ID: 1190408344

View in Genome Browser
Species Human (GRCh38)
Location X:50110125-50110147
Sequence CCGTAGCCTCCAAATTTTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190408344_1190408353 18 Left 1190408344 X:50110125-50110147 CCTCAAAAATTTGGAGGCTACGG No data
Right 1190408353 X:50110166-50110188 GAGGGCAGGGGTGTGAAAAATGG No data
1190408344_1190408350 4 Left 1190408344 X:50110125-50110147 CCTCAAAAATTTGGAGGCTACGG No data
Right 1190408350 X:50110152-50110174 TCAAAGGCAGTTTGGAGGGCAGG No data
1190408344_1190408349 0 Left 1190408344 X:50110125-50110147 CCTCAAAAATTTGGAGGCTACGG No data
Right 1190408349 X:50110148-50110170 TTTTTCAAAGGCAGTTTGGAGGG No data
1190408344_1190408352 6 Left 1190408344 X:50110125-50110147 CCTCAAAAATTTGGAGGCTACGG No data
Right 1190408352 X:50110154-50110176 AAAGGCAGTTTGGAGGGCAGGGG No data
1190408344_1190408347 -4 Left 1190408344 X:50110125-50110147 CCTCAAAAATTTGGAGGCTACGG No data
Right 1190408347 X:50110144-50110166 ACGGTTTTTCAAAGGCAGTTTGG No data
1190408344_1190408348 -1 Left 1190408344 X:50110125-50110147 CCTCAAAAATTTGGAGGCTACGG No data
Right 1190408348 X:50110147-50110169 GTTTTTCAAAGGCAGTTTGGAGG 0: 21
1: 55
2: 113
3: 196
4: 491
1190408344_1190408351 5 Left 1190408344 X:50110125-50110147 CCTCAAAAATTTGGAGGCTACGG No data
Right 1190408351 X:50110153-50110175 CAAAGGCAGTTTGGAGGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190408344 Original CRISPR CCGTAGCCTCCAAATTTTTG AGG (reversed) Intergenic
No off target data available for this crispr