ID: 1190413058

View in Genome Browser
Species Human (GRCh38)
Location X:50156146-50156168
Sequence ACTAGCTATCCCTATGGTGT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 51
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 46}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190413050_1190413058 20 Left 1190413050 X:50156103-50156125 CCTTGGGGGTTCCCTCGCCTTCC No data
Right 1190413058 X:50156146-50156168 ACTAGCTATCCCTATGGTGTCGG 0: 1
1: 0
2: 0
3: 4
4: 46
1190413051_1190413058 9 Left 1190413051 X:50156114-50156136 CCCTCGCCTTCCACCTCCTGCTC No data
Right 1190413058 X:50156146-50156168 ACTAGCTATCCCTATGGTGTCGG 0: 1
1: 0
2: 0
3: 4
4: 46
1190413056_1190413058 -7 Left 1190413056 X:50156130-50156152 CCTGCTCATCTGCTTCACTAGCT No data
Right 1190413058 X:50156146-50156168 ACTAGCTATCCCTATGGTGTCGG 0: 1
1: 0
2: 0
3: 4
4: 46
1190413053_1190413058 3 Left 1190413053 X:50156120-50156142 CCTTCCACCTCCTGCTCATCTGC No data
Right 1190413058 X:50156146-50156168 ACTAGCTATCCCTATGGTGTCGG 0: 1
1: 0
2: 0
3: 4
4: 46
1190413048_1190413058 25 Left 1190413048 X:50156098-50156120 CCAGCCCTTGGGGGTTCCCTCGC No data
Right 1190413058 X:50156146-50156168 ACTAGCTATCCCTATGGTGTCGG 0: 1
1: 0
2: 0
3: 4
4: 46
1190413052_1190413058 8 Left 1190413052 X:50156115-50156137 CCTCGCCTTCCACCTCCTGCTCA No data
Right 1190413058 X:50156146-50156168 ACTAGCTATCCCTATGGTGTCGG 0: 1
1: 0
2: 0
3: 4
4: 46
1190413054_1190413058 -1 Left 1190413054 X:50156124-50156146 CCACCTCCTGCTCATCTGCTTCA No data
Right 1190413058 X:50156146-50156168 ACTAGCTATCCCTATGGTGTCGG 0: 1
1: 0
2: 0
3: 4
4: 46
1190413049_1190413058 21 Left 1190413049 X:50156102-50156124 CCCTTGGGGGTTCCCTCGCCTTC No data
Right 1190413058 X:50156146-50156168 ACTAGCTATCCCTATGGTGTCGG 0: 1
1: 0
2: 0
3: 4
4: 46
1190413055_1190413058 -4 Left 1190413055 X:50156127-50156149 CCTCCTGCTCATCTGCTTCACTA No data
Right 1190413058 X:50156146-50156168 ACTAGCTATCCCTATGGTGTCGG 0: 1
1: 0
2: 0
3: 4
4: 46

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190413058 Original CRISPR ACTAGCTATCCCTATGGTGT CGG Intergenic
900577237 1:3389408-3389430 AAGAGCTATCCCTATGGCGTGGG + Intronic
904751703 1:32744672-32744694 ACTAGCAAGCCCCATGATGTAGG + Intronic
906914091 1:49989473-49989495 ACTAACTATACCTATAGTATTGG - Intronic
907137760 1:52155648-52155670 GCAAGCAATCCCTATGCTGTTGG - Intronic
907606003 1:55818137-55818159 ATTACCTATCCCCATTGTGTGGG + Intergenic
910182554 1:84501775-84501797 ACTAGTTATTCCTACAGTGTGGG + Intronic
1066215930 10:33287606-33287628 ACTAGCTATCTCAATAGTGATGG - Intronic
1071909659 10:90217148-90217170 AGTAGCTTTCCCCATGGGGTGGG + Intergenic
1073972928 10:109064996-109065018 AATAGCTCTCCCTATGATTTGGG - Intergenic
1081679396 11:44991018-44991040 ACTTAATCTCCCTATGGTGTGGG - Intergenic
1085668440 11:78438251-78438273 ACTAGATATCCCTGTAATGTTGG - Intronic
1095833234 12:46609810-46609832 ACTAGCCATCTCTATGGCCTTGG + Intergenic
1108462609 13:50682169-50682191 ACTAACTACCCCCATGGTGTGGG - Intronic
1108740472 13:53332161-53332183 ACTAGTTTTCCCATTGGTGTGGG + Intergenic
1110750103 13:79103569-79103591 AACTGCTATCCCTGTGGTGTTGG + Intergenic
1143700966 17:8659809-8659831 ACCAGCTATCCCTCTGTTGTGGG + Intergenic
1150651016 17:67010198-67010220 ACTCGCTGTCCCAGTGGTGTGGG + Intronic
1153002591 18:469457-469479 ACTACCTATCCATAATGTGTTGG - Intronic
929281251 2:40081952-40081974 ACTAGATATCCCTATGTGGAAGG - Intergenic
1173433567 20:43012793-43012815 ACTGGCCATCCCCATGGTGATGG - Intronic
956636181 3:71367816-71367838 ACTAGCCATCATTATGGTCTTGG - Intronic
971720653 4:30241184-30241206 ACTAGCTAACCAAATGCTGTTGG - Intergenic
972392370 4:38625959-38625981 TCTAGCTATTCCTATGCTCTAGG - Intergenic
975836409 4:78426833-78426855 ACTAGCTATCACTTGGGTGCAGG - Intronic
981797825 4:148617650-148617672 ACTAGCTAGACAGATGGTGTAGG + Intergenic
986970312 5:13327032-13327054 ACTACCTAACCCTGTGGTTTTGG + Intergenic
994679734 5:102870991-102871013 GTTAACTATCCCTTTGGTGTTGG + Intronic
1000856437 5:166403853-166403875 AGTAGAGATCCCTATAGTGTGGG - Intergenic
1001709732 5:173768579-173768601 ACTTGCTAGCCATATGATGTGGG + Intergenic
1006205085 6:32333623-32333645 AACAGCTATCCCTCTGCTGTGGG - Intronic
1013355733 6:109344374-109344396 CCCAGCAATCCCTGTGGTGTGGG - Intergenic
1013361595 6:109398438-109398460 AATAATTATCCCTATGGAGTGGG + Intronic
1014501607 6:122197507-122197529 ACTAGCTATGTGTAGGGTGTGGG - Intergenic
1017534449 6:155331247-155331269 ACTTGCTATCTCTGTGATGTGGG + Intergenic
1029199785 7:98831211-98831233 AGCAGCTATCACTATGGTGTTGG + Intergenic
1031470931 7:122168548-122168570 ACTGGCTTTCCATGTGGTGTGGG - Intergenic
1034003002 7:147437153-147437175 ATCAGCAATCCCTCTGGTGTTGG - Intronic
1034148309 7:148891818-148891840 ACTGGCTATCCTTACGGGGTGGG + Intergenic
1037615502 8:20515339-20515361 ACTAAGTATCCATATGGTTTTGG + Intergenic
1046072766 8:109278566-109278588 ACTTGTTATCTCTAGGGTGTAGG - Intronic
1053370166 9:37554168-37554190 ACAAGGGATCCATATGGTGTTGG - Intronic
1055179017 9:73359805-73359827 ACTTGCTAACCGTGTGGTGTTGG + Intergenic
1061964756 9:134006915-134006937 AATGGCTATGTCTATGGTGTGGG - Intergenic
1062182617 9:135198718-135198740 GCTTGCTCTCCCTTTGGTGTCGG - Intergenic
1185912751 X:4000434-4000456 TCTGGCAAACCCTATGGTGTTGG + Intergenic
1186731797 X:12418226-12418248 ACAAGCTGTCTCTATGGTGATGG - Intronic
1187581148 X:20608733-20608755 ACTAGCAATCTCTAGGTTGTGGG + Intergenic
1187685753 X:21814142-21814164 ACTAGCTGCCCCTGGGGTGTAGG - Intergenic
1189105536 X:38231423-38231445 GCTTCCTATCCCTATGTTGTAGG + Intronic
1190413058 X:50156146-50156168 ACTAGCTATCCCTATGGTGTCGG + Intergenic
1195370853 X:104170806-104170828 CCTAGCTACCCCAATTGTGTTGG - Intronic