ID: 1190413050

View in Genome Browser
Species Human (GRCh38)
Location X:50156103-50156125
Sequence GGAAGGCGAGGGAACCCCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190413050_1190413059 28 Left 1190413050 X:50156103-50156125 CCTTGGGGGTTCCCTCGCCTTCC No data
Right 1190413059 X:50156154-50156176 TCCCTATGGTGTCGGTGTGCAGG 0: 1
1: 0
2: 0
3: 8
4: 79
1190413050_1190413058 20 Left 1190413050 X:50156103-50156125 CCTTGGGGGTTCCCTCGCCTTCC No data
Right 1190413058 X:50156146-50156168 ACTAGCTATCCCTATGGTGTCGG 0: 1
1: 0
2: 0
3: 4
4: 46
1190413050_1190413057 14 Left 1190413050 X:50156103-50156125 CCTTGGGGGTTCCCTCGCCTTCC No data
Right 1190413057 X:50156140-50156162 TGCTTCACTAGCTATCCCTATGG 0: 1
1: 0
2: 0
3: 5
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190413050 Original CRISPR GGAAGGCGAGGGAACCCCCA AGG (reversed) Intergenic
No off target data available for this crispr