ID: 1190413059

View in Genome Browser
Species Human (GRCh38)
Location X:50156154-50156176
Sequence TCCCTATGGTGTCGGTGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 79}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190413053_1190413059 11 Left 1190413053 X:50156120-50156142 CCTTCCACCTCCTGCTCATCTGC No data
Right 1190413059 X:50156154-50156176 TCCCTATGGTGTCGGTGTGCAGG 0: 1
1: 0
2: 0
3: 8
4: 79
1190413055_1190413059 4 Left 1190413055 X:50156127-50156149 CCTCCTGCTCATCTGCTTCACTA No data
Right 1190413059 X:50156154-50156176 TCCCTATGGTGTCGGTGTGCAGG 0: 1
1: 0
2: 0
3: 8
4: 79
1190413052_1190413059 16 Left 1190413052 X:50156115-50156137 CCTCGCCTTCCACCTCCTGCTCA No data
Right 1190413059 X:50156154-50156176 TCCCTATGGTGTCGGTGTGCAGG 0: 1
1: 0
2: 0
3: 8
4: 79
1190413054_1190413059 7 Left 1190413054 X:50156124-50156146 CCACCTCCTGCTCATCTGCTTCA No data
Right 1190413059 X:50156154-50156176 TCCCTATGGTGTCGGTGTGCAGG 0: 1
1: 0
2: 0
3: 8
4: 79
1190413051_1190413059 17 Left 1190413051 X:50156114-50156136 CCCTCGCCTTCCACCTCCTGCTC No data
Right 1190413059 X:50156154-50156176 TCCCTATGGTGTCGGTGTGCAGG 0: 1
1: 0
2: 0
3: 8
4: 79
1190413050_1190413059 28 Left 1190413050 X:50156103-50156125 CCTTGGGGGTTCCCTCGCCTTCC No data
Right 1190413059 X:50156154-50156176 TCCCTATGGTGTCGGTGTGCAGG 0: 1
1: 0
2: 0
3: 8
4: 79
1190413049_1190413059 29 Left 1190413049 X:50156102-50156124 CCCTTGGGGGTTCCCTCGCCTTC No data
Right 1190413059 X:50156154-50156176 TCCCTATGGTGTCGGTGTGCAGG 0: 1
1: 0
2: 0
3: 8
4: 79
1190413056_1190413059 1 Left 1190413056 X:50156130-50156152 CCTGCTCATCTGCTTCACTAGCT No data
Right 1190413059 X:50156154-50156176 TCCCTATGGTGTCGGTGTGCAGG 0: 1
1: 0
2: 0
3: 8
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190413059 Original CRISPR TCCCTATGGTGTCGGTGTGC AGG Intergenic
901192837 1:7422723-7422745 TGCCTATGGAGTGGGTGTGAGGG - Intronic
902541148 1:17155860-17155882 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
904832084 1:33311848-33311870 GCTCTATGGTGTTGGTGTCCAGG + Intronic
907680133 1:56555285-56555307 TCCTTACGGTGTCCATGTGCAGG - Intronic
910714206 1:90212986-90213008 TTCTTATGGTGTTGGTGTGCTGG + Intergenic
912046961 1:105470882-105470904 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
913706915 1:121434525-121434547 TCCCTCTGCTGTGGCTGTGCTGG - Intergenic
915752738 1:158227358-158227380 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
916204700 1:162304696-162304718 TCCCTGTGTTTTCGGTGTCCTGG + Intronic
922692019 1:227700515-227700537 TCCCTTTGCTGTAGGTCTGCTGG - Intergenic
1062820571 10:531630-531652 GCCCTATGGTGTGGGTTTGCCGG - Intronic
1076321828 10:129588729-129588751 ACCCTGTGATGTCAGTGTGCTGG - Intronic
1076723175 10:132401573-132401595 TCCCTAGGGGGTGGGTGTGTGGG + Intronic
1077511805 11:2969443-2969465 TTCCTGTGGTGTGAGTGTGCAGG - Intronic
1081037981 11:38174082-38174104 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1083552999 11:63604948-63604970 TCCCTCTGGTTTCTGGGTGCTGG + Intronic
1087032212 11:93717008-93717030 TCCCTATGTTGAAGGAGTGCTGG + Intronic
1089793724 11:120963493-120963515 TCTCTATGGTGTGTGTGTGAAGG - Intronic
1095391686 12:41714659-41714681 TTGCTTTGGTGTCAGTGTGCAGG + Intergenic
1095855647 12:46857892-46857914 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1097138298 12:56878361-56878383 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1101593078 12:106139770-106139792 TCCAGATGGTGTCGGAGGGCCGG - Exonic
1104204357 12:126622976-126622998 TTCCCATGGGGTAGGTGTGCAGG - Intergenic
1105610481 13:21965022-21965044 TGCCTATGGTGTCCAAGTGCGGG + Intergenic
1107914285 13:45133463-45133485 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1114181102 14:20368736-20368758 TCCCTTTGGGATAGGTGTGCAGG + Intronic
1120154837 14:81082107-81082129 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1120818095 14:88884140-88884162 TCCACATGGTGTTGGTTTGCAGG - Intergenic
1122953664 14:105060139-105060161 TCCCTCGGGTGCCTGTGTGCTGG + Intronic
1127572182 15:60254479-60254501 TGACTATGGTGTTGGTGTTCAGG - Intergenic
1128786795 15:70403542-70403564 TCCATATGGTGACAGTGTGGGGG - Intergenic
1134443015 16:14310620-14310642 TCCCAGTGGTGTCGGTGAGCAGG - Intergenic
1141957660 16:87383423-87383445 TCCAGATGGTGTCGGTGTGGAGG + Exonic
1142105844 16:88302228-88302250 TCCCGCTGCTGTCGGAGTGCTGG + Intergenic
1144206709 17:12984642-12984664 TCCATAGGGTGACGGGGTGCTGG - Exonic
1145355408 17:22142009-22142031 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1145961033 17:28886662-28886684 TCCCTAGGCAGTCTGTGTGCAGG + Intronic
1146574368 17:33978646-33978668 TTCCTATGCTTACGGTGTGCTGG + Intronic
1147307440 17:39573767-39573789 CCCCCATGGTGTCGGGGAGCAGG - Intergenic
1150984261 17:70177545-70177567 TCCCTAAGGTGAAGGTGGGCTGG - Exonic
1159054777 18:63452762-63452784 TCCCTATGTTGAAGGAGTGCTGG - Intergenic
1163367201 19:16881885-16881907 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1163565544 19:18049034-18049056 GGCCAATGGTCTCGGTGTGCTGG - Intergenic
1164404477 19:27931466-27931488 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1165698300 19:37918048-37918070 TTACATTGGTGTCGGTGTGCTGG + Intronic
925398804 2:3557371-3557393 GCCTTATGGTGCTGGTGTGCTGG - Intronic
929140940 2:38666157-38666179 TCCCTATGGCTTCGGTGACCAGG + Exonic
933083890 2:78030079-78030101 TCCTTATGTTGTGGGAGTGCTGG + Intergenic
942431701 2:175918478-175918500 TCTATATGCTGTCTGTGTGCTGG - Intergenic
948723344 2:239917348-239917370 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1177016624 21:15797569-15797591 TTCCTTTGGTGTGGGTGTGCTGG - Intronic
1182144240 22:27987377-27987399 TCCCTTTGGTGTGGGGGTGGTGG - Intronic
1185223640 22:49641217-49641239 TCCCTGGGGTGTCTGTGGGCAGG - Intronic
965626883 3:170690563-170690585 TCCCCCTAGTGGCGGTGTGCCGG + Intronic
968602598 4:1517391-1517413 CCACCATGGTGTGGGTGTGCCGG - Intergenic
968649270 4:1753982-1754004 TCCCCATGGTGTCGGGCTGGGGG - Intergenic
969325415 4:6441290-6441312 TCACTGTGGTGTCGGTGTGGAGG - Intronic
975262786 4:72323551-72323573 TGGCTATGGGGTCTGTGTGCAGG + Intronic
976455831 4:85246185-85246207 TCCCTAGGGCGTGGGTGTGCAGG + Intergenic
981281884 4:142967855-142967877 TCCCTCTGGCGTCTGTGTGTTGG - Intergenic
984580908 4:181509078-181509100 TCCCTATGATCTCGGGTTGCAGG - Intergenic
986481875 5:8197820-8197842 TCCCTGTAGTGTCCGTGAGCTGG + Intergenic
994570848 5:101511873-101511895 TGCCTGTGCTGTCAGTGTGCTGG + Intergenic
994934019 5:106228726-106228748 TCACTATGGTGTCAGTATTCTGG - Intergenic
999624306 5:153504212-153504234 TCCGTATGGTTTTGGTGGGCTGG - Intronic
1002081191 5:176738452-176738474 TCCCCATGGTGAGGGTGTGAGGG + Intergenic
1003228102 6:4224561-4224583 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1006888447 6:37402039-37402061 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1007165505 6:39825989-39826011 TCCCCATGGTGCAGGTGTGTTGG + Intronic
1008907920 6:56699993-56700015 TCCCTATGGTATAGGTTTGGGGG - Intronic
1010141494 6:72620129-72620151 TCCCTATGGAGTTTCTGTGCAGG - Intergenic
1012448941 6:99334702-99334724 TCCCTCTGGTGGCAGTGTGGAGG - Intronic
1013049741 6:106520814-106520836 TCCCATTAGTGTTGGTGTGCAGG - Exonic
1029099523 7:98117116-98117138 TCCCCATGGTGTACGAGTGCAGG + Intronic
1041400856 8:57443210-57443232 TCCCTATGTTGCCAGAGTGCTGG + Intergenic
1042929975 8:74003676-74003698 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1062723660 9:138058891-138058913 TCCCTTTGTTGTCTGTGGGCTGG + Intronic
1185983535 X:4805940-4805962 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1186087219 X:6003542-6003564 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1187660967 X:21545809-21545831 TCCCTCTGGTGCAGGTCTGCTGG - Intronic
1190413059 X:50156154-50156176 TCCCTATGGTGTCGGTGTGCAGG + Intergenic
1193292847 X:79796796-79796818 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1194596647 X:95867600-95867622 GCCCTATGGTGTGGGTTCGCAGG - Intergenic
1194692040 X:96999104-96999126 TCCCTATAGTGTCTGTGAGCTGG + Intronic
1195598621 X:106721410-106721432 TCTCTATAGAGTCGGTGTGATGG + Intronic
1197147863 X:123188797-123188819 TTTCTAGGGTGTAGGTGTGCAGG + Intronic
1199001803 X:142647743-142647765 TGCCTTTGGTGTAGGTGTTCTGG + Intergenic
1200415209 Y:2902819-2902841 TCCCTATGTTGAGGGAGTGCTGG - Intronic