ID: 1190413057

View in Genome Browser
Species Human (GRCh38)
Location X:50156140-50156162
Sequence TGCTTCACTAGCTATCCCTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 82}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190413051_1190413057 3 Left 1190413051 X:50156114-50156136 CCCTCGCCTTCCACCTCCTGCTC No data
Right 1190413057 X:50156140-50156162 TGCTTCACTAGCTATCCCTATGG 0: 1
1: 0
2: 0
3: 5
4: 82
1190413053_1190413057 -3 Left 1190413053 X:50156120-50156142 CCTTCCACCTCCTGCTCATCTGC No data
Right 1190413057 X:50156140-50156162 TGCTTCACTAGCTATCCCTATGG 0: 1
1: 0
2: 0
3: 5
4: 82
1190413054_1190413057 -7 Left 1190413054 X:50156124-50156146 CCACCTCCTGCTCATCTGCTTCA No data
Right 1190413057 X:50156140-50156162 TGCTTCACTAGCTATCCCTATGG 0: 1
1: 0
2: 0
3: 5
4: 82
1190413055_1190413057 -10 Left 1190413055 X:50156127-50156149 CCTCCTGCTCATCTGCTTCACTA No data
Right 1190413057 X:50156140-50156162 TGCTTCACTAGCTATCCCTATGG 0: 1
1: 0
2: 0
3: 5
4: 82
1190413044_1190413057 30 Left 1190413044 X:50156087-50156109 CCTGTGGCAGTCCAGCCCTTGGG No data
Right 1190413057 X:50156140-50156162 TGCTTCACTAGCTATCCCTATGG 0: 1
1: 0
2: 0
3: 5
4: 82
1190413050_1190413057 14 Left 1190413050 X:50156103-50156125 CCTTGGGGGTTCCCTCGCCTTCC No data
Right 1190413057 X:50156140-50156162 TGCTTCACTAGCTATCCCTATGG 0: 1
1: 0
2: 0
3: 5
4: 82
1190413048_1190413057 19 Left 1190413048 X:50156098-50156120 CCAGCCCTTGGGGGTTCCCTCGC No data
Right 1190413057 X:50156140-50156162 TGCTTCACTAGCTATCCCTATGG 0: 1
1: 0
2: 0
3: 5
4: 82
1190413052_1190413057 2 Left 1190413052 X:50156115-50156137 CCTCGCCTTCCACCTCCTGCTCA No data
Right 1190413057 X:50156140-50156162 TGCTTCACTAGCTATCCCTATGG 0: 1
1: 0
2: 0
3: 5
4: 82
1190413049_1190413057 15 Left 1190413049 X:50156102-50156124 CCCTTGGGGGTTCCCTCGCCTTC No data
Right 1190413057 X:50156140-50156162 TGCTTCACTAGCTATCCCTATGG 0: 1
1: 0
2: 0
3: 5
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190413057 Original CRISPR TGCTTCACTAGCTATCCCTA TGG Intergenic
900868970 1:5288430-5288452 TGCTTCACTTGTTCTCCCAAAGG + Intergenic
902528797 1:17077045-17077067 TGCTACACTTGCTATCCCTTGGG + Intronic
904308230 1:29604623-29604645 TGCTTCACTAGCTAGGCTTGAGG - Intergenic
905918155 1:41699979-41700001 TGCTCCACTTGCTGTCCCTTGGG + Intronic
918568996 1:185965149-185965171 TGCTTCACTTGCTTGCCCAATGG - Intronic
921898310 1:220424067-220424089 TGTGTCTCTAGCTATCCCTTTGG + Intergenic
1063895424 10:10676392-10676414 TGGTTAACTAGCTTTTCCTAAGG + Intergenic
1065139219 10:22704255-22704277 TGCTTCACTAGCCACTCCTTAGG - Intronic
1070787489 10:79170443-79170465 AGCTTCTCTATCTATCCCTAGGG - Intronic
1072574066 10:96684208-96684230 TGCCTAACTAGCTATGCCAATGG - Intronic
1083187865 11:61027844-61027866 CCCTACACTAGCTATCCCCAGGG - Intergenic
1085142061 11:74154933-74154955 TGCTTCACCAGCTCTTGCTATGG - Intronic
1085373516 11:76035935-76035957 AGATTCATTAGGTATCCCTAGGG + Intronic
1085379257 11:76098230-76098252 TCCCTCAGTAGCTATTCCTAAGG - Intronic
1085521206 11:77139878-77139900 TGCTTCAAGAACTTTCCCTAGGG + Intronic
1087040557 11:93795181-93795203 TGCTTTACTGGCTGTCACTATGG - Intronic
1094697398 12:32834111-32834133 TGCTTCACTAACTTTGCCTTGGG - Intronic
1102229743 12:111254255-111254277 TGCTTCTCCAGACATCCCTAAGG + Intronic
1103003140 12:117401389-117401411 TTCTTCTCTTGCTGTCCCTAGGG + Intronic
1107553436 13:41497411-41497433 TGCCACACCAGCTATCCCTGTGG - Intergenic
1107920149 13:45197786-45197808 TGCTTCAGTACCTATACCAAGGG + Intronic
1108679581 13:52768230-52768252 TCCTTCCCTTGCTTTCCCTAGGG + Intergenic
1114809495 14:25880796-25880818 TGCTTCATTTACTATCCCTTGGG - Intergenic
1117096994 14:52309271-52309293 TTCTTCTCTAGCTATCAGTAGGG + Intergenic
1117206853 14:53452173-53452195 TGCTGCACTTGCTATCACCAGGG + Intergenic
1128929539 15:71691788-71691810 TGGTTCACTAGGGATCCCCAGGG - Intronic
1138156381 16:54708791-54708813 TGCTCCCCTAGCTATCAATATGG - Intergenic
1140792229 16:78402942-78402964 TTCTTCATTAGCTATTCCCAGGG + Intronic
1144265954 17:13569742-13569764 TGTTTCACTACCTTTCCCAAGGG - Intronic
1150461244 17:65355504-65355526 TGCTTCAGTGGCTACCCCTAAGG + Intergenic
1152277392 17:79366086-79366108 TGCTCTACTTGCTTTCCCTAAGG - Intronic
1153669233 18:7394249-7394271 AGCAGCACTGGCTATCCCTACGG - Intergenic
1155976591 18:32138675-32138697 TGCTTGACTGGCTATACTTATGG + Intronic
1161166613 19:2791234-2791256 TGCTTCCCGAGCTCTGCCTAAGG + Intronic
1163104910 19:15117748-15117770 TGGTTGACTGGCTACCCCTAGGG + Intronic
928054830 2:28042419-28042441 TACTTCACTGGCTCTCCCTCTGG - Intronic
928936327 2:36682678-36682700 TGCTCCTCTCGCTATCCCCAGGG - Intergenic
929561514 2:42959305-42959327 TGTTTCACTGGCTATCCTTTGGG + Intergenic
940045892 2:149409449-149409471 TGCTTAACCAGGTGTCCCTAGGG - Intronic
957543210 3:81603044-81603066 TCCTAAACTAGCTATCCATATGG + Intronic
959613353 3:108319189-108319211 TATTTTACTAGCTATCACTATGG - Intronic
971959184 4:33462962-33462984 TGCTGCACTAGCCTTCCCCATGG - Intergenic
973194269 4:47421819-47421841 TGCTTCACTCTATATCTCTAAGG + Intronic
975714130 4:77189373-77189395 TGCCACACGAGCTATCCTTAGGG - Intronic
980459387 4:133086825-133086847 TTCCTAACTAGCTATCCCCAAGG + Intergenic
982156572 4:152528307-152528329 TGATCCACTAGCTGTCCCTTAGG + Intronic
982913573 4:161176442-161176464 TGTTTCTCTAGATATCCCTTAGG - Intergenic
996497217 5:124173146-124173168 TGCTTTCATATCTATCCCTATGG + Intergenic
997160113 5:131599618-131599640 AGATTCATTAGGTATCCCTATGG - Intronic
1000247831 5:159463623-159463645 TACTTCACAAGCTATTACTATGG - Intergenic
1000979872 5:167805249-167805271 TGTTTTATTAGCTGTCCCTATGG + Intronic
1001580614 5:172795639-172795661 TGAGTCACCAGCCATCCCTAGGG - Intergenic
1004604572 6:17181917-17181939 TGGTTCACTAGCATTCTCTAAGG + Intergenic
1004639143 6:17497217-17497239 GACTTCACTAGTAATCCCTAGGG - Intronic
1005197398 6:23303862-23303884 TGTTTCACTAGCGATTCCTGAGG + Intergenic
1008402288 6:51078042-51078064 TGCTTAACCAGGTGTCCCTAGGG - Intergenic
1012063874 6:94522182-94522204 TGCTACAAAAACTATCCCTAAGG + Intergenic
1013691832 6:112654163-112654185 TGCTTCACTGTCTATCATTAGGG - Intergenic
1013854368 6:114553815-114553837 TGCTATACCATCTATCCCTAAGG - Intergenic
1014195086 6:118546175-118546197 ATCTTCACTAGCTAACCCAAAGG + Intronic
1014314378 6:119844708-119844730 TGCTTCCCTATGTATCCTTAAGG + Intergenic
1014420262 6:121235249-121235271 TGCTTAACCAGGTGTCCCTAGGG - Intronic
1014482008 6:121950821-121950843 TACTTAACCAGGTATCCCTAGGG - Intergenic
1015355692 6:132274961-132274983 TGCTTTCCTTGCTATCCCTGGGG + Intergenic
1017185199 6:151593642-151593664 TGATTCACTTCCCATCCCTAGGG + Intronic
1017636280 6:156446313-156446335 TACTTTAGTAGCTATACCTAAGG + Intergenic
1024599709 7:50969878-50969900 TCCTTCACTAGCCAGTCCTAAGG - Intergenic
1027691656 7:81354412-81354434 TACTTAACTAGGTGTCCCTAGGG - Intergenic
1028106467 7:86884971-86884993 TGCTTCACTAAGTTTTCCTATGG - Intronic
1036408584 8:8477808-8477830 TACTTCCCTGGCTATTCCTAGGG + Intergenic
1039074603 8:33678501-33678523 TGCTTCACTGGGTATCTCAAAGG + Intergenic
1044803593 8:95981886-95981908 TGCTTCATGACCTATCCCTTAGG - Intergenic
1045989143 8:108285511-108285533 TGCTTTAATAACTATTCCTATGG + Intronic
1046578225 8:116058573-116058595 TGCTTGACTATCCATCCATATGG + Intergenic
1050297867 9:4224505-4224527 TGCTTCACTATTTAACCTTATGG + Intronic
1050400490 9:5248260-5248282 TACTTAACTAGGTGTCCCTAGGG + Intergenic
1051118818 9:13729283-13729305 TGCTTCACTAGCTAACCAGCTGG - Intergenic
1055859815 9:80735288-80735310 TCCTTCACTAGCTAGCCTCAGGG - Intergenic
1058426822 9:104882756-104882778 TGCACCCCTAGCTGTCCCTAAGG + Intronic
1058748327 9:108014084-108014106 TGCATCACTCTCTTTCCCTATGG - Intergenic
1060314427 9:122496233-122496255 TGCTTAACTAGGTGTCCCTAGGG - Intergenic
1061034677 9:128106978-128107000 TGCCTCACTAGCCCTTCCTAGGG + Intronic
1187588885 X:20693669-20693691 TACTTAACTAGGTGTCCCTAGGG + Intergenic
1190413057 X:50156140-50156162 TGCTTCACTAGCTATCCCTATGG + Intergenic
1195237127 X:102911470-102911492 TACTTAACCAGCTGTCCCTAGGG + Intergenic
1195972794 X:110491809-110491831 TGCTTAACCAGGTATCCCTAGGG - Intergenic
1199861777 X:151807511-151807533 TCCTGCTCTAGCTGTCCCTAGGG + Intergenic
1200056150 X:153462435-153462457 TGCTTCTCTAGGCATCCCTGGGG - Intronic