ID: 1190413096

View in Genome Browser
Species Human (GRCh38)
Location X:50156329-50156351
Sequence CGTGGTCACCAGACAGTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 110}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190413088_1190413096 10 Left 1190413088 X:50156296-50156318 CCACTATTATGCTTCCCTGTGCC 0: 1
1: 0
2: 1
3: 17
4: 136
Right 1190413096 X:50156329-50156351 CGTGGTCACCAGACAGTGGTGGG 0: 1
1: 0
2: 0
3: 5
4: 110
1190413089_1190413096 -4 Left 1190413089 X:50156310-50156332 CCCTGTGCCACTACCTCAACGTG 0: 1
1: 0
2: 2
3: 3
4: 107
Right 1190413096 X:50156329-50156351 CGTGGTCACCAGACAGTGGTGGG 0: 1
1: 0
2: 0
3: 5
4: 110
1190413087_1190413096 25 Left 1190413087 X:50156281-50156303 CCTGGAGGAGCTGAGCCACTATT 0: 1
1: 0
2: 0
3: 17
4: 152
Right 1190413096 X:50156329-50156351 CGTGGTCACCAGACAGTGGTGGG 0: 1
1: 0
2: 0
3: 5
4: 110
1190413090_1190413096 -5 Left 1190413090 X:50156311-50156333 CCTGTGCCACTACCTCAACGTGG 0: 1
1: 0
2: 1
3: 3
4: 69
Right 1190413096 X:50156329-50156351 CGTGGTCACCAGACAGTGGTGGG 0: 1
1: 0
2: 0
3: 5
4: 110
1190413086_1190413096 26 Left 1190413086 X:50156280-50156302 CCCTGGAGGAGCTGAGCCACTAT 0: 1
1: 0
2: 1
3: 14
4: 161
Right 1190413096 X:50156329-50156351 CGTGGTCACCAGACAGTGGTGGG 0: 1
1: 0
2: 0
3: 5
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190413096 Original CRISPR CGTGGTCACCAGACAGTGGT GGG Intergenic
900998939 1:6137897-6137919 AGTGGTCACCAGGCAGGGGCAGG - Intronic
902458792 1:16555273-16555295 CCTGGTCACCAGACAGAAATGGG - Intergenic
902493364 1:16852643-16852665 CCTGGTCACCAGACAGAAATGGG + Intronic
902549488 1:17210844-17210866 TGTGGGCACCAGACAGTAGGAGG - Intronic
902587722 1:17451143-17451165 CCTCGTCATCAGACAGTGGCAGG + Intergenic
903151980 1:21416031-21416053 CCTGGTCACCAGACAGAAATGGG - Intergenic
903673133 1:25048096-25048118 CCTGGTCACCAGAAAGGGCTGGG + Intergenic
904279659 1:29409841-29409863 GGTGGTCACCAGAGGGTGGCCGG + Intergenic
913606853 1:120475112-120475134 CCTGGTCACCAGACAGAAATGGG + Intergenic
913988489 1:143586496-143586518 CCTGGTCACCAGACAGAAATGGG - Intergenic
914209580 1:145565030-145565052 CCTGGTCACCAGACAGAAATGGG - Intergenic
914268499 1:146057398-146057420 CCTGGTCACCAGACAGAAATGGG - Intergenic
914368593 1:147003465-147003487 CCTGGTCACCAGACAGAAATGGG + Intergenic
914584340 1:149046724-149046746 CCTGGTCACCAGACAGAAATGGG - Intronic
915890460 1:159768528-159768550 CATGGTCACAAGACAATAGTGGG - Intergenic
917908541 1:179615036-179615058 CGTGGTTACCAGACACTGAGGGG - Intronic
919919214 1:202158314-202158336 GGTGCTCACTAGGCAGTGGTGGG - Intronic
921820917 1:219616446-219616468 GGTGCTCACCAGCCAGAGGTTGG + Intergenic
1065293941 10:24257391-24257413 CGTGTTCACCAGACATCTGTGGG + Intronic
1066526569 10:36285880-36285902 GGTGGTCACCAGAGACTGGGGGG - Intergenic
1067152650 10:43749307-43749329 GCTGGACACCTGACAGTGGTTGG + Intergenic
1067277754 10:44850069-44850091 CCTGGACACCAGGCAGGGGTTGG + Intergenic
1067776674 10:49169338-49169360 TGTGGTCAGCAGACAGGGTTGGG - Intronic
1068690266 10:59906730-59906752 CGTGGTCACCAGACGGCGGCGGG - Intergenic
1070606217 10:77900292-77900314 CGTGGTGACTGGACAGTGGCTGG - Intronic
1071507525 10:86241544-86241566 CCTGGTGACCAGATAGCGGTGGG - Intronic
1073286407 10:102392170-102392192 CATGGTCACAAGACAATAGTGGG - Intergenic
1076180805 10:128405688-128405710 CCTGGGCACCAGACAGAGGGAGG - Intergenic
1083224888 11:61278687-61278709 TGTGCTCTCCAGACAGTTGTGGG - Intronic
1086611985 11:88768420-88768442 GGTGGTTACCAGACGCTGGTGGG + Intronic
1087272778 11:96128366-96128388 CCTGGGCAACAGACAGTGGGAGG + Intronic
1087553531 11:99684097-99684119 TGTGGTTACCAGACGGGGGTTGG - Intronic
1094215733 12:27940014-27940036 CGTGGTTACCAGGGACTGGTGGG + Intergenic
1095162417 12:38933687-38933709 CGTGGTCCCCAGGCAGATGTTGG + Intergenic
1102607581 12:114080511-114080533 CATTCTCACCAGAGAGTGGTGGG - Intergenic
1104031290 12:125066963-125066985 CCTCCTCACCAAACAGTGGTTGG + Intronic
1104737582 12:131146703-131146725 CGTGGTTCCCAGCCTGTGGTGGG + Intergenic
1106926266 13:34616176-34616198 GATTGTAACCAGACAGTGGTTGG - Intergenic
1113887701 13:113669769-113669791 GGTCATCACCAGACAGAGGTCGG - Exonic
1114350182 14:21841754-21841776 TGTGTTCACCACACAGAGGTAGG - Intergenic
1124368045 15:29087927-29087949 CGTGGTCAAAAGCCAGTGGAGGG - Intronic
1129644797 15:77420052-77420074 CGTGGTCACCAGGAAGGGGACGG - Exonic
1132300620 15:100773427-100773449 CGTGTTCATCTGACACTGGTAGG + Intergenic
1132690309 16:1179055-1179077 CGTGGACACCAGGCTGTGGCGGG + Intronic
1138392659 16:56681984-56682006 CGTGGCCAACAGACCGAGGTGGG + Intronic
1141380615 16:83573331-83573353 CCTAGTCACCATTCAGTGGTGGG + Intronic
1146172512 17:30644832-30644854 CTTGGTCACCTGACAGGGGCAGG + Intergenic
1146345966 17:32060841-32060863 CTTGGTCACCTGACAGGGGCAGG + Intergenic
1146839523 17:36140785-36140807 CATGGTCACAAGACAATAGTGGG - Intergenic
1147741614 17:42673676-42673698 CGTGCTCACCAGCCTGTGCTCGG - Exonic
1147899528 17:43774938-43774960 CCTGGACAGGAGACAGTGGTGGG + Exonic
1150248679 17:63694185-63694207 GGTGGTCTCCAGACATTGGAAGG - Exonic
1153447700 18:5192768-5192790 AGTGGTCACCAGAGATTGGTGGG + Intronic
1156831793 18:41500554-41500576 CGGGGTGCCCTGACAGTGGTTGG + Intergenic
1157339363 18:46765694-46765716 CATGGTCAGCAGACAGTCCTGGG - Intergenic
1162989919 19:14295248-14295270 CTTGGTCACCTGACAGGGGCAGG - Intergenic
1164698493 19:30264668-30264690 CGTGCTCACCAGACTGGGGTGGG - Intronic
1202708741 1_KI270714v1_random:4860-4882 CCTGGTCACCAGACAGAAATGGG + Intergenic
926579461 2:14618813-14618835 CGTGCTCTGCAGACAGTGGGAGG - Intergenic
936548272 2:113411849-113411871 ACTGGACACCGGACAGTGGTAGG - Intergenic
939492153 2:142889290-142889312 CGTAATCAACAGACAGTGGCGGG + Intronic
940170904 2:150829223-150829245 CATGGTCACCAAACTATGGTGGG - Intergenic
946543738 2:220714313-220714335 CGTGGTCACCTTGCACTGGTTGG - Intergenic
946642223 2:221796495-221796517 GTTGGTCACCAGCCAGTGGCTGG - Intergenic
1171310980 20:24144332-24144354 GGTGGTCAGCAGAGAGGGGTCGG - Intergenic
1174707678 20:52673839-52673861 AGTGGAAACCAGAGAGTGGTTGG - Intergenic
1175922397 20:62456232-62456254 CGTGGTTACCAGACCGGGGTCGG + Intergenic
1176244882 20:64092800-64092822 CGGGGGCAGCAGACTGTGGTTGG - Exonic
1182546377 22:31079106-31079128 AGTGGTCACCTGGCAGTAGTGGG + Intronic
1183311715 22:37113342-37113364 CTTGGTCACCTGAGTGTGGTGGG - Intergenic
1184093100 22:42302543-42302565 CAAGGTCACCAGCCAGTGGAAGG + Intronic
1184790717 22:46698107-46698129 AGTGGTCCTCAGACTGTGGTGGG - Intronic
1184984358 22:48119359-48119381 AGGGGTCATCAGTCAGTGGTGGG - Intergenic
953040743 3:39252965-39252987 GGCGGTCACCAGGCAGTGCTGGG + Intergenic
955751887 3:62191757-62191779 CATGTTCACCAGACAGTGTGAGG - Intronic
957864505 3:86004793-86004815 GGTGGTCACAAGACATTGATAGG - Intronic
958089599 3:88859183-88859205 GGTGGTTACCAAGCAGTGGTGGG - Intergenic
958922094 3:100118893-100118915 CTTGGTCACCTGTCAGTGGGTGG - Intronic
958925439 3:100151976-100151998 CATGCTCAACACACAGTGGTGGG + Intronic
959069918 3:101692632-101692654 CATGGTCACAAGACAATAGTGGG - Intergenic
959070823 3:101700780-101700802 CATGGTCACAAGACAATAGTGGG - Intergenic
959096053 3:101957276-101957298 GGTGGTTACCAGAGAGTGGCTGG - Intergenic
960402067 3:117212965-117212987 TGTGGTCACCAGAAGATGGTGGG + Intergenic
961053750 3:123768800-123768822 CCTGTTCACCAGACAGTGTATGG - Intronic
976813840 4:89124392-89124414 AGTGGTCACCAGGCAGGAGTGGG - Intergenic
978978720 4:114914901-114914923 CTTGGACTCAAGACAGTGGTAGG + Intronic
985965868 5:3338472-3338494 CGTGGGGTCCAGACAGAGGTGGG - Intergenic
989780836 5:45262844-45262866 CGTTGTCATCAGTCATTGGTAGG - Intronic
990472274 5:56126894-56126916 CATGGTAACCAGAAAGTGCTGGG - Intronic
994679632 5:102869565-102869587 CATGGTCAACAGAGAGTGATGGG - Intronic
1000133586 5:158322861-158322883 TGTGGTCACCTGATAGTGCTTGG + Intergenic
1000240345 5:159403059-159403081 CGTGGTCATAAGACAGCTGTTGG + Intergenic
1000531585 5:162428573-162428595 TGTGGTTACAAGACAGTAGTAGG + Intergenic
1002544111 5:179926973-179926995 CGTGACCAACAGTCAGTGGTGGG - Intronic
1013310335 6:108887993-108888015 GGTGGTCACGTCACAGTGGTGGG - Intronic
1016267106 6:142245418-142245440 CTTGGTCACCAGGCTGTGGCCGG - Intergenic
1017933725 6:158985075-158985097 CTTGGTCATCAGACAGTGCTTGG - Intronic
1023726836 7:43151117-43151139 CGTGGTCCCAAGACAGAGGCTGG + Intronic
1023874822 7:44281273-44281295 CGGGGCCACCAGACACTTGTGGG + Intronic
1034938035 7:155212314-155212336 CGTCCTCACTAGACAGGGGTGGG + Intergenic
1035842177 8:2825049-2825071 AGTGGTCAGCAGGCAATGGTTGG - Intergenic
1037084099 8:14825715-14825737 AGTGGTTACCAGACACTGGAGGG - Intronic
1037855695 8:22369154-22369176 AGAGGGCACCAGACAGTGGAAGG + Intronic
1038205258 8:25459003-25459025 CGAGGTCACAAGGCAGTGGCAGG + Exonic
1038871113 8:31494955-31494977 CGTGGACACCAGAGAGTGAGTGG + Intergenic
1040027578 8:42795907-42795929 CATGGTCACAAGACAATAGTGGG + Intronic
1044364255 8:91324768-91324790 CGTGGTCAAGTGACAGGGGTGGG + Intronic
1049016358 8:139922801-139922823 CGTGGACACTAGACAGAGCTGGG + Intronic
1053248191 9:36552760-36552782 TGTGGTCATCAGATATTGGTTGG - Intergenic
1053727290 9:41016938-41016960 ACTGGACACCGGACAGTGGTAGG + Intergenic
1054701227 9:68415174-68415196 ACTGGACACCGGACAGTGGTAGG - Intronic
1054710316 9:68504485-68504507 CATGTTCACCAAACAGCGGTTGG - Intronic
1190413096 X:50156329-50156351 CGTGGTCACCAGACAGTGGTGGG + Intergenic
1196211315 X:112998852-112998874 CTAGGTCCCCAGTCAGTGGTAGG + Intergenic
1197847686 X:130820785-130820807 GGTGGTTACCAGGAAGTGGTTGG + Intronic
1198602214 X:138295994-138296016 CAGGGTCACAAGACAGTAGTGGG + Intergenic