ID: 1190413062

View in Genome Browser
Species Human (GRCh38)
Location X:50156160-50156182
Sequence TGGTGTCGGTGTGCAGGCCG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 143}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190413053_1190413062 17 Left 1190413053 X:50156120-50156142 CCTTCCACCTCCTGCTCATCTGC No data
Right 1190413062 X:50156160-50156182 TGGTGTCGGTGTGCAGGCCGTGG 0: 1
1: 0
2: 0
3: 11
4: 143
1190413056_1190413062 7 Left 1190413056 X:50156130-50156152 CCTGCTCATCTGCTTCACTAGCT No data
Right 1190413062 X:50156160-50156182 TGGTGTCGGTGTGCAGGCCGTGG 0: 1
1: 0
2: 0
3: 11
4: 143
1190413051_1190413062 23 Left 1190413051 X:50156114-50156136 CCCTCGCCTTCCACCTCCTGCTC No data
Right 1190413062 X:50156160-50156182 TGGTGTCGGTGTGCAGGCCGTGG 0: 1
1: 0
2: 0
3: 11
4: 143
1190413054_1190413062 13 Left 1190413054 X:50156124-50156146 CCACCTCCTGCTCATCTGCTTCA No data
Right 1190413062 X:50156160-50156182 TGGTGTCGGTGTGCAGGCCGTGG 0: 1
1: 0
2: 0
3: 11
4: 143
1190413052_1190413062 22 Left 1190413052 X:50156115-50156137 CCTCGCCTTCCACCTCCTGCTCA No data
Right 1190413062 X:50156160-50156182 TGGTGTCGGTGTGCAGGCCGTGG 0: 1
1: 0
2: 0
3: 11
4: 143
1190413055_1190413062 10 Left 1190413055 X:50156127-50156149 CCTCCTGCTCATCTGCTTCACTA No data
Right 1190413062 X:50156160-50156182 TGGTGTCGGTGTGCAGGCCGTGG 0: 1
1: 0
2: 0
3: 11
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190413062 Original CRISPR TGGTGTCGGTGTGCAGGCCG TGG Intergenic
900220065 1:1503673-1503695 CGGTGTGGGTGGGGAGGCCGGGG + Intergenic
900222368 1:1516100-1516122 CGGTGTGGGTGGGGAGGCCGGGG + Intronic
900534298 1:3169427-3169449 AGGGGTGGGAGTGCAGGCCGAGG + Intronic
900646130 1:3709498-3709520 TGGTGGTGGTGTGCTGGCCTGGG + Intronic
902612516 1:17605484-17605506 TTGTGCCTGTGTGCAGCCCGAGG - Intronic
903758155 1:25677651-25677673 TAGTGTCTGTGTCCTGGCCGAGG + Intronic
905067085 1:35192844-35192866 TGCTGTTGGTGTGGAGGCGGTGG + Exonic
905166258 1:36084871-36084893 TGGTGTCTGTGAACAGGCCTAGG + Exonic
906586590 1:46984081-46984103 TGGTGTCAGTCTGGAGGCCCAGG + Intergenic
908251071 1:62266284-62266306 TGGTGTGAGTGTGCAGGCCAGGG - Intronic
910876071 1:91879406-91879428 TGGTGTCGGGGGGCAGGGCAGGG - Intronic
911651937 1:100398816-100398838 TGGTGTGGGTGTGGAGGGCTGGG + Intronic
914881365 1:151549346-151549368 TGGGTTGGGGGTGCAGGCCGAGG + Intronic
920386695 1:205574987-205575009 AGGTGTCAGTGTGAAGGCTGGGG + Intronic
922664500 1:227456950-227456972 AGGTGGTGGTGTGCAGGCAGAGG - Intergenic
924414973 1:243849830-243849852 GGGTGTGGGTGTGGAGGCCGGGG - Intronic
924455638 1:244216965-244216987 AGGTGTCTGCGTGCAGGCCCGGG + Intergenic
1064030053 10:11877818-11877840 TGGGGTCGGGGTGGAGGCAGAGG - Intergenic
1071328993 10:84542226-84542248 TGGTGTATGTGTGTAGGCAGGGG + Intergenic
1071505451 10:86228982-86229004 GGGTGTGGGTGTGGAGGCAGTGG + Intronic
1071664493 10:87541522-87541544 TTGTGTTGGTGTGAAGGCAGAGG - Intronic
1075715130 10:124551379-124551401 TGGGGTCAGTGTGAGGGCCGGGG - Intronic
1076565095 10:131393238-131393260 TGGTGATGGTGTGGAGGCCTGGG + Intergenic
1077118725 11:897131-897153 TCGTGTCGGGGTGGAGGCTGGGG - Intronic
1077225520 11:1437616-1437638 TACAGTAGGTGTGCAGGCCGTGG - Intronic
1077518285 11:3015677-3015699 TGGTGTGGGTGGGCAGACAGAGG + Intronic
1077674560 11:4184738-4184760 TGGTGCCCGTCTGCAGGCCTAGG - Intergenic
1079633851 11:22711538-22711560 TGGTGTGGGTAGGCAGGCCCAGG + Intronic
1081908135 11:46682100-46682122 TGTTGTCGCTGGTCAGGCCGTGG + Exonic
1085771315 11:79328596-79328618 TGGTGGCGGTGTGGGGACCGAGG + Intronic
1091666070 12:2419415-2419437 TGGTGGGGGTGTTCAGGCCGTGG - Intronic
1091820243 12:3470675-3470697 TGGTCCCGGTGTCCAGGGCGGGG + Intronic
1098647801 12:72926621-72926643 TGGTGTGAGTGTGAAGGCCTAGG - Intergenic
1103328224 12:120135738-120135760 TTGGGTGGGTGTGCAGGCTGTGG + Intronic
1104730908 12:131104825-131104847 TGGTGTCCGCGTGCAAGCTGCGG - Exonic
1106070970 13:26410645-26410667 TGATGAAGGTGTGCAGGCTGTGG - Intergenic
1118827606 14:69398173-69398195 TGGGGTCGCTCTGGAGGCCGGGG + Intronic
1121406352 14:93721429-93721451 TGGTGTGAGTCTGCAGGCCCTGG - Exonic
1121871194 14:97409130-97409152 TGGTGTGTGTGTGCAGCCCTGGG + Intergenic
1122641191 14:103160639-103160661 GGCTGTCGGGGTGCAGGCTGTGG - Intergenic
1122981063 14:105192609-105192631 TGGGGTCAGCGTGCAGACCGAGG - Intergenic
1122981123 14:105192804-105192826 TGGGGTCAGCGTGCAGACCGAGG - Intergenic
1202856938 14_GL000225v1_random:57823-57845 TGGGGTGGGTGGGGAGGCCGTGG - Intergenic
1125723759 15:41857552-41857574 AGGTGAGGTTGTGCAGGCCGAGG - Exonic
1131562824 15:93459100-93459122 TGGGGGCTGTGTGCAGGCAGGGG + Intergenic
1132640905 16:977872-977894 TGGTGTATGTGTGCAGGGTGTGG - Intronic
1132640920 16:978060-978082 TGGTGTATGTGTGCAGGGTGTGG - Intronic
1134039269 16:11055517-11055539 TGGTAGCGCTTTGCAGGCCGTGG + Intronic
1134443010 16:14310614-14310636 TGGTGTCGGTGAGCAGGGAAGGG - Intergenic
1137985013 16:53099919-53099941 TGGTGGCTGTGTGCAGGGCGGGG + Intronic
1141467336 16:84214986-84215008 AGGTGTGGGTGTGGAGGCCCAGG - Intergenic
1141567928 16:84915830-84915852 TGGTGTGGGAGGGCAGGCAGAGG + Intronic
1142809241 17:2387499-2387521 GGGTGTGGGTGTGGAGGCAGAGG + Exonic
1143523280 17:7458103-7458125 TGGTGTGGGTCTGCAGTCCCAGG - Intergenic
1144381676 17:14705120-14705142 TGGTCTTGGTGTGCTGGCCTCGG + Intergenic
1145123878 17:20284414-20284436 TGCTGTCCGTGTGCAGGACGAGG + Intronic
1145863722 17:28227307-28227329 TGGTGTCGGTTCGCAGGTCGTGG + Intergenic
1147927234 17:43953460-43953482 TGGTGTTCGTGCGCAGGCCGTGG - Exonic
1152331990 17:79678826-79678848 TGGGGTCAGTGGGCTGGCCGAGG - Intergenic
1152580152 17:81162237-81162259 GGCTGCAGGTGTGCAGGCCGAGG - Intronic
1152739211 17:82011754-82011776 TGGTGTCTGTGTGGAGACCTAGG + Intronic
1159942127 18:74416300-74416322 GGGTGTCTCTGTGCAGGCCTTGG - Intergenic
1160564997 18:79781662-79781684 CGGAGTTGGTGTGGAGGCCGGGG - Intergenic
1160906735 19:1455250-1455272 TGGAGACGGTGAGCCGGCCGGGG + Exonic
1161568942 19:5019474-5019496 TGGTGTTGGTGTGCAGGTGTTGG + Intronic
1163835442 19:19570688-19570710 TGGTGTTGCTGTGCCGGCCCTGG + Exonic
1165150219 19:33755906-33755928 TGGTGGAGATGTGCAGGCAGAGG + Intronic
1165958221 19:39515280-39515302 TGGAGTCGGTGTCCGGGTCGGGG - Exonic
1167113842 19:47477259-47477281 TGGTGAAGGTGTCCAGGCCAGGG - Intronic
1167237949 19:48326224-48326246 TGATGTCGGGGTGCAGGGTGGGG + Intronic
925145009 2:1575497-1575519 TGGGGTCTCTGTGCAGGCTGTGG + Intergenic
926003606 2:9354065-9354087 TGGGGTCGGTCTGCAGGCAATGG - Intronic
934036024 2:88088951-88088973 TGGTGAAGGTGAGCAGGCTGAGG + Intronic
935032456 2:99336113-99336135 CGGTGTCGGTGTCCTGGCAGAGG - Intronic
939625063 2:144466927-144466949 TGCTGCAGGTGTGCAGGCCTGGG + Intronic
946311308 2:218883837-218883859 TCGTGTCGGCGCGCAGGCGGCGG - Intronic
948124698 2:235556164-235556186 TGCTGCAGGTGTGCAGGCCACGG - Intronic
1169191153 20:3660039-3660061 TGGGGTGGGGGTGCAGGCAGAGG - Intronic
1169278404 20:4248564-4248586 TGGTGACGGTCTGCAGGTGGCGG + Exonic
1171491329 20:25520087-25520109 TGATGTTGGTGTCCAGGCAGTGG + Intronic
1172409395 20:34710370-34710392 AGGTTTCGGTGTCCAGCCCGAGG - Exonic
1172836594 20:37877298-37877320 TGGGCTCTGTGTGCAGGCAGGGG - Intergenic
1173602616 20:44306849-44306871 TGATGGCGGTGTGGAGGCAGTGG + Exonic
1174113735 20:48213335-48213357 GGGTGTCAGGGTGCAGGCTGCGG + Intergenic
1174168116 20:48599204-48599226 GGGTGTCAGGGTGCAGGCTGCGG - Intergenic
1176157214 20:63627740-63627762 TGGGATCGGGGTGCCGGCCGTGG - Intergenic
1177507349 21:22035994-22036016 TGGAGTCAGTGGGCAGGCCCAGG - Intergenic
1178297339 21:31421365-31421387 TGGTATCGGTCAGCAGCCCGAGG - Intronic
1178756014 21:35350419-35350441 TGCTGTGGGTGTGCAGGTCATGG + Intronic
1179464283 21:41561462-41561484 TGGTGCAGGTGTGCTGGCCTTGG - Intergenic
1180835737 22:18928633-18928655 TGGTCTGGCTGTGCAGGCCCAGG - Intronic
1181418078 22:22774541-22774563 TGGTGTCAGTATTCAGGCCTCGG + Intronic
1182401355 22:30080219-30080241 TCGGGTCAGTGTGCAGCCCGTGG + Exonic
1182494190 22:30694852-30694874 TGGGGGCGGGGGGCAGGCCGGGG - Exonic
1182612406 22:31559873-31559895 TGGTCTTGGTGTGCTGGCCTCGG - Intronic
1183063789 22:35350264-35350286 AGGGGTCGGTGTCCAGGCCCAGG - Intergenic
1203285826 22_KI270734v1_random:153932-153954 TGGTCTGGCTGTGCAGGCCCAGG - Intergenic
949301276 3:2586576-2586598 TGGTGGAGGGGTGCAGGCGGTGG - Intronic
957740008 3:84253227-84253249 TGGTGACCCTGTGCAGGCCCAGG + Intergenic
958594162 3:96200861-96200883 TTGTGTCAGTGTACAGGCCCAGG - Intergenic
959056953 3:101576533-101576555 TGGTCTTGGTGTGCTGGCCTCGG + Intronic
959554661 3:107702852-107702874 GGGGGACGGTGTGCAGGCCTGGG + Intronic
961133628 3:124490975-124490997 TGGTTTTGGTGTGGAGGCCGGGG - Intronic
961225592 3:125242545-125242567 TGGTGTCGGGGAGCAGGCAGAGG + Intronic
962049757 3:131800619-131800641 TGTTGTCCATGTGCAGGCTGGGG + Intronic
968682235 4:1929133-1929155 GGGTGTTGGTGTCCAGGCCAGGG + Intronic
969364380 4:6685716-6685738 TGGGGTGGGGGTGCAGGCTGAGG - Intergenic
969507964 4:7599747-7599769 TGGGCTGGGTGTGCAGGGCGTGG + Intronic
969760103 4:9175403-9175425 TGGTGTCTGACTGCAGGCTGAGG - Exonic
975048569 4:69831497-69831519 TGGTGTCAGTTGGCTGGCCGAGG - Intronic
977908231 4:102501474-102501496 CGGTGGCTGCGTGCAGGCCGAGG - Exonic
978072729 4:104491907-104491929 TGGTGTTGGGGTGGGGGCCGAGG + Exonic
985574197 5:665955-665977 GGGTGACGGTGAGCAGGGCGGGG - Exonic
985791408 5:1930536-1930558 AGGTGCAGGTGTGCAGGGCGGGG + Intergenic
993016461 5:82540045-82540067 TGGTGTAAGTTTGCAGGCAGAGG + Intergenic
996785038 5:127229259-127229281 TGGTTTCTGTGGGCAGGCCCCGG - Intergenic
998318855 5:141210302-141210324 TGCTGCCGATGTGCAGGGCGGGG - Exonic
1002939086 6:1700063-1700085 TGGTGTCGGTGCGGAGGGGGTGG - Intronic
1004611679 6:17247329-17247351 TGGTGTCAGAGTTCAGGACGTGG + Intergenic
1006313274 6:33276400-33276422 TGGTCTTGGTGTGCTGGCCTCGG - Exonic
1006514253 6:34537299-34537321 TGGTGTCTGTGGGCATGCTGGGG - Intergenic
1009053550 6:58307949-58307971 TGGAGTATGTGTGCAGGCAGGGG + Intergenic
1009237566 6:61142599-61142621 TGGAGTATGTGTGCAGGCAGGGG - Intergenic
1016952575 6:149594477-149594499 TGGTCTTGGTGTGCTGGCCTCGG - Intergenic
1019275017 7:171633-171655 GGGTGTCGGGGAGGAGGCCGGGG - Intergenic
1019523128 7:1469384-1469406 TGGTGCAGGTGTGCAGGCCAGGG + Intergenic
1019715899 7:2539205-2539227 TGGTGGGGGCGTGCAGGCCCTGG + Exonic
1023035312 7:36126441-36126463 AGGTGTCAGTGAGCAGGCTGTGG + Intergenic
1026551598 7:71373484-71373506 TGGTTTCGGTCTGCAGCCTGTGG + Intronic
1032834768 7:135662558-135662580 TGATGTCGGTGGGGAGGGCGAGG - Exonic
1033192424 7:139293948-139293970 TGCTGTAAGTGTGCAGGCAGAGG - Exonic
1035141469 7:156766742-156766764 TGGTGACAGTCTGCAGGCTGAGG + Intronic
1036270232 8:7297260-7297282 TGGTGCCTGACTGCAGGCCGAGG - Intergenic
1038011868 8:23482224-23482246 TGATGTCCCTGTGCTGGCCGAGG - Intergenic
1040475955 8:47777724-47777746 TGGTGTTGGTGAGCAGGCCAGGG + Exonic
1047537297 8:125731697-125731719 TGTTGCTGGTGTGCAGCCCGTGG + Intergenic
1049595842 8:143482950-143482972 TTGTGTCTGTGTGTGGGCCGGGG + Intronic
1049718487 8:144104772-144104794 CGGTGCCGGTGCGCAGGCGGGGG - Exonic
1049770678 8:144379539-144379561 TGGCGTCTGTGTGCATGCAGAGG + Intronic
1049811917 8:144579476-144579498 TGGTGTCGGTATTCAGGGCAGGG - Intronic
1054765002 9:69035899-69035921 CGATGTCGGTGCGCAGGCCACGG - Exonic
1057208307 9:93185865-93185887 TGGTGTAAGTGTGCACGCTGTGG + Intronic
1057934168 9:99222469-99222491 GGGTGTGGGTGTCTAGGCCGGGG + Intronic
1058110861 9:101029458-101029480 TTGGGTGGGTGTGCAGGCGGAGG + Intronic
1060148521 9:121271669-121271691 GGGTGTCGGTGTGCAGAGCTTGG + Intronic
1061054645 9:128215881-128215903 TGGGGTGGGTGTGGGGGCCGGGG - Intronic
1061408597 9:130406096-130406118 TGGCTTCGCTGTGCAGCCCGGGG + Intronic
1062085769 9:134647271-134647293 TGGGGTCATTGTCCAGGCCGTGG + Intronic
1062432691 9:136533059-136533081 TGGTGGCGGGGCTCAGGCCGTGG - Intronic
1190300387 X:49053825-49053847 CGGTGTCGGTCGGCCGGCCGGGG - Intronic
1190413062 X:50156160-50156182 TGGTGTCGGTGTGCAGGCCGTGG + Intergenic
1192347213 X:70320673-70320695 GGGTGTGGGAGTGGAGGCCGAGG + Intronic
1192473712 X:71420891-71420913 TGGGGCCGGTGGGGAGGCCGGGG - Intronic
1197888105 X:131239064-131239086 TGGTGGCGGTATGCAGTCCATGG + Intergenic
1200075526 X:153548776-153548798 TGGTGTCACTGTGCTGGTCGTGG + Exonic