ID: 1190407390

View in Genome Browser
Species Human (GRCh38)
Location X:50101496-50101518
Sequence AGAAGCCCCTTTTCAAGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190407390_1190407392 -7 Left 1190407390 X:50101496-50101518 CCTCCTCTTGAAAAGGGGCTTCT No data
Right 1190407392 X:50101512-50101534 GGCTTCTGCATCTCACAGTATGG No data
1190407390_1190407395 28 Left 1190407390 X:50101496-50101518 CCTCCTCTTGAAAAGGGGCTTCT No data
Right 1190407395 X:50101547-50101569 CAAGATTCTCCTTGCCTTGGAGG No data
1190407390_1190407394 25 Left 1190407390 X:50101496-50101518 CCTCCTCTTGAAAAGGGGCTTCT No data
Right 1190407394 X:50101544-50101566 CCACAAGATTCTCCTTGCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190407390 Original CRISPR AGAAGCCCCTTTTCAAGAGG AGG (reversed) Intergenic
No off target data available for this crispr