ID: 1190420828

View in Genome Browser
Species Human (GRCh38)
Location X:50282557-50282579
Sequence AAGGCTCAGGGTTCTGTAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 195}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190420828 Original CRISPR AAGGCTCAGGGTTCTGTAGG TGG Intronic
900598192 1:3491869-3491891 CAGCCTCAGGGTCCTGAAGGTGG + Intronic
902472295 1:16657279-16657301 CAGGCTCAGGCCTCTGTAGGGGG + Intergenic
902486508 1:16750167-16750189 CAGGCTCAGGCCTCTGTAGGGGG - Intronic
902671089 1:17974341-17974363 ATGGGACAGGGTTCTGTAGCTGG + Intergenic
903867234 1:26408794-26408816 AACGCTCTGGCTTCTCTAGGTGG - Intergenic
904630854 1:31841000-31841022 AAGGCTCAGGGTTGGGAAAGAGG + Intergenic
905244988 1:36606617-36606639 AAGGTTCCTGGTTCTGTTGGTGG + Intergenic
905905475 1:41615378-41615400 CAGGCTGAGGGTTCTCCAGGTGG - Intronic
906194447 1:43921079-43921101 AAGGCCCTGGGTTCAGTGGGAGG - Intronic
906867612 1:49439919-49439941 ATTGCTCAGGGTTCTCTAGAGGG - Intronic
907800053 1:57755799-57755821 AAGGATCAGAGCTCTGTACGTGG - Intronic
911003390 1:93191428-93191450 AAGGCACAAGGTACTGTAGAGGG - Intronic
912086485 1:106013001-106013023 TTGGCTCATGGTTCTGTAGGCGG + Intergenic
912956836 1:114160050-114160072 TATGCTCAGGGCTCTGTATGTGG - Intergenic
915498013 1:156294855-156294877 GACGCTCAGGGTGCTGTGGGGGG + Exonic
916742944 1:167662141-167662163 AAGCCTCATGGTTCTGAAGCAGG - Intronic
916922735 1:169485905-169485927 AAAGCTGGGGGTTCTGTAGCCGG - Exonic
918115803 1:181496581-181496603 AAGGGTTAGGGTGCTGTGGGGGG + Intronic
919814509 1:201429051-201429073 AAGGCTCAGGGTCCCAAAGGCGG + Intronic
923318744 1:232806794-232806816 AAGGATAAGCGTTCTGTGGGGGG + Exonic
923899169 1:238306284-238306306 TTGGCTCATGGTTCTGCAGGTGG - Intergenic
1062967816 10:1623713-1623735 AAGGCCCCTGGTCCTGTAGGCGG - Intronic
1064094962 10:12417500-12417522 ATTGCTCAGGGTTCTGCAGAGGG + Intronic
1064112893 10:12553645-12553667 AAGACTCAGGGCTCTGTAGCCGG - Intronic
1064562549 10:16607283-16607305 CTGGCTCATGGTTCTGCAGGAGG - Intronic
1067011768 10:42720800-42720822 AAGGCTCAGTGTTTTGAAGCTGG + Intergenic
1067689922 10:48495183-48495205 AAGGCTCAGGGTTCAGTGAATGG + Intronic
1069155894 10:65030511-65030533 TTGGCTCATGGTTCTGGAGGTGG - Intergenic
1073164349 10:101431365-101431387 AAGGCTGAGGGGTCTGTGTGCGG - Intronic
1080394464 11:31877063-31877085 AAGGCTATGGTTTGTGTAGGGGG + Intronic
1081721185 11:45289797-45289819 AAGGCTCTGGCTTCTGTGGCAGG - Intergenic
1085531940 11:77197136-77197158 AAGGCCCTGGGGTCAGTAGGAGG - Intronic
1085970268 11:81581077-81581099 AATGCCCAGGGTACTGTAAGAGG + Intergenic
1090067020 11:123511693-123511715 AAGGCTCAGACTTCTGGAGCAGG + Intergenic
1090902334 11:131044076-131044098 AAGGCTCAGGCTTCTGGTTGAGG - Intergenic
1099282206 12:80664938-80664960 AAGAGTCAGGGTTCTCTAGAGGG + Intronic
1100666225 12:96756271-96756293 AAGCCTGAGGGTTCTGAAGAAGG + Intronic
1101249077 12:102914612-102914634 AAGGCTCAGTATTCTTTAGTAGG - Intronic
1101250377 12:102928542-102928564 AAGGGTCAGGGGTCTCTAAGTGG - Intronic
1101553685 12:105786676-105786698 AGGGCTCAGGAATCTATAGGAGG + Intergenic
1101871623 12:108570504-108570526 AATGCTCTGGGTTCTGGTGGAGG + Intergenic
1101882691 12:108636489-108636511 AAGGGACAGGTTTCTGTAGTAGG - Intergenic
1103942749 12:124509874-124509896 GAGGCTCAGGTTACTGTGGGGGG - Intronic
1104814452 12:131637749-131637771 CAGGCTCAGGGCCCTGTGGGAGG + Intergenic
1105014433 12:132777494-132777516 GAGGCTCAGGATTCTGGAGACGG + Intronic
1105039473 12:132950283-132950305 AATACTCAGGATTCTGAAGGGGG - Intronic
1105628668 13:22139072-22139094 AAGCCTCAGAGAACTGTAGGGGG + Intergenic
1105882560 13:24616772-24616794 AGAGCTCAGGGTGATGTAGGAGG + Intergenic
1109145214 13:58771748-58771770 AAGGCTCAGGAGGCTGCAGGTGG - Intergenic
1109590623 13:64476151-64476173 AAGCCTGAGGGTTCTGCAGGAGG - Intergenic
1109936462 13:69291812-69291834 AAGGCTCAGGTATCTGGAAGGGG - Intergenic
1113882911 13:113637820-113637842 ATGGCTCAGGGAACTGTTGGAGG + Exonic
1114962521 14:27911414-27911436 TCGGCTCATGGTTCTGCAGGTGG - Intergenic
1114969349 14:28005937-28005959 AAGGCTCACAATTCTCTAGGTGG - Intergenic
1118572443 14:67207210-67207232 TTGGCTCATGGGTCTGTAGGTGG + Intronic
1118731440 14:68669798-68669820 AAGGCCCAGGGTTCTGGCTGGGG - Intronic
1119638322 14:76294422-76294444 AAGGTGCAGGGCTCTGTGGGAGG - Intergenic
1120515356 14:85463992-85464014 TAGGCTCACAGTTCTGCAGGTGG - Intergenic
1121287535 14:92748211-92748233 AGGGCTCAGTGCTCTGGAGGGGG - Intronic
1121545693 14:94761826-94761848 AAGACTCAGCGTTCTGGAGTTGG - Intergenic
1123059744 14:105589118-105589140 TGGGCTCAGGGCTCTGCAGGTGG + Intergenic
1123084066 14:105709367-105709389 TGGGCTCAGGGCTCTGCAGGTGG + Intergenic
1125089976 15:35778980-35779002 TAGGAACAGTGTTCTGTAGGTGG + Intergenic
1129797941 15:78392178-78392200 AAGGCTCAGGGATATCTATGGGG - Intergenic
1129948060 15:79559457-79559479 ATGGCTCAGGGAACTGTGGGAGG - Intergenic
1130160730 15:81397455-81397477 AAGACTCACAATTCTGTAGGAGG + Intergenic
1131264295 15:90906560-90906582 AAGGCACAGGGATCGGCAGGGGG + Intronic
1133257586 16:4526809-4526831 AGGGCTCATGCTTCTGTTGGAGG - Intronic
1135094900 16:19556484-19556506 AAGCTTCAGGGTTCAGCAGGTGG + Intronic
1135564159 16:23499069-23499091 AAGGCTCTGGATTCTGTGAGGGG - Intronic
1141792315 16:86245006-86245028 AAGGCTGAGGGGGCTGCAGGTGG + Intergenic
1143551287 17:7631890-7631912 AAGGCCCAGGGCTCTGCATGAGG - Exonic
1143598017 17:7927248-7927270 AAGTCCCAGGGTTCTTTAGAGGG + Intronic
1148255552 17:46128270-46128292 AAGGCACAAGGTTCTGTGAGAGG - Intronic
1150281981 17:63934124-63934146 AGGGCTCAGCGGACTGTAGGGGG + Intergenic
1151405333 17:73882463-73882485 AAGGCTCAGAGATCTGGAGAGGG - Intergenic
1154485301 18:14867618-14867640 GGGGCTCAGGGTCCTGTGGGTGG + Intergenic
1155372997 18:25123567-25123589 AAGGCTCAGGGTTGTGATTGAGG - Intronic
1157385032 18:47253284-47253306 AAGGCTCAGTGCTCTTTAGAAGG + Intergenic
1158624989 18:59063254-59063276 AAGGCTCAAGGTGCTGTGGCTGG - Intergenic
1158869591 18:61672092-61672114 AAGGATCAGGGTTCTATTTGTGG + Intergenic
1160235614 18:77083867-77083889 AAGGCACAGGTTTCTTTTGGAGG + Intronic
1161295995 19:3520416-3520438 AAGGCCCAGGGTTCTCTACATGG - Intronic
1161707136 19:5827488-5827510 TAGGCTCAGGGTTCAGAAAGGGG + Intronic
1165006115 19:32808548-32808570 ATGGCTCTGGGTTATCTAGGTGG - Intronic
1165082731 19:33318701-33318723 AATGCTAAGGGTACTTTAGGAGG + Intergenic
1166975354 19:46602176-46602198 AAGGATCAGGGTCGTGGAGGTGG + Intronic
1168242839 19:55095913-55095935 AGGGTTCTGGGTTCTGCAGGGGG + Exonic
1202704692 1_KI270713v1_random:14073-14095 CAGGCTCAGGCCTCTGTAGGGGG + Intergenic
925414576 2:3660335-3660357 TTGGCTCATGGTTCTGCAGGCGG - Intronic
927393790 2:22626504-22626526 AAGCCTGTGGGATCTGTAGGTGG + Intergenic
928337515 2:30410499-30410521 AAGGCTTGGGGTACAGTAGGTGG + Intergenic
930684976 2:54298619-54298641 AAGGCTCAGGCTACTGGAAGTGG + Intronic
933480286 2:82848366-82848388 TTGGCTCATGGTTCTGGAGGCGG + Intergenic
933895351 2:86806307-86806329 AAGGCTCTGACTCCTGTAGGGGG + Intronic
941394776 2:164961126-164961148 TTGGCTCATGGTTCTGCAGGAGG + Intergenic
941661364 2:168198724-168198746 AAGACTCAGCGTTCACTAGGTGG + Intronic
942227801 2:173832073-173832095 TAGGCTCTGGGTGCTGGAGGGGG - Intergenic
942449917 2:176102301-176102323 AAGGCTCAGGGCTCTCTGTGAGG - Intergenic
943618042 2:190116243-190116265 TGGGCTCATGGTTCTGGAGGTGG + Intronic
944676667 2:202038675-202038697 AAGGCTTAGGGGTATGTAGTGGG - Intergenic
947776686 2:232717621-232717643 TTGGCTCATGGTTCTGTAGGCGG + Intronic
948768171 2:240233867-240233889 GAGGATCAGGGTGCTGTGGGCGG - Intergenic
1170145820 20:13173348-13173370 ATGACTCTGGGTTCTGTAGCTGG - Intergenic
1170647746 20:18211982-18212004 AGGGCCCAGGCTTCTGTAGTGGG + Intergenic
1171130849 20:22651897-22651919 AAGGCTCAGGGCTCCCAAGGTGG + Intergenic
1171192174 20:23166506-23166528 AAGGTTCAGGGATCTCCAGGAGG + Intergenic
1172126259 20:32626973-32626995 ATGGCTCAGGGTTCAGTGGAGGG - Intergenic
1172134859 20:32680063-32680085 AAGGCCCAGAGTTCTGCAGGGGG - Intergenic
1172524731 20:35592489-35592511 AAGGCTGAGGGTTAGGTAGGAGG + Intergenic
1173950177 20:46986597-46986619 TTGGCTCACGGTTCTGCAGGTGG + Intronic
1174061216 20:47834265-47834287 AAGGCTGAGGGTTGTGTAGCTGG - Intergenic
1174070560 20:47896434-47896456 AAGGCTGAGGGTTGTGTAGCTGG + Intergenic
1174148858 20:48472000-48472022 AAGTCTGAGGGTTGTGTAGCTGG - Intergenic
1175296113 20:57909864-57909886 AGGGCTCAGGGCTCTGTCGCTGG + Intergenic
1176723942 21:10414526-10414548 GGGGCTCAGGGTCCTGTGGGTGG + Intergenic
1176796033 21:13371858-13371880 GGGGCTCAGGGTCCTGTGGGTGG - Intergenic
1177938501 21:27380135-27380157 AAAGCTCAGTTTGCTGTAGGGGG - Intergenic
1178817889 21:35948321-35948343 GGGGCTCAGGGCTCTTTAGGAGG - Intronic
1179929845 21:44559946-44559968 ATGGCTAAGGGCTCTGTTGGAGG + Intronic
1180196268 21:46196231-46196253 AGGGCTTAGAGTTCTGTCGGCGG - Exonic
1180305188 22:11067700-11067722 GGGGCTCAGGGTCCTGTGGGTGG + Intergenic
1180633869 22:17248800-17248822 AAGGCACAGGGTTGTGTTAGTGG - Intergenic
1181826363 22:25519557-25519579 ACCTCTCAGGGTTCTCTAGGGGG - Intergenic
1183654024 22:39174871-39174893 AAGGGGCAGGGGTCTGGAGGGGG + Intergenic
1184914054 22:47555483-47555505 TTGGCTCATGGTTCTGCAGGCGG + Intergenic
1185030857 22:48442195-48442217 AAGGCTCAGGGTTCAGGATTAGG - Intergenic
1185402195 22:50625068-50625090 GAGGCTCAGGTGTCTGGAGGGGG - Exonic
950040707 3:9917450-9917472 AAGGCTCAGGGTTCAGTTTTTGG + Exonic
950522320 3:13504666-13504688 AAGGGTCAGGGCACTGCAGGGGG - Exonic
953043942 3:39278885-39278907 CAGGCTCAGGTTTGTGTGGGTGG - Intronic
954613953 3:51960083-51960105 CAGGCTCAGAGCTCTCTAGGTGG + Intronic
955416980 3:58701510-58701532 AAGGCTCTGGGTTTCATAGGTGG + Intergenic
955769065 3:62371760-62371782 AAGGCTCTGGTTTCTGAAGGGGG - Intronic
956704910 3:71991410-71991432 TTGGCTCATGGTTCTGCAGGCGG + Intergenic
960438724 3:117660427-117660449 AGGGCTCAAGCATCTGTAGGTGG + Intergenic
967652967 3:192009080-192009102 ATGGCTCAGGGATCTGCAGTGGG - Intergenic
967948352 3:194821873-194821895 AAGGCTCGGGGTTCAGTAACTGG + Intergenic
968557074 4:1250877-1250899 AAGGCTTTGGGTCCTGCAGGTGG + Intergenic
969291674 4:6243990-6244012 AAGTCTCAGGGCTTTGCAGGTGG + Intergenic
969700064 4:8762999-8763021 GAGGCTCTGGGTCCTGGAGGAGG + Intergenic
970477363 4:16437229-16437251 ATTACTCAGGGTTCTGTAGAGGG + Intergenic
973262680 4:48180674-48180696 GAAGCTCAGGGTGCTTTAGGAGG + Intronic
974605764 4:64147514-64147536 AAGCCTGAGGGTACTGCAGGAGG + Intergenic
979519480 4:121650233-121650255 AAACCCCAGGGTTCAGTAGGGGG - Intergenic
980849424 4:138362717-138362739 TTGGCTCATGGTTCTGCAGGGGG + Intergenic
982607522 4:157533417-157533439 AAGGCTCATGGTTTTATAAGGGG + Intergenic
983341156 4:166462978-166463000 AAGGCTCACGGTTGTGAAGCTGG + Intergenic
984396549 4:179209105-179209127 AAGACTCTGAGTTCTGCAGGTGG + Intergenic
985614307 5:910386-910408 ATAGCTCAGGGTTCTGTGGGGGG + Intronic
986043156 5:4012380-4012402 GAGGCAGAGGGTTCTGGAGGAGG + Intergenic
986270590 5:6227449-6227471 CAAGCACAGGGTTCTGGAGGAGG - Intergenic
986720460 5:10557403-10557425 AGGGCTCAGGGTTCTGCTGCAGG + Intergenic
987549840 5:19365246-19365268 AAGGTTCCAGGTTCTGTAAGTGG + Intergenic
991503653 5:67302539-67302561 GAGGCTCAGGGTTATATAGTGGG + Intergenic
992820751 5:80493674-80493696 AAGCCTGAGGGTACTGCAGGAGG - Intronic
993321113 5:86468253-86468275 ATTGGTCAGGGTTCTCTAGGGGG - Intergenic
994792228 5:104243821-104243843 AAGTCTCAGTTTTATGTAGGAGG - Intergenic
996373457 5:122776764-122776786 AAGGCTAAGCATTCTGTTGGGGG + Intronic
996507348 5:124282723-124282745 ATGGCCCAGGATTCTGTAAGTGG + Intergenic
999061247 5:148638268-148638290 GGGGCTCAGAGTTCTGCAGGTGG - Intronic
999100377 5:149018950-149018972 AAGTGGCAGGCTTCTGTAGGGGG - Intronic
999319106 5:150602224-150602246 CAGGCTCTGGGTTCTGGTGGTGG + Intronic
1001216329 5:169859223-169859245 TGGGCTGAGAGTTCTGTAGGAGG + Intronic
1002724084 5:181283057-181283079 GGGGCTCAGGGTCCTGTGGGTGG + Intergenic
1005068557 6:21842927-21842949 AAGGCTCAGGGTTATGAGGATGG + Intergenic
1005250617 6:23941970-23941992 AATGCACAGAGTTCTGGAGGTGG - Intergenic
1005841074 6:29744907-29744929 CAGGTTCAGGCTTCTATAGGAGG + Intergenic
1006059797 6:31411577-31411599 CAGGCTCAGGATTCTGTCGGAGG - Intronic
1006072288 6:31506648-31506670 CAGGCTCAGGCTTCTGTCAGAGG - Intronic
1006444003 6:34068807-34068829 CTGGCTCAGGGGTCTGGAGGAGG - Intronic
1012146543 6:95691208-95691230 AAGGCTCAGGGCTATTGAGGGGG - Intergenic
1012736912 6:102959400-102959422 ATTACTCAGGGTTCTTTAGGGGG - Intergenic
1013302735 6:108819303-108819325 TTGGCTCATGGTTCTGCAGGCGG - Intergenic
1017326733 6:153149702-153149724 TTGGCTCATGGTTCTGCAGGAGG + Intergenic
1018102156 6:160450142-160450164 AAGCCTGAGGGTACTGCAGGAGG + Intronic
1019471611 7:1224264-1224286 AAGGCTCCGGCTTCTGCAGGCGG + Intergenic
1022020789 7:26398172-26398194 AAGGCCCAGGGTTCGGGAGGCGG + Intergenic
1025233513 7:57218567-57218589 AAGGCTGAGGGTTGTGGAGCTGG + Intergenic
1026964623 7:74431277-74431299 GGTGCTCAGGGTCCTGTAGGTGG - Intergenic
1029200612 7:98836815-98836837 ATGGCACAGGGTTCCCTAGGTGG + Intergenic
1034356739 7:150456526-150456548 TGGGCTCAGTGGTCTGTAGGAGG - Intronic
1035087854 7:156276796-156276818 ATTGCTCAGGGTTCTCTAGAGGG + Intergenic
1039388046 8:37153647-37153669 AAGGCTTTGGGGTCTTTAGGAGG + Intergenic
1039667833 8:39555115-39555137 TAGGCTCATGGTTCTGCAGGCGG - Intergenic
1040278274 8:46024929-46024951 AAGGCCCAGGCCTCTGTAAGAGG + Intergenic
1040278635 8:46026448-46026470 AAGGCCCAGGCCTCCGTAGGAGG + Intergenic
1043271053 8:78334191-78334213 AAGGCTCTGGTTTCTGTTGAGGG + Intergenic
1047409557 8:124613177-124613199 AAGATTCAGGGTTCTGGAGCTGG + Intronic
1048224610 8:132572981-132573003 AAGGCTCAGGTTCTTGTGGGAGG - Intronic
1049360321 8:142209685-142209707 GAGGCTCAGGCTGCTGTGGGAGG - Intergenic
1051029211 9:12654290-12654312 AAGGCACATGGTTCTGAAGTAGG - Intergenic
1053886220 9:42646491-42646513 GAGGCTCAGGGTCCTGTGGGTGG + Intergenic
1054225240 9:62453940-62453962 GAGGCTCAGGGTCCTGTGGGTGG + Intergenic
1055894820 9:81162742-81162764 ATGGCTGAGGCTTCAGTAGGTGG + Intergenic
1057677354 9:97146338-97146360 TTGGCTCATGGTTCTGTAGTAGG + Intergenic
1058592871 9:106584009-106584031 AAGGCTCAGGTTTCTCAAGCAGG + Intergenic
1060248259 9:121964721-121964743 AAGGCACAAGGCTCTGTTGGGGG - Intronic
1060596408 9:124851803-124851825 TTGGCTCAGGCATCTGTAGGTGG - Intergenic
1061006865 9:127933170-127933192 AAAGCTCAGGGTCCTGTGGATGG + Intergenic
1061326686 9:129868650-129868672 AAGGCTCAGGGCTCTGGGAGAGG - Intronic
1062082987 9:134634213-134634235 GAGGCTCTGGGTTTTCTAGGCGG + Intergenic
1062388948 9:136326603-136326625 AAGGCCCAGGATGCTGTCGGGGG + Intergenic
1186183249 X:6993222-6993244 ATTACTCAGGGTTCTGTAGAGGG - Intergenic
1187729052 X:22234576-22234598 AATGCTGAGGCTTCAGTAGGTGG - Intronic
1189002566 X:36962398-36962420 ATGGCTCAGGGAACTGTTGGAGG - Intergenic
1189548712 X:42071320-42071342 AAGGCTCAGGGTCCTGTGGCAGG + Intergenic
1189705293 X:43753546-43753568 AAAGCTCAGGTTTCTGGAGCTGG + Intergenic
1190420828 X:50282557-50282579 AAGGCTCAGGGTTCTGTAGGTGG + Intronic
1190629327 X:52369352-52369374 AATGCTCGGGGTGCTGTTGGAGG + Intronic
1196684320 X:118496930-118496952 AAGGCTGAGGGTGCTCTGGGAGG - Intronic
1200325647 X:155235855-155235877 AAGGCTCAGGTTTCCTTAGCTGG - Intronic
1201772183 Y:17625651-17625673 AGGGCTCAGGGCTGTGTATGAGG - Intergenic
1201829372 Y:18280335-18280357 AGGGCTCAGGGCTGTGTATGAGG + Intergenic
1202373581 Y:24214141-24214163 TAGGCTCATGTTTCTGGAGGAGG - Intergenic
1202497200 Y:25455979-25456001 TAGGCTCATGTTTCTGGAGGAGG + Intergenic