ID: 1190413063

View in Genome Browser
Species Human (GRCh38)
Location X:50156170-50156192
Sequence GTGCAGGCCGTGGCCTGCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 289
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 260}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190413060_1190413063 -8 Left 1190413060 X:50156155-50156177 CCCTATGGTGTCGGTGTGCAGGC 0: 1
1: 0
2: 0
3: 4
4: 60
Right 1190413063 X:50156170-50156192 GTGCAGGCCGTGGCCTGCTGTGG 0: 1
1: 0
2: 2
3: 26
4: 260
1190413055_1190413063 20 Left 1190413055 X:50156127-50156149 CCTCCTGCTCATCTGCTTCACTA No data
Right 1190413063 X:50156170-50156192 GTGCAGGCCGTGGCCTGCTGTGG 0: 1
1: 0
2: 2
3: 26
4: 260
1190413061_1190413063 -9 Left 1190413061 X:50156156-50156178 CCTATGGTGTCGGTGTGCAGGCC 0: 1
1: 0
2: 1
3: 3
4: 58
Right 1190413063 X:50156170-50156192 GTGCAGGCCGTGGCCTGCTGTGG 0: 1
1: 0
2: 2
3: 26
4: 260
1190413053_1190413063 27 Left 1190413053 X:50156120-50156142 CCTTCCACCTCCTGCTCATCTGC No data
Right 1190413063 X:50156170-50156192 GTGCAGGCCGTGGCCTGCTGTGG 0: 1
1: 0
2: 2
3: 26
4: 260
1190413054_1190413063 23 Left 1190413054 X:50156124-50156146 CCACCTCCTGCTCATCTGCTTCA No data
Right 1190413063 X:50156170-50156192 GTGCAGGCCGTGGCCTGCTGTGG 0: 1
1: 0
2: 2
3: 26
4: 260
1190413056_1190413063 17 Left 1190413056 X:50156130-50156152 CCTGCTCATCTGCTTCACTAGCT No data
Right 1190413063 X:50156170-50156192 GTGCAGGCCGTGGCCTGCTGTGG 0: 1
1: 0
2: 2
3: 26
4: 260

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190413063 Original CRISPR GTGCAGGCCGTGGCCTGCTG TGG Intergenic
900174514 1:1285888-1285910 GTGCAGGCCGGGCCCTGCTGAGG + Intronic
900216381 1:1484046-1484068 GCCCAGGCTCTGGCCTGCTGTGG - Intronic
900382339 1:2391225-2391247 CTGCAGGGCTTGGCCTGCTGCGG + Intronic
900466551 1:2828471-2828493 GTGCCTGCTGTGGCCTGGTGTGG + Intergenic
900618604 1:3576801-3576823 GTGCAGGGCCAGGCCTGCAGGGG - Intronic
900830662 1:4963075-4963097 GTGCATGCCTTTCCCTGCTGCGG - Intergenic
900922553 1:5682796-5682818 GTGCTGGCCTTGTCCTGCTCTGG + Intergenic
901049521 1:6419438-6419460 GGGCGCGCCGTGGCCTGCTGGGG + Intronic
901199600 1:7459127-7459149 GACCAGGGGGTGGCCTGCTGGGG + Intronic
901749626 1:11397762-11397784 GTGCAGGCCCTGGCCAGCGAAGG - Intergenic
901975745 1:12942462-12942484 TTGCAGGGCGGAGCCTGCTGAGG - Exonic
902009429 1:13259303-13259325 TTGCAGGGCGGAGCCTGCTGAGG + Exonic
902017236 1:13318448-13318470 TTGCAGGGCGGAGCCTGCTGAGG + Exonic
902171031 1:14611171-14611193 GTGCAGCAGGTGACCTGCTGAGG + Intronic
902614399 1:17616003-17616025 CTGCAGGCCGAGGCCTGGGGAGG + Intronic
902728242 1:18351441-18351463 GTACAGGCCTTGGCTTTCTGAGG - Intronic
903786315 1:25863541-25863563 GTGGAGACCGTGGACTTCTGGGG - Exonic
905449946 1:38049583-38049605 GGGCAGGCCAGGGCCTGCTGGGG + Intergenic
906030468 1:42716102-42716124 GTGCAGGTGGTTGCCAGCTGTGG + Intergenic
906147000 1:43566122-43566144 GTGCCGGCCGAGGCGTGGTGTGG + Intronic
906495421 1:46301835-46301857 GGCCCGGCCGAGGCCTGCTGGGG - Intronic
906882601 1:49608493-49608515 ATCCAGGCCTTAGCCTGCTGTGG + Intronic
907325792 1:53637997-53638019 CTGCAGGCTTTGGCCTGCAGGGG - Intronic
907388642 1:54141961-54141983 GTGCAGGCAGAGGGCTGCTGTGG + Intronic
909938929 1:81588334-81588356 GTGCAAGGGGTGGCCTGCAGTGG - Intronic
914869092 1:151458705-151458727 GCGCGGGCGGTGGCCCGCTGGGG - Intronic
915544212 1:156586670-156586692 GTGCAGCCAGTGGACTCCTGAGG + Exonic
916803482 1:168236068-168236090 GTCCAGGCCGTGGGCATCTGAGG - Intronic
918570637 1:185987815-185987837 TTGCTGGCTGTGGCCTTCTGGGG + Intronic
919761026 1:201098249-201098271 GTGCAGGCTGTGGGCAGGTGCGG + Intronic
920307777 1:205030156-205030178 CTGCAGGGCGTGCCCTGGTGTGG + Intergenic
922195476 1:223355950-223355972 CTGCAGGCCCTGACCTGCTGGGG + Intronic
923018746 1:230146899-230146921 GTGCAGGCGGTAGCCAGCTCTGG - Intronic
924343059 1:243053033-243053055 GAGCAGGCCTTGGCCAGGTGTGG - Intergenic
924534479 1:244922908-244922930 GTGGAGGCCGTGGACTGTAGCGG + Intergenic
924739959 1:246789220-246789242 GGGCCGGCTGGGGCCTGCTGTGG - Intergenic
1063592254 10:7406810-7406832 GTGCCGGTGGAGGCCTGCTGAGG - Intronic
1064150786 10:12862879-12862901 GGGCATGCGGTGGACTGCTGGGG - Intergenic
1065322437 10:24521947-24521969 GTGCTGGGGGTGGCCTGCGGAGG + Intronic
1067221099 10:44344993-44345015 GTGCTGACCATGGCCTCCTGAGG - Intergenic
1069992245 10:72322899-72322921 GTGCAGTCCGAGGCCTGATGAGG - Intergenic
1070282222 10:75058249-75058271 GCGCAGGGCGTGGCCTGGGGAGG + Intronic
1070757029 10:78999672-78999694 GTGTAGGCAGTAGCCTGCTCTGG - Intergenic
1070850134 10:79556794-79556816 GGGCAGGCAGTGGGCTGCAGAGG + Exonic
1070932697 10:80272379-80272401 GAGCAGTCCTTGGCCTGCTAAGG - Exonic
1071603877 10:86971636-86971658 GCGCGGGGCGTGGGCTGCTGCGG + Intronic
1072424341 10:95317007-95317029 GTGAGGGCCGTGGGCTTCTGAGG + Intronic
1072705143 10:97675637-97675659 GTGGAGGCTGTGGCCAGGTGAGG - Exonic
1073327374 10:102650605-102650627 GTCCAGGCCATGCACTGCTGTGG + Intronic
1074501326 10:114027764-114027786 ATGCAGGACCTGGCCTGCTAGGG + Intergenic
1075811486 10:125227797-125227819 GGGCAGGCCTTGACCTGCTCAGG + Intergenic
1075967416 10:126624851-126624873 GTGTAGGCCTTAACCTGCTGCGG - Intronic
1076344886 10:129773356-129773378 CTCCAAGGCGTGGCCTGCTGGGG + Intergenic
1076344895 10:129773384-129773406 CTGCAAGGCGTGGCCTGCTGGGG + Intergenic
1076344903 10:129773412-129773434 CTCCAAGGCGTGGCCTGCTGGGG + Intergenic
1076344912 10:129773440-129773462 CTCCAAGGCGTGGCCTGCTGGGG + Intergenic
1077216092 11:1395733-1395755 GTGCTGGCCCTGCTCTGCTGAGG + Intronic
1079391329 11:20024408-20024430 GAGCTGGCCTTGGGCTGCTGAGG + Intronic
1083138363 11:60701094-60701116 GTGCAGTCTGTGGCCTGCAAAGG - Intronic
1083397495 11:62401706-62401728 CTGCAGGCCCTGACCTGCTGGGG - Intergenic
1083758176 11:64802377-64802399 GGGAAGGCTGGGGCCTGCTGGGG + Intronic
1083897357 11:65626728-65626750 GTGGAGCCCTTGCCCTGCTGGGG + Intronic
1083920608 11:65780038-65780060 TCGCAGGCCGTGGCCTGCAAGGG + Exonic
1084435246 11:69135679-69135701 GTCAAGGCTGGGGCCTGCTGAGG + Intergenic
1084438606 11:69158004-69158026 GTGGAGGCCGCAGCCTGCAGAGG - Intergenic
1084792253 11:71482274-71482296 GTGCACGGTGTGGCCTGGTGGGG + Intronic
1085042164 11:73332981-73333003 GTGCCGGCACTGACCTGCTGTGG - Intronic
1085082433 11:73646101-73646123 GTGCGGTGCGTGCCCTGCTGAGG - Intergenic
1090953707 11:131496472-131496494 GTGCCGGCCCTGGCCTGCCCAGG - Intronic
1091318449 11:134632600-134632622 TGGCAGGCCGAGGGCTGCTGGGG - Intergenic
1092258072 12:6937715-6937737 CTGCAGGCTGTGAGCTGCTGCGG - Intronic
1093176432 12:15918219-15918241 GTGTAGGCAGCAGCCTGCTGTGG - Intronic
1094084408 12:26573917-26573939 GTGCAGGCAGTGGATTGCAGGGG + Intronic
1095096006 12:38149652-38149674 GTGCAGGTCCTGGCCATCTGAGG + Intergenic
1097190737 12:57218231-57218253 GGGCAGCCCCTGCCCTGCTGGGG - Intronic
1100367890 12:93938183-93938205 GTGCAGGCAGGGGTCTGCTGAGG + Intergenic
1101337487 12:103809328-103809350 GTGGAGGGCATGTCCTGCTGGGG - Intronic
1104017827 12:124972129-124972151 GTGCAGGCTCTGCCCTGCGGCGG - Intronic
1104085555 12:125471242-125471264 GTGAGGGCCATGGGCTGCTGTGG + Intronic
1104685614 12:130782369-130782391 GGTGAGGCCGTGCCCTGCTGAGG - Intergenic
1104685622 12:130782397-130782419 GGTGAGGCCGTGCCCTGCTGAGG - Intergenic
1104685672 12:130782593-130782615 GGTGAGGCCGTGCCCTGCTGAGG - Intergenic
1104730535 12:131103135-131103157 GCGCAGGTCCTTGCCTGCTGAGG + Intronic
1107129469 13:36879696-36879718 GTGCGCGCCGGAGCCTGCTGTGG - Exonic
1112290885 13:98143329-98143351 GGGCTGGCGGTGGCCGGCTGAGG - Intronic
1113539443 13:111095039-111095061 CTGTAGGCAGTGGCCTCCTGCGG - Intergenic
1113695587 13:112343229-112343251 GGGCAGGCCGGGGTCTGCGGGGG + Intergenic
1118011501 14:61614867-61614889 GTACAGTCCGTGGCCTGTTAGGG + Intronic
1119034046 14:71215144-71215166 GTGGGGGGCCTGGCCTGCTGTGG - Intergenic
1119672373 14:76529376-76529398 CTGCACGCCGTGGCCTGCAGAGG - Intergenic
1121492756 14:94371868-94371890 AGGCAGGCCTTGGCCTCCTGAGG - Intergenic
1122354088 14:101112985-101113007 GAGCATGCAGGGGCCTGCTGGGG + Intergenic
1122608468 14:102964278-102964300 GTGCAGGGCCTTGCCTGCCGCGG - Intronic
1123934272 15:25186601-25186623 GTGCAGCCCGTGTCCTACTGGGG + Intergenic
1123937767 15:25202276-25202298 GTGCAGCCTGTGTCCCGCTGGGG + Intergenic
1123976064 15:25555746-25555768 GAGCAGGTGGTGGCCCGCTGTGG - Intergenic
1124220466 15:27846349-27846371 GAGCAGGGCAGGGCCTGCTGAGG - Intronic
1125325262 15:38530153-38530175 GTGCAGGCTGGGTGCTGCTGGGG + Intronic
1129090405 15:73143625-73143647 GTGCAGGACGGGGCGTGCGGGGG - Intronic
1129266655 15:74396946-74396968 TTGGAGGCCTTGGACTGCTGTGG - Intergenic
1130868796 15:87953831-87953853 CTGCAGGCTGTGGCCTCCTTGGG + Intronic
1131435250 15:92416816-92416838 GTTCAGAGCGGGGCCTGCTGGGG - Intronic
1132608657 16:804204-804226 GTGTAGTCAGGGGCCTGCTGGGG + Intergenic
1132642185 16:982928-982950 GTGCACGCCTTGGCGTGGTGGGG + Intronic
1133161797 16:3916833-3916855 GTGAATGCCGCTGCCTGCTGTGG + Intergenic
1133255269 16:4512703-4512725 GAACAGGCTGAGGCCTGCTGCGG + Intronic
1134143667 16:11742959-11742981 GTGCAGGGCGTGGCCCGTTGGGG - Intergenic
1134229688 16:12419294-12419316 GGGCAGGCCGGGTCCTGCTGAGG - Intronic
1135303698 16:21351596-21351618 GTGCAGCCCGTGACCTGGCGTGG + Intergenic
1135914650 16:26594875-26594897 GAGCAGCCCGTTGCCTGCAGTGG - Intergenic
1136300440 16:29330791-29330813 GTGCAGCCCGTGACCTGGCGTGG + Intergenic
1141146274 16:81532556-81532578 GGGCAAGCCGAGGCCTCCTGTGG - Intronic
1141169650 16:81683226-81683248 GTGGAAGCCGTGGCCCACTGGGG + Intronic
1141635779 16:85313151-85313173 GTGGGGCCCCTGGCCTGCTGGGG + Intergenic
1141678310 16:85529341-85529363 CTGCAGGCTGAGGCCTGCTGAGG - Intergenic
1141708516 16:85683491-85683513 GAGCAGGCTGTGGGCTGCAGTGG - Intronic
1141827935 16:86494084-86494106 GTGCTAGCCGTGGCTTGCTGTGG - Intergenic
1141898495 16:86974239-86974261 GTGGAGGCGGAGGCCAGCTGAGG + Intergenic
1142062159 16:88037556-88037578 GTGCAGCCCGTGACCTGGCGTGG + Intronic
1142186968 16:88699229-88699251 CTGCACGCCATGGCCTCCTGAGG + Intronic
1142556540 17:782143-782165 GTGCAGGCCGGGGCCGACAGGGG - Intronic
1142874774 17:2845028-2845050 GTGCAGGCCGGGACCAGATGAGG - Intronic
1143490201 17:7281667-7281689 GTGAAGGGCGTGGCCCGCGGGGG + Exonic
1144729673 17:17519220-17519242 GTGCAGGCAGGGGCCTGGAGGGG + Intronic
1144789065 17:17847533-17847555 GTGCAGGCCGTGTGGAGCTGGGG + Exonic
1145909003 17:28532029-28532051 GTTCAGCCCCTGACCTGCTGGGG - Intronic
1147723604 17:42553445-42553467 ACGCAGGCCTGGGCCTGCTGGGG + Exonic
1147930414 17:43977151-43977173 GTGCAGCCCATGGCCTTCAGCGG + Intronic
1148566008 17:48633485-48633507 GTGCAGGCCGAGGGCGGCGGCGG + Intronic
1150592933 17:66579007-66579029 GTGCAGGCTGTGGCCTCTTGGGG + Intronic
1150654605 17:67031644-67031666 GGGGAGGCCGTGGCCTGTGGAGG + Exonic
1151166699 17:72209930-72209952 GTGCAGGAGGGGGCCTGGTGAGG - Intergenic
1151481309 17:74371513-74371535 GTACAGCCAGTGGCCTGCAGTGG + Intronic
1151624333 17:75267262-75267284 GTGCAAGCCATGGCTAGCTGTGG - Intronic
1152319353 17:79599503-79599525 CCGCAAGACGTGGCCTGCTGCGG - Intergenic
1152568276 17:81109888-81109910 GTGCGGGCCGGGCCCGGCTGGGG + Intronic
1153999704 18:10472957-10472979 GTGCAGACCCGGGCCTGCTGCGG + Intronic
1154231502 18:12559578-12559600 GTGGACGCCGTGGCCTGAGGAGG + Intronic
1157306101 18:46518809-46518831 GTGCAGGCTGTGGCATGAAGGGG - Intronic
1157605503 18:48923545-48923567 GTGCACACTGCGGCCTGCTGGGG + Intronic
1160309223 18:77773155-77773177 GTGCAGACCGTGAGCTGCAGAGG - Intergenic
1160499372 18:79394637-79394659 CTCCAGGCCGAGGCCTGCGGTGG + Intergenic
1160794767 19:940137-940159 AGGCAGGCCCTGCCCTGCTGTGG - Intronic
1160855554 19:1215585-1215607 GCTCAGGCCTTGGCCTTCTGAGG + Intronic
1161240567 19:3221016-3221038 GTGAAGGCCCTGGTCTGGTGTGG - Intergenic
1161270132 19:3385157-3385179 GGGGAGGGTGTGGCCTGCTGGGG - Intronic
1161280460 19:3442810-3442832 GTGGAGGCTGAGGCCTGATGGGG - Intronic
1161313211 19:3606436-3606458 GCGCTGGCCCTGCCCTGCTGTGG - Intronic
1161317973 19:3627092-3627114 GTGCAGGGAGGGGCCTGCCGAGG + Intergenic
1161505061 19:4639449-4639471 GTGGAGGGCGTGGCCTGCCGAGG + Intergenic
1162919218 19:13890296-13890318 GTGCAGGCGGTGCCCGGCAGTGG - Exonic
1163082621 19:14954547-14954569 GAGCAGGACGTGGCCAGGTGAGG + Intronic
1163829623 19:19541429-19541451 GTGAAGGGCGGGGCCTGGTGCGG + Intronic
1164305287 19:24000748-24000770 GTGCAGGCAGTGGCTGGATGAGG - Intergenic
1164835342 19:31351891-31351913 GTTCAGGCCGCGGCCCGCAGTGG - Intergenic
1164855508 19:31517691-31517713 GTGGATGCCGTGGTCTGGTGGGG - Intergenic
1165129368 19:33622375-33622397 GTGCAGTCCGGGGCCCGCTCGGG - Intronic
1166141673 19:40808525-40808547 CTCCAGCCAGTGGCCTGCTGAGG - Intronic
1166659593 19:44637686-44637708 GGGCAGGCCCAGGGCTGCTGTGG - Intergenic
1166671297 19:44710928-44710950 GGGCAGTCCTTGGCCAGCTGGGG - Intergenic
1166864930 19:45830064-45830086 GAGAAGGCTGTGGCCTGCAGCGG - Exonic
1168147912 19:54429997-54430019 GTGCAGGCCCTGGCTTCCTCAGG + Intronic
925128040 2:1475839-1475861 GTGCAGCCCAAGGCCAGCTGGGG - Intronic
925305627 2:2846406-2846428 CTGCAGGCTGAGGCTTGCTGGGG + Intergenic
926054918 2:9768907-9768929 GTGCTGCCCGTGGCCCTCTGTGG + Intergenic
927569392 2:24144936-24144958 GTGCAGGAGGTTGCCAGCTGTGG - Intronic
928212657 2:29335036-29335058 CTGCAGGCTGTGGCCAGCCGGGG - Intronic
928230700 2:29496409-29496431 GTGCAGGCTGTGTCCTGCACAGG + Intronic
928401046 2:30979043-30979065 GCACAGGCCATGGCCTGATGGGG + Intronic
929008227 2:37416003-37416025 GTGGAGGCCTTCTCCTGCTGTGG + Intergenic
932105360 2:68936728-68936750 GTGCAGGCTGGGGCAGGCTGTGG - Intergenic
937499539 2:122462908-122462930 GGGCAGGACATGGCCTGATGTGG + Intergenic
944910777 2:204308621-204308643 GTGCATGCAGTGGCCTGCTCTGG - Intergenic
946425897 2:219596539-219596561 GAGCTGGCCGTGGCCTGGCGCGG - Intergenic
946801734 2:223424590-223424612 GTGCAGGCCATGGCCCGGTGCGG - Intergenic
947640028 2:231702048-231702070 GGGCAGGCCTGGGCGTGCTGAGG + Intergenic
947871733 2:233442464-233442486 GGGGAGGCCGTGGCTTGGTGTGG - Intronic
948981835 2:241498485-241498507 CTGCAGGACAGGGCCTGCTGAGG - Intronic
1171447747 20:25216795-25216817 GTGCAGGGTGGGGCCTGCTGAGG + Intronic
1172193009 20:33073585-33073607 GTGCTGACCGTGGCATCCTGAGG + Exonic
1175082003 20:56428548-56428570 GTGGAGGCTGTGGCATGCTCAGG - Intronic
1175241042 20:57549127-57549149 GTGCAGGCCCTGGCTTCCCGGGG + Intergenic
1175676610 20:60951585-60951607 GTGCAGGGCTCGGCCAGCTGCGG - Intergenic
1176062903 20:63180004-63180026 GGTCAGGCCGGGGCTTGCTGGGG - Intergenic
1176217283 20:63954196-63954218 GTGCAGGGCAGGTCCTGCTGAGG - Intronic
1176251196 20:64120956-64120978 GTGCAGGGCGTCGCATGGTGAGG - Intergenic
1176412957 21:6458580-6458602 GTGAAGGCCTTGGCCTTGTGCGG - Intergenic
1177148358 21:17430271-17430293 TTCCAGGCTGTGGCCTGCTTGGG - Intergenic
1179106375 21:38404378-38404400 GTGCTCGCCATGGCCAGCTGTGG - Intronic
1179688452 21:43066902-43066924 GTGAAGGCCTTGGCCTTGTGCGG - Intronic
1179979144 21:44887480-44887502 GTGCAGTCCCTGGCCTGGTCTGG + Intronic
1180149937 21:45942289-45942311 GTGGAGGGCGGAGCCTGCTGGGG + Exonic
1180789322 22:18565994-18566016 CTGCAGGCCGTGCCCTACTCTGG + Intergenic
1181005824 22:20012992-20013014 GGGGAGGGGGTGGCCTGCTGAGG - Intronic
1181232419 22:21429317-21429339 CTGCAGGCCGTGCCCTACTCTGG - Intronic
1181246232 22:21505540-21505562 CTGCAGGCCGTGCCCTACTCTGG + Intergenic
1182319700 22:29470572-29470594 GTGCCCGCCGTCGCCTGCAGGGG + Intergenic
1183655089 22:39179917-39179939 GAGCAGGCAGGGGCCAGCTGGGG + Intergenic
1183718454 22:39548155-39548177 CTGCAGGCTGGGGCCTGGTGGGG + Intergenic
1184057938 22:42065116-42065138 GAGCAGGAACTGGCCTGCTGTGG - Intronic
1184557097 22:45239573-45239595 CTCCAGGGTGTGGCCTGCTGAGG + Intronic
1185368582 22:50448058-50448080 CTGCAGGCTGTGGTCAGCTGTGG + Intronic
950201226 3:11045707-11045729 GTGCAGGCCCTTGCCTCCAGAGG - Intergenic
950426174 3:12925878-12925900 GAGCAGGCCCTGCCCCGCTGTGG + Intronic
950462733 3:13135057-13135079 GTGCATGCAGGGGTCTGCTGAGG + Intergenic
950870103 3:16220821-16220843 GTGCAGGCCCTGGGTTCCTGGGG + Intronic
953364507 3:42331598-42331620 GTGCAGGCCGTGAGATGCTTTGG - Intergenic
955356393 3:58236501-58236523 GTGGAGGCCTTGGCAGGCTGAGG + Intergenic
960594136 3:119392592-119392614 ATGGAGGCCTTGCCCTGCTGTGG - Intronic
961339673 3:126209668-126209690 GTCCACACCGTGGCCTGGTGGGG - Intergenic
961378944 3:126484744-126484766 GGGCAGTCCATGGCCTGCAGTGG + Intronic
961638679 3:128350856-128350878 ATGCAGGCCATGGTCTGGTGTGG - Intronic
961754690 3:129121079-129121101 GCGCCGGCCGTGGGTTGCTGGGG - Intronic
961921369 3:130429825-130429847 GTGCTGGCCCTGTGCTGCTGGGG + Intronic
965744286 3:171907541-171907563 GTGGAGGCCGTGGCATGAGGAGG + Intronic
968446537 4:655098-655120 GAGGAGGACGTGGGCTGCTGAGG + Intronic
968549890 4:1216764-1216786 GTGCCAGCCTTGGACTGCTGGGG - Intronic
971198828 4:24493606-24493628 GGGCAGGATGTGACCTGCTGGGG + Intergenic
973723411 4:53748507-53748529 GAGCAGGACATGGCCAGCTGGGG + Intronic
974299319 4:60042709-60042731 GTGGATGCCGTGGCCTGAGGAGG + Intergenic
975721302 4:77251085-77251107 GTACTGGCTGTGGGCTGCTGGGG + Intronic
977908228 4:102501464-102501486 GTGCAGGCCGAGGGCTGCGGCGG - Exonic
980860304 4:138491159-138491181 GTACAGGCAGTGGCCTGAGGTGG + Intergenic
982060581 4:151600667-151600689 GTTCAGGCCCCAGCCTGCTGAGG - Intronic
982139236 4:152301874-152301896 GAGCAGGCTGTGGCCAGCTGAGG - Intergenic
982388541 4:154838879-154838901 GTGCAGGAGCTGGCCTGCTAGGG - Intergenic
994369740 5:98954598-98954620 TTGAAGGCAGTGCCCTGCTGTGG + Intergenic
997319246 5:132963877-132963899 GTGCAGGCCCTGTACTGCCGTGG - Intergenic
997647982 5:135493754-135493776 GTGCCTGCCCTGGCCTGCTTGGG - Intergenic
998034966 5:138907444-138907466 GTGCTGCCTCTGGCCTGCTGTGG + Intronic
1000572730 5:162935480-162935502 GTGCAGGTGGAGGCCAGCTGTGG + Intergenic
1002427286 5:179183787-179183809 TTGCAGGCAGAGGCCTGGTGGGG - Intronic
1002840519 6:901328-901350 GTGCTGGCTGTGTCCTGATGTGG + Intergenic
1002854727 6:1026791-1026813 GTGCAGGCCTTGCCCTCCAGAGG + Intergenic
1003131197 6:3396672-3396694 GTGCATGCCGGTGCCTGCTGGGG - Intronic
1004350392 6:14885745-14885767 TTGCAGGCTGTGACCTGGTGTGG + Intergenic
1004483293 6:16040808-16040830 GTGGATGCCGTGGCCTGAAGAGG + Intergenic
1006116617 6:31779211-31779233 GTGCAGGCCCTGGCCAGCGCAGG - Exonic
1007386463 6:41523430-41523452 GTTCAGGGCGTGGCCAGCTCAGG - Intergenic
1008496229 6:52137048-52137070 GTGGGGGCCGAAGCCTGCTGGGG + Intergenic
1012778602 6:103528197-103528219 TTGCATACCGGGGCCTGCTGTGG + Intergenic
1014585874 6:123197170-123197192 GTGCCTGCCGTGTCCTGCTTGGG - Intergenic
1018269992 6:162066673-162066695 GACCAGGCCTTGACCTGCTGGGG + Intronic
1019014231 6:168867943-168867965 CTGCAGGCCTTTGGCTGCTGCGG + Intergenic
1019074650 6:169377734-169377756 GGGAAGGCCGTGGGCGGCTGGGG - Intergenic
1019177020 6:170165216-170165238 GAGCAGGCGGTGGCCAGCAGGGG - Intergenic
1020099577 7:5387721-5387743 GTGGCGGCAGTGGCCGGCTGGGG - Exonic
1021837669 7:24696320-24696342 GTGTCGGCCGGGGCCTGTTGGGG + Intergenic
1024075478 7:45815776-45815798 GAGCAGGCCTTGGCCAGGTGTGG + Intergenic
1025051976 7:55740030-55740052 GAGCAGGCCTTGGCCAGGTGTGG - Intergenic
1026833483 7:73623771-73623793 GAGAAGGCCGAGGCCTGCAGGGG + Intronic
1027960556 7:84940164-84940186 CTGCAGGGCGAGGCCTGGTGAGG + Intergenic
1029409194 7:100397953-100397975 GTGCAGGCAGTGGGCTGATTTGG + Intronic
1032502181 7:132408337-132408359 CTGCAGGCGGTGGCATTCTGGGG + Intronic
1033172375 7:139095532-139095554 GTGCAGGCTGTGGCTTGCCGTGG - Intronic
1034111345 7:148540711-148540733 GTGCTGGCAGTGAGCTGCTGCGG - Intergenic
1034472794 7:151264618-151264640 GAGAAGGAGGTGGCCTGCTGAGG - Intronic
1034573058 7:151972805-151972827 GTCCAGGCAGAAGCCTGCTGCGG + Intronic
1035220820 7:157405670-157405692 GCGCAGGATGTGGCCTGGTGCGG - Intronic
1035258036 7:157644410-157644432 GGGCCTGCCCTGGCCTGCTGGGG - Intronic
1036774329 8:11599704-11599726 GGGCAGTCCGGGGCCAGCTGAGG - Intergenic
1037823761 8:22148410-22148432 GTGCAGGCCCTGCCCTCCCGGGG - Exonic
1038011603 8:23480761-23480783 GTGCTGCCAGGGGCCTGCTGGGG - Intergenic
1041358826 8:57029034-57029056 GTGCAGGCCATCTCATGCTGAGG - Intergenic
1041689909 8:60678740-60678762 GCGCAGGCGCTGGCGTGCTGGGG + Intergenic
1043088739 8:75871424-75871446 GTGCATGCTGTGGACTGTTGGGG - Intergenic
1049442187 8:142614596-142614618 GCGCAGGGCGGGGCCTGCAGGGG - Intergenic
1049796767 8:144500586-144500608 CTGCACGCCGCGGCCTACTGGGG + Exonic
1052844191 9:33320394-33320416 GTGGTGCCCTTGGCCTGCTGAGG + Intronic
1056263514 9:84873290-84873312 GTGCAGGCCATGGCCTTCCAAGG - Intronic
1056823748 9:89862734-89862756 CTGCAGGAAGTGGCCAGCTGAGG - Intergenic
1057300259 9:93874441-93874463 GTCCAGGCAGAAGCCTGCTGTGG - Intergenic
1057464562 9:95300880-95300902 GTGCAGCCCTTGGCCTGCTGCGG - Intronic
1057772807 9:97983286-97983308 GTGCAGGCCGCGGCCGGGGGCGG + Intergenic
1061308725 9:129748606-129748628 GGGCAGGCCATGGCCAGGTGTGG + Intronic
1061566439 9:131443900-131443922 GGGCAGGCTGTGGCCTGGAGCGG + Intronic
1061578655 9:131523423-131523445 GACCAGGCCCTGGTCTGCTGAGG - Exonic
1062189725 9:135241873-135241895 CTGCAGGCCTGGGCTTGCTGGGG - Intergenic
1062239105 9:135526363-135526385 GTGCCGTCCTTGGGCTGCTGAGG - Exonic
1062315793 9:135966476-135966498 ATGCAGGCCTTGGCCAGCCGGGG - Intergenic
1062381066 9:136286739-136286761 GTGCTTTCCGTGCCCTGCTGGGG - Intronic
1062679504 9:137770822-137770844 TTCCAGGCTGTGTCCTGCTGGGG + Intronic
1188951086 X:36376072-36376094 GTGGAGGCAGAGGCCAGCTGTGG + Intronic
1189322583 X:40095853-40095875 GTGTAGGCCGTGGCCGGGCGAGG - Intronic
1190320236 X:49175777-49175799 GTGCAGGCCCATGCCTGCTCAGG - Exonic
1190413063 X:50156170-50156192 GTGCAGGCCGTGGCCTGCTGTGG + Intergenic
1193257568 X:79367509-79367531 GTGGAGTCCGTGGCCGGCTCAGG + Intronic
1197445794 X:126551794-126551816 GTGCGGGCCCTGGCCTGCGGCGG - Exonic
1200951447 Y:8903038-8903060 TTGCGGGCCGGGGCCTCCTGGGG + Intergenic