ID: 1190407392

View in Genome Browser
Species Human (GRCh38)
Location X:50101512-50101534
Sequence GGCTTCTGCATCTCACAGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190407391_1190407392 -10 Left 1190407391 X:50101499-50101521 CCTCTTGAAAAGGGGCTTCTGCA No data
Right 1190407392 X:50101512-50101534 GGCTTCTGCATCTCACAGTATGG No data
1190407390_1190407392 -7 Left 1190407390 X:50101496-50101518 CCTCCTCTTGAAAAGGGGCTTCT No data
Right 1190407392 X:50101512-50101534 GGCTTCTGCATCTCACAGTATGG No data
1190407386_1190407392 7 Left 1190407386 X:50101482-50101504 CCTTGGATGAACAGCCTCCTCTT No data
Right 1190407392 X:50101512-50101534 GGCTTCTGCATCTCACAGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190407392 Original CRISPR GGCTTCTGCATCTCACAGTA TGG Intergenic
No off target data available for this crispr