ID: 1190413048

View in Genome Browser
Species Human (GRCh38)
Location X:50156098-50156120
Sequence GCGAGGGAACCCCCAAGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190413048_1190413058 25 Left 1190413048 X:50156098-50156120 CCAGCCCTTGGGGGTTCCCTCGC No data
Right 1190413058 X:50156146-50156168 ACTAGCTATCCCTATGGTGTCGG 0: 1
1: 0
2: 0
3: 4
4: 46
1190413048_1190413057 19 Left 1190413048 X:50156098-50156120 CCAGCCCTTGGGGGTTCCCTCGC No data
Right 1190413057 X:50156140-50156162 TGCTTCACTAGCTATCCCTATGG 0: 1
1: 0
2: 0
3: 5
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190413048 Original CRISPR GCGAGGGAACCCCCAAGGGC TGG (reversed) Intergenic
No off target data available for this crispr