ID: 1190407394

View in Genome Browser
Species Human (GRCh38)
Location X:50101544-50101566
Sequence CCACAAGATTCTCCTTGCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190407391_1190407394 22 Left 1190407391 X:50101499-50101521 CCTCTTGAAAAGGGGCTTCTGCA No data
Right 1190407394 X:50101544-50101566 CCACAAGATTCTCCTTGCCTTGG No data
1190407390_1190407394 25 Left 1190407390 X:50101496-50101518 CCTCCTCTTGAAAAGGGGCTTCT No data
Right 1190407394 X:50101544-50101566 CCACAAGATTCTCCTTGCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190407394 Original CRISPR CCACAAGATTCTCCTTGCCT TGG Intergenic
No off target data available for this crispr