ID: 1190413054

View in Genome Browser
Species Human (GRCh38)
Location X:50156124-50156146
Sequence TGAAGCAGATGAGCAGGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190413054_1190413062 13 Left 1190413054 X:50156124-50156146 CCACCTCCTGCTCATCTGCTTCA No data
Right 1190413062 X:50156160-50156182 TGGTGTCGGTGTGCAGGCCGTGG 0: 1
1: 0
2: 0
3: 11
4: 143
1190413054_1190413063 23 Left 1190413054 X:50156124-50156146 CCACCTCCTGCTCATCTGCTTCA No data
Right 1190413063 X:50156170-50156192 GTGCAGGCCGTGGCCTGCTGTGG 0: 1
1: 0
2: 2
3: 26
4: 260
1190413054_1190413059 7 Left 1190413054 X:50156124-50156146 CCACCTCCTGCTCATCTGCTTCA No data
Right 1190413059 X:50156154-50156176 TCCCTATGGTGTCGGTGTGCAGG 0: 1
1: 0
2: 0
3: 8
4: 79
1190413054_1190413057 -7 Left 1190413054 X:50156124-50156146 CCACCTCCTGCTCATCTGCTTCA No data
Right 1190413057 X:50156140-50156162 TGCTTCACTAGCTATCCCTATGG 0: 1
1: 0
2: 0
3: 5
4: 82
1190413054_1190413058 -1 Left 1190413054 X:50156124-50156146 CCACCTCCTGCTCATCTGCTTCA No data
Right 1190413058 X:50156146-50156168 ACTAGCTATCCCTATGGTGTCGG 0: 1
1: 0
2: 0
3: 4
4: 46

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190413054 Original CRISPR TGAAGCAGATGAGCAGGAGG TGG (reversed) Intergenic
No off target data available for this crispr