ID: 1190425839

View in Genome Browser
Species Human (GRCh38)
Location X:50333937-50333959
Sequence AAGGGTCTGCTAAACTCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 1, 2: 8, 3: 23, 4: 157}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190425839_1190425846 5 Left 1190425839 X:50333937-50333959 CCCCCAGAGTTTAGCAGACCCTT 0: 1
1: 1
2: 8
3: 23
4: 157
Right 1190425846 X:50333965-50333987 TATATAATGTTCCATGCACTTGG 0: 1
1: 12
2: 8
3: 26
4: 207
1190425839_1190425847 8 Left 1190425839 X:50333937-50333959 CCCCCAGAGTTTAGCAGACCCTT 0: 1
1: 1
2: 8
3: 23
4: 157
Right 1190425847 X:50333968-50333990 ATAATGTTCCATGCACTTGGAGG 0: 1
1: 11
2: 23
3: 38
4: 167
1190425839_1190425850 18 Left 1190425839 X:50333937-50333959 CCCCCAGAGTTTAGCAGACCCTT 0: 1
1: 1
2: 8
3: 23
4: 157
Right 1190425850 X:50333978-50334000 ATGCACTTGGAGGGTTAGAAAGG 0: 7
1: 12
2: 30
3: 23
4: 150
1190425839_1190425848 9 Left 1190425839 X:50333937-50333959 CCCCCAGAGTTTAGCAGACCCTT 0: 1
1: 1
2: 8
3: 23
4: 157
Right 1190425848 X:50333969-50333991 TAATGTTCCATGCACTTGGAGGG 0: 1
1: 11
2: 22
3: 40
4: 198

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190425839 Original CRISPR AAGGGTCTGCTAAACTCTGG GGG (reversed) Intronic
900730421 1:4255340-4255362 AAAGCCCTGCCAAACTCTGGAGG + Intergenic
903277565 1:22231615-22231637 AAGGGGCTGCATATCTCTGGCGG + Intergenic
905262681 1:36730709-36730731 AAGGGGCAGCTCAACCCTGGAGG - Intergenic
905585811 1:39117165-39117187 AAAGGTCAGATAAACTCTGAAGG - Intronic
912742920 1:112218233-112218255 CAGGCTGTGCTAAACTCTGTAGG + Intergenic
913441739 1:118905676-118905698 AAGGGTTTGCAAAATTTTGGGGG + Intronic
918647189 1:186918346-186918368 AAGGGCCTGTTAAACTCTGGGGG - Intronic
923107604 1:230866843-230866865 AAGGGTGTGGTAAACTGGGGAGG - Intronic
1063098104 10:2926035-2926057 AAGTGTCTGCTGAACTCTAAGGG + Intergenic
1063984370 10:11485877-11485899 AAGGTTTTCCTAAACTCTTGAGG - Exonic
1064191882 10:13213636-13213658 AAGGCTCTGCAAAGCTTTGGGGG - Intergenic
1064397222 10:14991668-14991690 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1064400119 10:15014138-15014160 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1066333854 10:34456163-34456185 AATAGTTTGCTAAACTATGGTGG + Intronic
1066390402 10:34973491-34973513 AAGGGCCTATTGAACTCTGGGGG + Intergenic
1070379867 10:75871156-75871178 AAGTGTCTGCTAGAGTCAGGTGG - Intronic
1071282221 10:84113206-84113228 AAAGGCCTGTTAAACTCTGGAGG + Intergenic
1077571300 11:3340484-3340506 AAGGGTCTTCTCCACTCTGGAGG + Intronic
1077589034 11:3477521-3477543 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1078947417 11:16085223-16085245 AAGGAGCTCCTCAACTCTGGAGG + Intronic
1081746939 11:45480013-45480035 AATGGTCTGCAAAACTCTGCGGG - Intergenic
1081967732 11:47179641-47179663 CAGTGTCTGGTAAACACTGGTGG - Intronic
1083010822 11:59397267-59397289 AGGGATCTACTAAACCCTGGTGG - Intergenic
1083700041 11:64470241-64470263 AAGGGTCAGCTAAAGACTGATGG + Intergenic
1084244729 11:67849144-67849166 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1084847464 11:71911683-71911705 AAGGGCCTATTGAACTCTGGGGG + Intronic
1085521886 11:77143929-77143951 AAGGGTCTTGCAAACTCTGAGGG - Intronic
1088117340 11:106327431-106327453 AGGGGTCCGCTAACCACTGGAGG + Intergenic
1091708544 12:2718733-2718755 AAGGGACTGCAAATCTCTTGAGG - Intergenic
1092328118 12:7555676-7555698 AAGTGTCTTCTAAACCATGGTGG + Intergenic
1092415293 12:8286289-8286311 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1092432376 12:8419890-8419912 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1093289298 12:17301616-17301638 AAAGGCCTGTTAAACTCTGGGGG + Intergenic
1096788588 12:54031648-54031670 AAGGGCCCGGAAAACTCTGGCGG - Intronic
1097162510 12:57058190-57058212 AAGGCTCTGGAAAACACTGGTGG + Exonic
1098748643 12:74269065-74269087 AAGGGCCTGTTAAACTCTGGGGG + Intergenic
1104292911 12:127485584-127485606 AAAGGCCTGTTGAACTCTGGGGG + Intergenic
1107174092 13:37379678-37379700 AGGGGTGTGTTAAACTTTGGAGG + Intergenic
1107544157 13:41421456-41421478 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1109779966 13:67096739-67096761 AAAAGTCTGTAAAACTCTGGTGG + Intronic
1109803003 13:67401929-67401951 AAGGGCCTGTTAAACTCTGGGGG + Intergenic
1115747322 14:36450814-36450836 AATGCTTTGCTAAACTCTCGAGG - Intergenic
1117123577 14:52595865-52595887 AAGGATCTGCTATCCTTTGGAGG + Intronic
1127096303 15:55515089-55515111 AAGGGCCGGTTAAACTCTGGGGG - Intergenic
1134165825 16:11928556-11928578 AAGGATCTTCTTCACTCTGGAGG + Intronic
1134494897 16:14725184-14725206 AAGGATCTTCTTCACTCTGGAGG - Intronic
1134500280 16:14764304-14764326 AAGGATCTTCTTCACTCTGGAGG - Intronic
1134526822 16:14950916-14950938 AAGGATCTTCTTCACTCTGGAGG - Intronic
1134545584 16:15105432-15105454 AAGGATCTTCTTCACTCTGGAGG + Intronic
1134580299 16:15364746-15364768 AAGGATCTTCTTCACTCTGGAGG + Intronic
1134714399 16:16349393-16349415 AAGGATCTTCTTCACTCTGGAGG - Intergenic
1134722274 16:16392757-16392779 AAGGATCTTCTTCACTCTGGAGG - Intronic
1134945153 16:18319112-18319134 AAGGATCTTCTTCACTCTGGAGG + Intronic
1134952417 16:18359265-18359287 AAGGATCTTCTTCACTCTGGAGG + Intergenic
1135311218 16:21405970-21405992 AAGGATCTTCTTCACTCTGGAGG + Intronic
1135364170 16:21838421-21838443 AAGGATCTTCTTCACTCTGGAGG + Intronic
1135447673 16:22532927-22532949 AAGGATCTTCTTCACTCTGGAGG - Intronic
1136150372 16:28343865-28343887 AAGGATCTTCTTCACTCTGGAGG + Intronic
1136166609 16:28457703-28457725 AAGGATCTTCTTCACTCTGGAGG + Intronic
1136212706 16:28771454-28771476 AAGGATCTTCTTCACTCTGGAGG - Intronic
1136257428 16:29051373-29051395 AAGGATCTTCTTCACTCTGGAGG - Intronic
1136307922 16:29384966-29384988 AAGGATCTTCTTCACTCTGGAGG + Intronic
1136321338 16:29486510-29486532 AAGGATCTTCTTCACTCTGGAGG + Intronic
1136436018 16:30226480-30226502 AAGGATCTTCTTCACTCTGGAGG + Intronic
1138173493 16:54874995-54875017 AACTGTCTGGTAAACTCTGAAGG + Intergenic
1138578195 16:57922303-57922325 AAGGATCTGAGAAGCTCTGGTGG - Intronic
1139855614 16:69977397-69977419 AAGGATCTTCTTCACTCTGGAGG + Intergenic
1140367120 16:74390692-74390714 AAGGATCTTCTTCACTCTGGAGG - Intronic
1144659764 17:17060402-17060424 AATGGCCTGCTAAACTGGGGAGG + Intronic
1148330766 17:46812547-46812569 AAGAGTCTGGCAGACTCTGGGGG + Intronic
1149499910 17:57144630-57144652 AAGGGTCTCCTACATTTTGGAGG + Intergenic
1154117084 18:11620587-11620609 AAGGATCTTCTTCACTCTGGAGG + Intergenic
1156982580 18:43308059-43308081 AGGGGTCTGCTTAGCTCTTGAGG - Intergenic
1162284204 19:9726110-9726132 AAGGGCCTGTTAAACTCTGGGGG - Intergenic
1163916790 19:20247099-20247121 ACAGGCCTGTTAAACTCTGGGGG + Intergenic
1163943208 19:20513824-20513846 AAGGGCCTGTTAAACTCTGGGGG - Intergenic
1163966372 19:20750816-20750838 AAGGGCCTATTGAACTCTGGGGG - Intronic
1164055870 19:21621704-21621726 AAGGCTCTGCAAAACTTTGTGGG + Intergenic
1166642628 19:44507029-44507051 CAGTGTCTGCTACATTCTGGAGG - Intronic
1168467594 19:56616646-56616668 AATAGTCTGCTAAATACTGGAGG + Intronic
930518552 2:52435521-52435543 AAAGGCCTGTTGAACTCTGGGGG + Intergenic
930525281 2:52521364-52521386 AAGGGTCTTTTATACTCTGGTGG + Intergenic
931193012 2:60023834-60023856 AAGGGCAAGCTATACTCTGGGGG - Intergenic
932349946 2:71023607-71023629 AAGGGCCTATTGAACTCTGGGGG + Intergenic
932353441 2:71049745-71049767 AAGGGCCTACTGAACTCTGGGGG + Intergenic
933238431 2:79891593-79891615 AAAGGGCTGCCACACTCTGGGGG - Intronic
938111589 2:128570483-128570505 AGGGCTCTGCTACACTATGGTGG - Intergenic
940869526 2:158848384-158848406 AAGGGCCTATTGAACTCTGGGGG + Intronic
940872202 2:158869382-158869404 AAGGGCCTATTGAACTCTGGGGG + Intergenic
940874409 2:158885370-158885392 AAGGGCCTATTGAACTCTGGGGG + Intergenic
946241777 2:218360506-218360528 AAGGGTCAGGTGACCTCTGGGGG + Intronic
946690886 2:222307360-222307382 CAGGCGCTGCTAAACCCTGGCGG - Intergenic
947595003 2:231405528-231405550 AAGGGCCTATTGAACTCTGGGGG + Intergenic
949041274 2:241851022-241851044 GAGGGTCTGCAGAACACTGGTGG + Exonic
1170336002 20:15270897-15270919 AAGGGTGTGCTTAAATCTGGTGG - Intronic
1170974012 20:21143586-21143608 AAGGTTCTGCTAAATTTAGGTGG + Intronic
1171408547 20:24930246-24930268 AAGGGCCTATTGAACTCTGGGGG + Intergenic
1175813094 20:61869444-61869466 AAGTGTCTGCTGGACCCTGGAGG + Intronic
1178447716 21:32660793-32660815 AAGGGCCTGTTAAACTCTAGGGG + Intronic
1185016485 22:48346186-48346208 AAGGATCTGCTCAGCTCTGCTGG + Intergenic
949158118 3:851155-851177 AAAGGCCTGTTGAACTCTGGGGG + Intergenic
951020896 3:17779708-17779730 AAGGAGCTCCTAACCTCTGGGGG + Intronic
951166009 3:19485884-19485906 AAGGGCCTGTTAAACCCTGGGGG - Intronic
954569403 3:51627980-51628002 GAGGGTCTTCTACTCTCTGGAGG + Intronic
954663134 3:52236748-52236770 AAGGGTCTGCTGAGCTCAGTTGG - Intronic
957076184 3:75604895-75604917 AAGGGCCTATTGAACTCTGGGGG - Intergenic
960596400 3:119411794-119411816 AAGGGTCTGCTGAACTGTAATGG - Intronic
961272252 3:125698050-125698072 AAGGGCCTACTGAACTCTGGGGG + Intergenic
961278032 3:125742910-125742932 AAGGGCCTACTGAACTCTGGGGG + Intergenic
961876382 3:130026746-130026768 AAGGGCCTACTGAACTCTGGGGG - Intergenic
961892843 3:130144903-130144925 AAGGGCCTAATGAACTCTGGGGG - Intergenic
962963500 3:140332846-140332868 AAGGTTCTGCTAAGATCTAGAGG - Intronic
964522395 3:157583191-157583213 AAGGGCCTGTTAAACTCTGGGGG - Intronic
965319067 3:167229020-167229042 AAGGATCTGCTAATCCCTGATGG + Intergenic
967420340 3:189265465-189265487 AAGTGTCTGCTAAATTCTAATGG + Intronic
968215818 3:196889256-196889278 ATGGGTCTGCTAACCTCAGTAGG - Intronic
968771796 4:2512269-2512291 AAGGTTCTGCCCAGCTCTGGAGG - Intronic
969492625 4:7508873-7508895 AAGGGAAGGCTAAAATCTGGAGG + Intronic
969734217 4:8976213-8976235 AAGGGCCTCTTGAACTCTGGGGG + Intergenic
969749920 4:9102238-9102260 AAGGGCCTACTGAACCCTGGGGG + Intergenic
969789067 4:9479509-9479531 AAGGGCCTATTGAACTCTGGGGG + Intergenic
969793804 4:9510277-9510299 AAGGGCCTATTGAACTCTGGGGG + Intergenic
971863733 4:32141870-32141892 AAGGCTCTGCAAAACTTTGGAGG - Intergenic
974209904 4:58758352-58758374 TATGGTCTGCCAAACCCTGGAGG - Intergenic
974640399 4:64623392-64623414 AAGGCTCTGCATAACTTTGGTGG - Intergenic
979929256 4:126610371-126610393 AAGGGTCTGCTGGACTATGTTGG + Intergenic
980780151 4:137483063-137483085 AAGGGCCTGTTAAACTCTGGGGG + Intergenic
980862949 4:138521542-138521564 AAAGATCTGCTAAAATATGGTGG - Intergenic
987506638 5:18782739-18782761 AAGGCTCTGCATAGCTCTGGGGG - Intergenic
989593301 5:43131678-43131700 AAGGCTTTGCTGAACTCTTGAGG - Intronic
989863688 5:46419444-46419466 AAAGGTGTTCTAAACTCTGTGGG + Intergenic
993320473 5:86463358-86463380 AAAGGCTTGTTAAACTCTGGAGG + Intergenic
994379833 5:99057818-99057840 TAGGGCCAGCTAAACGCTGGAGG + Intergenic
995473833 5:112528659-112528681 AAGGTCCTGTTAAACTCTGGGGG + Intergenic
995742159 5:115366274-115366296 AAGTGTCTGCTAAGCTATGAGGG + Intergenic
996017569 5:118557499-118557521 GAGGTTCTGCCAAGCTCTGGGGG - Intergenic
996613528 5:125412551-125412573 AAGGGTGTGCTTAATTCTGTAGG - Intergenic
999058301 5:148605807-148605829 AAGAGACTGCTACACTCTGTAGG - Intronic
999713965 5:154344126-154344148 CAGGGTCTTCTAAAACCTGGAGG - Intronic
1000257829 5:159557668-159557690 AAGAGTCTGCGAACCCCTGGAGG + Intergenic
1003847989 6:10193842-10193864 AAGGTTCTGCCAAGCTCTGTTGG - Intronic
1004651104 6:17609503-17609525 TTGGGTCTGCTAAAGTTTGGGGG + Exonic
1005405878 6:25487350-25487372 AAGGGTCTGCCCAAATGTGGAGG + Intronic
1012611689 6:101227133-101227155 AAAGGCCTGTTGAACTCTGGGGG - Intergenic
1014223468 6:118822542-118822564 AAGTGTCTGCTGAACCCTGCTGG + Intronic
1014307487 6:119759605-119759627 AAGTGTCTGATAAAACCTGGAGG + Intergenic
1020307021 7:6843222-6843244 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1020311497 7:6872066-6872088 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1020323065 7:6954404-6954426 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1022516696 7:30979294-30979316 ACGGGTCTGCCATGCTCTGGAGG + Exonic
1026301612 7:69102765-69102787 AGGGGTCTTCTAATATCTGGAGG - Intergenic
1029078175 7:97952166-97952188 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1030468029 7:109927006-109927028 AAAGATCAGCTGAACTCTGGAGG - Intergenic
1032170776 7:129582843-129582865 AAAGGCCTGTTGAACTCTGGGGG + Intergenic
1033453490 7:141482109-141482131 AGGTCTCTGCTAAACTCTGTGGG - Intergenic
1033551745 7:142453640-142453662 AAGTGTCTGCTGCACTCTGGGGG - Intergenic
1034268099 7:149790867-149790889 GAGGGTCTGCTCAGGTCTGGTGG - Intergenic
1034420429 7:150987648-150987670 AGGGGTCTGCCAGCCTCTGGGGG + Intergenic
1036239833 8:7072337-7072359 AAGGGCCTATTGAACTCTGGGGG + Intergenic
1036903500 8:12689228-12689250 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1036906000 8:12708907-12708929 AAAGGCCTGCTGAACTCTGGGGG - Intergenic
1037574224 8:20185611-20185633 AAAGGTATGCTAAAATATGGGGG + Intergenic
1037905467 8:22713704-22713726 GAGGCTCTGCTAACATCTGGGGG - Intronic
1038799128 8:30733386-30733408 AAGGGCCTATTGAACTCTGGGGG + Intronic
1039278388 8:35956286-35956308 AAAGGCCTATTAAACTCTGGGGG + Intergenic
1041006111 8:53498270-53498292 AAGGGTGTGCTAGAGTCTGGAGG - Intergenic
1041008988 8:53523228-53523250 AAGGGCCTGTTGAACTCTGGGGG - Intergenic
1042078694 8:65025360-65025382 AAGTATCTGCTCAACTGTGGAGG - Intergenic
1047119293 8:121882592-121882614 AAGAGACTTCTAAACTCTGCTGG + Intergenic
1048182951 8:132213231-132213253 AAGGGACAGTTAAGCTCTGGTGG - Intronic
1050297687 9:4222457-4222479 AAGGGTCAGGTAAACACAGGGGG - Intronic
1056295788 9:85191776-85191798 ATGCTTCTGCTTAACTCTGGTGG + Intergenic
1056917169 9:90756062-90756084 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1060101664 9:120846023-120846045 CAGGGCCTGCTACACTCTGAGGG + Intergenic
1062224082 9:135439214-135439236 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1185909967 X:3972196-3972218 AAGGGCCTGTTAAACTCTGGGGG + Intergenic
1189293326 X:39901249-39901271 TGGGGTCTGCTGAACTCTGCTGG + Intergenic
1190425839 X:50333937-50333959 AAGGGTCTGCTAAACTCTGGGGG - Intronic
1190503144 X:51098715-51098737 AAGGGTCTTCTCTACTCTGGAGG + Intergenic
1190556626 X:51642179-51642201 AAGATTCTGCTAACCTGTGGCGG + Intergenic
1191036032 X:56027429-56027451 AAAGGCCTGTTAAATTCTGGGGG - Intergenic
1194400555 X:93434469-93434491 AAGGGTCTATTGAACTCTGGGGG + Intergenic
1198792548 X:140361471-140361493 CAGGGACTTCTAAACACTGGGGG - Intergenic
1200394075 X:155972905-155972927 AAGGGCCTGTTAAACTCTAGGGG - Intergenic
1200440240 Y:3203942-3203964 AAGTGGCTGCAAAACTGTGGAGG + Intergenic
1200925304 Y:8648985-8649007 AAGGTCCTGTTAAACTCTGAAGG + Intergenic
1201278849 Y:12323274-12323296 AAGGGTCCGCTAACTTCTGTGGG - Intergenic
1201401338 Y:13607414-13607436 AAGACTCTGCATAACTCTGGGGG + Intergenic
1201555107 Y:15259043-15259065 AAGGGTCTGTTAAACTCTGGGGG + Intergenic
1202126765 Y:21575243-21575265 AAGGGGCTGTTAATCTCTGGAGG + Intergenic