ID: 1190413049

View in Genome Browser
Species Human (GRCh38)
Location X:50156102-50156124
Sequence GAAGGCGAGGGAACCCCCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190413049_1190413058 21 Left 1190413049 X:50156102-50156124 CCCTTGGGGGTTCCCTCGCCTTC No data
Right 1190413058 X:50156146-50156168 ACTAGCTATCCCTATGGTGTCGG 0: 1
1: 0
2: 0
3: 4
4: 46
1190413049_1190413059 29 Left 1190413049 X:50156102-50156124 CCCTTGGGGGTTCCCTCGCCTTC No data
Right 1190413059 X:50156154-50156176 TCCCTATGGTGTCGGTGTGCAGG 0: 1
1: 0
2: 0
3: 8
4: 79
1190413049_1190413057 15 Left 1190413049 X:50156102-50156124 CCCTTGGGGGTTCCCTCGCCTTC No data
Right 1190413057 X:50156140-50156162 TGCTTCACTAGCTATCCCTATGG 0: 1
1: 0
2: 0
3: 5
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190413049 Original CRISPR GAAGGCGAGGGAACCCCCAA GGG (reversed) Intergenic
No off target data available for this crispr