ID: 1190407395

View in Genome Browser
Species Human (GRCh38)
Location X:50101547-50101569
Sequence CAAGATTCTCCTTGCCTTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190407390_1190407395 28 Left 1190407390 X:50101496-50101518 CCTCCTCTTGAAAAGGGGCTTCT No data
Right 1190407395 X:50101547-50101569 CAAGATTCTCCTTGCCTTGGAGG No data
1190407391_1190407395 25 Left 1190407391 X:50101499-50101521 CCTCTTGAAAAGGGGCTTCTGCA No data
Right 1190407395 X:50101547-50101569 CAAGATTCTCCTTGCCTTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190407395 Original CRISPR CAAGATTCTCCTTGCCTTGG AGG Intergenic
No off target data available for this crispr