ID: 1190407302

View in Genome Browser
Species Human (GRCh38)
Location X:50100885-50100907
Sequence TGCTAGGAAAAGAGCTTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190407302_1190407307 11 Left 1190407302 X:50100885-50100907 CCTCCCAAGCTCTTTTCCTAGCA No data
Right 1190407307 X:50100919-50100941 GCCCTCCCCTTGAGCTCCCAAGG No data
1190407302_1190407313 23 Left 1190407302 X:50100885-50100907 CCTCCCAAGCTCTTTTCCTAGCA No data
Right 1190407313 X:50100931-50100953 AGCTCCCAAGGCCCCTCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190407302 Original CRISPR TGCTAGGAAAAGAGCTTGGG AGG (reversed) Intergenic
No off target data available for this crispr