285 17:14439673-14439695 GCATGAAAAGAAAAGAGGCAGGG + Intergenic
1146785852 17:35720730-35720752 CCATTTAAAAATATGGGGCAGGG - Intronic
1147225294 17:38971875-38971897 GCATTGAAAGCTCTGGGGCAAGG - Intergenic
1147765425 17:42832708-42832730 TCATTCAATAAAATGGGGCAGGG - Intronic
1150709374 17:67517001-67517023 GCATTGACAGAAAGGGTGCAAGG - Intronic
1153667924 18:7383012-7383034 CCATTCTGTGAAATGGGGCAAGG - Intergenic
1157301636 18:46483821-46483843 GCATTCCAAGCAGTGGGCCAGGG + Intronic
1162396972 19:10422902-10422924 CCTTGCAAAGAAATGGGGCCTGG - Intronic
1164823507 19:31267566-31267588 CCCTTGAAAGAAATGGGGGAAGG - Intergenic
1166114476 19:40644945-40644967 GTATTCAAAAAAATGGGGAGGGG + Intergenic
1166175880 19:41069293-41069315 GCATTACAACAAATGGGCCAGGG + Intergenic
1166252217 19:41579029-41579051 GCAGTCAGAGAAATGGAACATGG - Intronic
1166341009 19:42136897-42136919 GAATTGAAGGAAATGGGGAAGGG - Intronic
925626541 2:5847070-5847092 GCCTTCACAGAAATGAGGCCTGG + Intergenic
925914103 2:8592457-8592479 GCATTCAAAGAGATGCAGCCAGG + Intergenic
927407025 2:22782163-22782185 TCCTTCAAAGAAATGATGCAAGG - Intergenic
928776820 2:34775387-34775409 GCATTCAATTAAATGAAGCACGG + Intergenic
929397689 2:41542235-41542257 GAATTCAAAGGAGTGGGGGAAGG - Intergenic
929620110 2:43346137-43346159 TCATGGAAAAAAATGGGGCAGGG + Intronic
933777489 2:85779802-85779824 GCATGCAAACAAGTGTGGCACGG + Intronic
935756358 2:106278881-106278903 GGATTCAAAGAAAAGTGGCAAGG - Intergenic
937919713 2:127120601-127120623 GCTTTCTAAGAATGGGGGCAGGG - Intergenic
938127416 2:128684647-128684669 GCATCCTAAGAAATGGGCCCAGG + Intergenic
941298214 2:163767303-163767325 GAATTCAATCACATGGGGCAAGG - Intergenic
943270551 2:185797004-185797026 TCATTCATAGAAATGGGAAAAGG + Exonic
944529978 2:200658050-200658072 GTATTCAAACAACTGGGGGATGG - Intronic
947110092 2:226709124-226709146 GCATTCCAAGGGATGGGCCAAGG - Intergenic
947825602 2:233104259-233104281 ACAGATAAAGAAATGGGGCAAGG - Intronic
1169440833 20:5632489-5632511 GCATTCACAGATATGGGGGTTGG + Intergenic
1169943483 20:10963473-10963495 GCATTAAAAAAAGTGGGGCCGGG - Intergenic
1170338508 20:15297504-15297526 GCATTGACAGAAAGAGGGCAGGG + Intronic
1171141097 20:22743458-22743480 GCATTCTAAGCAATGGGACATGG - Intergenic
1173783685 20:45776897-45776919 ACATTAAAAGAACTGGGGGAAGG - Intronic
1174074626 20:47924675-47924697 GCATTCAGACAAATGGGGGAGGG - Intergenic
1175194952 20:57236652-57236674 AGATTCAGAGAAAGGGGGCAGGG + Intronic
1175451494 20:59072533-59072555 GCACTAAAAGAAAGGGAGCAGGG - Intergenic
1176665199 21:9679743-9679765 GCAACCAAAGAAAAGGGGCTTGG - Intergenic
1177379053 21:20314446-20314468 GCATTCCAAGGAATGGGCCAGGG - Intergenic
1177453293 21:21301055-21301077 CCATTTAAAGAAATGGGCAAAGG - Intronic
1177847210 21:26304578-26304600 GCCTTCAAAAAAATGGAGAATGG - Intergenic
1179261895 21:39764916-39764938 GCATTCACAGCAGTGGGGCTGGG - Intronic
1180123170 21:45767660-45767682 CCATTTTAAGAAATGGGGCATGG + Intronic
1180957407 22:19747175-19747197 GCATGAACAGAAATGGGTCAGGG - Intergenic
1182869695 22:33635194-33635216 GCATTCCAGGGAATGGGCCAGGG - Intronic
1183480591 22:38062607-38062629 GAATCCAAAGAGAAGGGGCAGGG - Intronic
1184268087 22:43360807-43360829 TGATTGAAAGAAACGGGGCAGGG - Intergenic
950328888 3:12140007-12140029 GCAGTCAAGAAAATGGGTCAAGG - Intronic
950494987 3:13328406-13328428 GCATTCAAAGACAGGTGTCAGGG - Intronic
951696874 3:25454106-25454128 GCATCCAAACATTTGGGGCACGG - Intronic
952238039 3:31500589-31500611 GCATGAAAAGAGAGGGGGCATGG - Intergenic
952288782 3:31995078-31995100 GCATCTGAGGAAATGGGGCAAGG + Intronic
954539428 3:51384141-51384163 GCAGTCAAGGAAGTGGGGAAAGG - Exonic
955523963 3:59802321-59802343 GAATTAAGAGAAATGGGCCAAGG - Intronic
956426120 3:69137447-69137469 GCATTTAAATAAAAAGGGCATGG - Intergenic
959184288 3:103025596-103025618 TCATTCAAAGAAATGGATCCAGG + Intergenic
962224844 3:133597244-133597266 GCATTCCAAGGAATGGGGCAGGG + Intergenic
962701616 3:138005876-138005898 TTATTCAAAAAAATGGGGGAAGG + Intronic
963078530 3:141370017-141370039 AGATTCAAAGAAAAGGGGAAAGG + Intronic
963983194 3:151563005-151563027 GCATTCTAAGGGATGGGCCAGGG + Intergenic
964041378 3:152266590-152266612 GCATTCTAAGCAGAGGGGCATGG + Intronic
964290892 3:155179061-155179083 GCATTCAAAGAAGGGGGCCAAGG + Intronic
964554140 3:157917328-157917350 GCAAACAAAGAAACAGGGCAGGG + Intergenic
964772916 3:160243435-160243457 ACTTTCAAAGAATTGGGGCCGGG + Intronic
965412282 3:168346990-168347012 GCATTCAAAGAGCTGGGAGAGGG + Intergenic
965536787 3:169831667-169831689 GCATTCAAAAACTGGGGGCAAGG + Intronic
966643272 3:182214464-182214486 CCATTCACAGAAAGGGTGCAGGG + Intergenic
966925255 3:184640423-184640445 GTATTCTGAGAAATGGGCCATGG + Intronic
967130869 3:186469656-186469678 GTATCCAGAGAAATGGGGCCCGG - Intergenic
967747008 3:193067874-193067896 GAATTCAAGGAATTGGGGCTAGG - Intergenic
968344907 3:197994424-197994446 CCATTTAAAAAAATGGGCCAAGG + Intronic
969516626 4:7651780-7651802 GCATTCCAAGGGATGGGCCAGGG + Intronic
970014468 4:11498143-11498165 GAATGCAAAGAATTTGGGCAGGG + Intergenic
970197366 4:13565180-13565202 GTATACAAAGTAATGGTGCATGG + Intergenic
970607170 4:17691729-17691751 ACATTCACAGAAATAGGTCAGGG + Intronic
971148130 4:24001958-24001980 ACATACCAAGAAATGGGGGAAGG + Intergenic
971302868 4:25456281-25456303 GCATACCAAGAAAGGGAGCAGGG - Intergenic
973819910 4:54653727-54653749 CCAGTCAAGGAAATGGGGCTTGG - Intergenic
975883293 4:78937166-78937188 GCATTCCATGAGATGGGACAGGG - Intronic
977099256 4:92788380-92788402 GAATTGAAAGAAATGGGAAAGGG + Intronic
979628618 4:122875511-122875533 GAAGTCAAAGAAATAGGGCCGGG + Intronic
981753215 4:148113750-148113772 GCATTCCAAAGAATGGGCCAGGG - Intronic
981946126 4:150346101-150346123 TCATTAAAATAAATGGGGCCAGG - Intronic
982234139 4:153236382-153236404 GCATACAAGGAAATGAGGTATGG - Intronic
982262898 4:153510585-153510607 GCATTCAGTAAAATTGGGCAGGG + Intronic
983922288 4:173358924-173358946 GCATTAAAATAAATGTAGCAAGG + Intergenic
984809198 4:183779338-183779360 TCATTGGAAGAAATTGGGCAAGG - Intergenic
985410678 4:189680211-189680233 GCAACCAAAGAAAAGGGGCTTGG - Intergenic
986172976 5:5328581-5328603 GAAGTCAAAGAAATAGGGAAAGG + Intergenic
987376679 5:17241912-17241934 GCATTTAATTAAATGGGGGAAGG + Intronic
988371631 5:30376930-30376952 GCATTCTAAGAAATAGTACATGG + Intergenic
988712979 5:33796770-33796792 GCAGGAAAAGAAATGGTGCAAGG + Intronic
990725563 5:58750443-58750465 CCACTCAAAGAAATGGGCCAAGG - Intronic
991038409 5:62151390-62151412 GGATTCTAAGAAATGGGTGATGG - Intergenic
992341282 5:75826076-75826098 GAATACAAAGAAATAGGGCAGGG - Intergenic
993855163 5:93065586-93065608 GCATACAAAATAATGGGGAAAGG + Intergenic
994076434 5:95655734-95655756 TCCTTGACAGAAATGGGGCAAGG - Intronic
994316714 5:98340988-98341010 GAATTTAAAGAAATGGTGTATGG - Intergenic
994806893 5:104459385-104459407 GTATTCAAAGAACTGGAGAATGG + Intergenic
995092377 5:108193444-108193466 GAATGAAAAGAAAAGGGGCAGGG + Intronic
995198390 5:109398915-109398937 CCTATCAAAGAAATGGGGCCGGG + Intronic
995554395 5:113312574-113312596 GAATGCAAAGAAATGAGGCTGGG + Intronic
995921297 5:117317169-117317191 GCATTTAAAAAAATGGAGAAAGG - Intergenic
996941424 5:129010340-129010362 GCATTCCAGGAATTAGGGCATGG - Intronic
997638983 5:135436074-135436096 GCATTCCAAGAAATGGCTCATGG + Intergenic
998769338 5:145524223-145524245 GCATTCACAGGAATGGGTCATGG + Intronic
999252774 5:150192496-150192518 GCAATCAAATAGCTGGGGCAGGG - Intronic
1000793761 5:165639175-165639197 GCATTCACAGAAAAGCGGTATGG - Intergenic
1001518533 5:172374166-172374188 GGACCCCAAGAAATGGGGCAGGG - Intronic
1001923977 5:175622786-175622808 TCATTCCAAGGAATGGGCCAGGG + Intergenic
1005120086 6:22380066-22380088 GGAGACAAAGAGATGGGGCAGGG - Intergenic
1009519983 6:64669475-64669497 TCATTCAAAGAACTGGTCCAGGG - Intronic
1010381937 6:75235551-75235573 GCATTCCAAGGAATGGGAAAAGG - Intergenic
1013506815 6:110808909-110808931 CTGTTCAAAGAAATGGGGCCAGG + Intronic
1013990439 6:116248795-116248817 CAATACAAAGAAATGGAGCAGGG + Exonic
1014259278 6:119197524-119197546 GCACTCAAAGCGCTGGGGCAGGG + Intronic
1014883302 6:126748592-126748614 CCCTTAAAAGAAATGGGGGAAGG - Intergenic
1014964288 6:127727855-127727877 GGTTTCAAAGAAATGGTGCCAGG - Intronic
1019623093 7:2002162-2002184 GCAGTCCTAGAAATGGGGCCTGG - Intronic
1020339869 7:7098746-7098768 GAATTCAGAGAAATGGAGGATGG - Intergenic
1020901437 7:14008388-14008410 GGAAGCAAAGAATTGGGGCAAGG - Intergenic
1021569569 7:22050918-22050940 GCTTTCAAGGAAATGAGGCCTGG + Intergenic
1022439918 7:30424801-30424823 CCCTCCAAAGAAATAGGGCATGG - Exonic
1023528485 7:41129791-41129813 GCATTCCAACACATGGTGCAGGG + Intergenic
1027798131 7:82719262-82719284 GCATTCCAAGGGATGGGCCAAGG - Intergenic
1028910169 7:96199083-96199105 GGATTCAAAGAGATGAAGCAGGG - Intronic
1031094367 7:117401755-117401777 GCATTCCAAGAAATGGGCCAGGG + Intronic
1031094946 7:117405957-117405979 GTATTCCAAGGAATGGGCCAGGG + Intronic
1032022638 7:128418112-128418134 GCATACAAAGAAATCTGGCCAGG + Intergenic
1032532539 7:132634141-132634163 GCATTCCAAGGAATGGGCCAAGG - Intronic
1032606910 7:133365379-133365401 TAATTCAAAGAAATAGGGCCTGG + Intronic
1035048561 7:155984736-155984758 GGATTCTAAGGAAAGGGGCATGG + Intergenic
1036970926 8:13354108-13354130 CCAAGCAAAGACATGGGGCAGGG - Intronic
1044104810 8:88190957-88190979 GCAAACAAAGACATGGGGAAGGG + Intronic
1051032751 9:12702080-12702102 TGATTCAAAGAAATGGGACATGG + Intronic
1056099612 9:83288260-83288282 ACATTCAAAGACAAGGGCCATGG + Intronic
1058009866 9:99965039-99965061 GCATGCTAAGATATGGGGCTGGG - Intronic
1058066759 9:100557073-100557095 GCATACAAGATAATGGGGCAGGG - Intronic
1058421823 9:104840088-104840110 GCATTCAGAGAACTGGGGACAGG + Intronic
1059392924 9:114010409-114010431 GCATTCAAAGAATTCAGGCTGGG + Intronic
1061121718 9:128647335-128647357 TCAGAGAAAGAAATGGGGCATGG + Intronic
1061456619 9:130702886-130702908 AGATTAAAAGGAATGGGGCAGGG - Intronic
1203569773 Un_KI270744v1:120041-120063 GAGTTGAAAGAAATGGGGGATGG + Intergenic
1203660901 Un_KI270753v1:42006-42028 GCAACCAAAGAAAAGGGGCTTGG + Intergenic
1203672084 Un_KI270755v1:25215-25237 GCAACCAAAGAAAAGGGGCTTGG + Intergenic
1187087440 X:16055922-16055944 ACATTCAAAGAAATGGAGAGAGG + Intergenic
1187190819 X:17033285-17033307 GGATTGAAACAAATGAGGCAGGG - Intronic
1187598761 X:20803331-20803353 CCATTAAAGAAAATGGGGCATGG + Intergenic
1188581456 X:31718841-31718863 GGATTCAATGAAATGACGCATGG - Intronic
1188813367 X:34680667-34680689 ACATTCAAAGAAATGCAGCTGGG + Intergenic
1189606341 X:42682033-42682055 GCATTCCAAGGCATGGGCCAGGG + Intergenic
1190403054 X:50058179-50058201 GCATTCAAAGAAATGGGGCAGGG - Intronic
1190937894 X:55013102-55013124 GTATTAAAAGAAAGAGGGCATGG - Intronic
1192057667 X:67788635-67788657 GCATCCAGAGAAATGGGAGAAGG + Intergenic
1192265238 X:69533146-69533168 GCTTTCACATAAATGGGGAAAGG + Intergenic
1193745359 X:85272220-85272242 GCAATTTTAGAAATGGGGCAGGG + Exonic
1193869331 X:86777784-86777806 ACAGTCAAAGGAATGTGGCAAGG - Intronic
1196200305 X:112879140-112879162 GAATTCAAATAAAAGAGGCAGGG + Intergenic
1199070701 X:143471726-143471748 ACATTCACATAAATGGGGGAAGG + Intergenic
1199478360 X:148271139-148271161 GTATTTAGAGAAATGGGGCTGGG - Intergenic