ID: 1190427387

View in Genome Browser
Species Human (GRCh38)
Location X:50345909-50345931
Sequence TGGGGGAAGAAAGCTGTTGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 277
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 259}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190427374_1190427387 25 Left 1190427374 X:50345861-50345883 CCAAACCAAAGGGTTGGTCCTGT 0: 1
1: 0
2: 0
3: 8
4: 68
Right 1190427387 X:50345909-50345931 TGGGGGAAGAAAGCTGTTGCGGG 0: 1
1: 0
2: 1
3: 16
4: 259
1190427383_1190427387 -5 Left 1190427383 X:50345891-50345913 CCAAAAATAGGGGAAAGGTGGGG 0: 1
1: 0
2: 0
3: 19
4: 171
Right 1190427387 X:50345909-50345931 TGGGGGAAGAAAGCTGTTGCGGG 0: 1
1: 0
2: 1
3: 16
4: 259
1190427375_1190427387 20 Left 1190427375 X:50345866-50345888 CCAAAGGGTTGGTCCTGTCTGTC 0: 1
1: 0
2: 1
3: 13
4: 101
Right 1190427387 X:50345909-50345931 TGGGGGAAGAAAGCTGTTGCGGG 0: 1
1: 0
2: 1
3: 16
4: 259
1190427376_1190427387 7 Left 1190427376 X:50345879-50345901 CCTGTCTGTCATCCAAAAATAGG 0: 1
1: 0
2: 0
3: 7
4: 112
Right 1190427387 X:50345909-50345931 TGGGGGAAGAAAGCTGTTGCGGG 0: 1
1: 0
2: 1
3: 16
4: 259

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190427387 Original CRISPR TGGGGGAAGAAAGCTGTTGC GGG Intronic
900693533 1:3995947-3995969 TGGGGGAAGCAGGCTGTGGAGGG + Intergenic
902332753 1:15738545-15738567 GGTGGGTAGAGAGCTGTTGCAGG + Intronic
902533607 1:17106140-17106162 GGTGGCAAGAAAGCTGTGGCAGG - Intronic
902798430 1:18814665-18814687 TGTGGGGAGACAGCTGTGGCGGG - Intergenic
904635008 1:31873149-31873171 TGGGGGAAGTAAGAAGTGGCTGG + Intergenic
905380716 1:37559639-37559661 AGGGGGCAGTTAGCTGTTGCTGG - Intronic
906566192 1:46802871-46802893 TGGAGGTAGAAACCTGTGGCAGG + Intronic
907788065 1:57633492-57633514 TGAAGGAAGAATGCTGTTCCTGG + Intronic
908478667 1:64514542-64514564 TGGGGGAGGAATGCAGTTGTAGG + Intronic
908737493 1:67291632-67291654 TGGGCGATGAAAGGGGTTGCTGG - Intergenic
909280944 1:73752863-73752885 TGGGGGAAGAAACCTTGTGGGGG + Intergenic
909947686 1:81682171-81682193 TACAGGAAGGAAGCTGTTGCTGG + Intronic
913979690 1:143497842-143497864 TGGGGGCAAAAAGCTGCGGCGGG - Intergenic
914073935 1:144322957-144322979 TGGGGGCAGAAAGCCGCGGCGGG - Intergenic
914105218 1:144643403-144643425 TGGGGGCAGAAAGCCGCGGCGGG + Intergenic
915093585 1:153443736-153443758 TGGGAGAAGAAAGCACCTGCAGG + Intergenic
915264481 1:154706806-154706828 TGGGGCTGGAAACCTGTTGCTGG + Exonic
915907459 1:159889285-159889307 GGTGGGAAGAAAGCTGCTTCTGG + Intronic
920281919 1:204849925-204849947 TGTGGGAAAAAAGCTGTGTCTGG + Intronic
1063133473 10:3197364-3197386 TGGGGGAAGCAAGGAGTTACAGG + Intergenic
1063953063 10:11242355-11242377 TGGGGGAAGGAAGCAGCTGCGGG - Intronic
1064722498 10:18244062-18244084 TGTGGCAAGGAAGATGTTGCTGG + Intronic
1065386311 10:25136982-25137004 TGGGGGAAGAAAGATGTTGGGGG + Intergenic
1065598970 10:27349148-27349170 TGGGGGAAGAAAAGTATTTCTGG - Intergenic
1067802476 10:49368545-49368567 TGGGAGATGACAGCTTTTGCTGG + Intronic
1068949663 10:62764483-62764505 GGGGTTAAGAAAGCAGTTGCTGG - Intergenic
1071345023 10:84684463-84684485 GTTGGGAAGAAAGCTGATGCAGG + Intergenic
1072823902 10:98586314-98586336 TGGTGGAACATAGCTGTTGGTGG - Intronic
1072986193 10:100143188-100143210 TGGGAGAAGAAGGCAGCTGCGGG - Intergenic
1073648516 10:105333571-105333593 TGGGGAAATAAAGCTTTTGGTGG + Intergenic
1074974699 10:118570590-118570612 TTTGGGAAGAAAGCTGCTGAGGG - Intergenic
1075222613 10:120598338-120598360 TGGGGGAAGAAAGTACTTGCTGG - Exonic
1075240565 10:120774682-120774704 GGGTGGAAGAAAGCAGATGCAGG + Intergenic
1075721380 10:124589623-124589645 TGGGTGATGAAAGCTGGGGCCGG - Intronic
1077168437 11:1153991-1154013 AGGGAGGAGAAAGCTGTGGCTGG + Intergenic
1078148861 11:8741796-8741818 TGGGGGATTCTAGCTGTTGCTGG - Intronic
1079233466 11:18670005-18670027 TGGGGGGAAAAAGCTGTAGAGGG - Intergenic
1079717553 11:23767227-23767249 TGTTGGAACAAAGCTGTTGTGGG + Intergenic
1080022352 11:27575953-27575975 AGGGGCAAGAAAACTGCTGCAGG - Intergenic
1080119216 11:28657027-28657049 TAGGGGTAGCAAGCTCTTGCTGG + Intergenic
1080216249 11:29844641-29844663 CTGGGGAAGAAAGCTCCTGCTGG + Intergenic
1081285465 11:41263903-41263925 TGGGGGAAGATAGCATGTGCGGG + Intronic
1084708551 11:70830013-70830035 TGGGGGAAGGAGGCTCTTACAGG - Intronic
1085047120 11:73360098-73360120 TGGGGGAAGTAACATGTTCCAGG + Intronic
1085072518 11:73560388-73560410 TGTGTGAAGATACCTGTTGCTGG + Intronic
1085119621 11:73958747-73958769 ACGGGGAAGAAAGCTGAAGCTGG + Intronic
1088201954 11:107346799-107346821 TGGGGGAAGAAGGCTGGAGGTGG - Intronic
1088743553 11:112786198-112786220 GGTGGGATGAAAGTTGTTGCTGG - Intergenic
1088813081 11:113404606-113404628 TGGGAGATGGAAGCTGTTGGTGG + Intergenic
1089156750 11:116408728-116408750 GGGGGGAGGAAGGCTGTTTCTGG - Intergenic
1089339752 11:117749358-117749380 TGAGGAAAGAAAGCTGCTTCTGG - Intronic
1089797959 11:120998554-120998576 CAGGAGAAGAATGCTGTTGCAGG + Intergenic
1093186612 12:16027403-16027425 TTGGGAAAAAGAGCTGTTGCAGG + Intronic
1095583790 12:43829118-43829140 TGGGGGAAGAAAGAAATTCCAGG - Intergenic
1096197741 12:49659375-49659397 TGGTGGAAGACATCTGTTCCAGG - Intronic
1096569077 12:52509097-52509119 TGTGAGAAGAATGCTGTTGTGGG + Intergenic
1096673983 12:53216683-53216705 TGGGGGAGGGAACCTGTTTCTGG + Intronic
1097190153 12:57215962-57215984 TGGGGGCAGAGAGCTGGGGCTGG + Intergenic
1098059316 12:66543157-66543179 TGGGGGAAGAAGGCTGGGGACGG + Intronic
1099668771 12:85663532-85663554 TGGTGACAGAAAGTTGTTGCTGG - Intergenic
1100783669 12:98056228-98056250 TGTGGGAAGAAGGCCCTTGCCGG + Intergenic
1101909378 12:108850411-108850433 TGGGGGAGGAAAGCTGGGGAAGG + Intronic
1101987137 12:109456199-109456221 TTGGGGATGAAATCTGCTGCTGG - Exonic
1102410821 12:112716744-112716766 TAGGGGAGGAAAGATGTTGGGGG + Intronic
1106180314 13:27364036-27364058 TTGTGGATGAATGCTGTTGCTGG + Intergenic
1106585320 13:31052125-31052147 TCTGGGAGGAAAGCTGGTGCAGG - Intergenic
1107761968 13:43689014-43689036 TGGGGGAGGACAGTTGTTCCAGG + Intronic
1108107921 13:47033157-47033179 AGGTGAAAGAAAGCAGTTGCAGG - Intergenic
1110159671 13:72360365-72360387 TGGGAGAGGAAAGCTGTTCAGGG + Intergenic
1110887765 13:80659294-80659316 TTTGGGAAGAAAGCTGAGGCAGG - Intergenic
1111484178 13:88873892-88873914 TGGAGGATGTAAGCTGTTGGGGG + Intergenic
1111973242 13:94939169-94939191 AGGCTGAAGAAAGCTGTGGCAGG + Intergenic
1112808024 13:103184224-103184246 TGGAGGCAGAAAGCACTTGCGGG - Intergenic
1114674862 14:24432946-24432968 TGAGGGAATACAGCTTTTGCAGG - Exonic
1121300703 14:92868382-92868404 TGGGGGAAAAGAGGAGTTGCTGG + Intergenic
1122584614 14:102796564-102796586 TGCGTGAACAAAGCTGTTGGCGG - Intronic
1123035678 14:105470956-105470978 AGGGGGCAGCAAGCGGTTGCAGG + Intergenic
1123765844 15:23477806-23477828 CTGGGCAACAAAGCTGTTGCAGG - Intergenic
1125471413 15:40008119-40008141 AGTGGGCAGAAAGCTGTTGGTGG - Exonic
1125838372 15:42774196-42774218 TTGGGGAACAATGCTGTTTCTGG + Intronic
1127633979 15:60851791-60851813 TGGAGGAAGAAAACTATTGTGGG - Intronic
1127821430 15:62659580-62659602 TAAGGGAAGAATACTGTTGCTGG - Intronic
1128199243 15:65791432-65791454 TGGGGGAAGGGAACTGTTCCTGG - Intronic
1128280577 15:66390821-66390843 TGGTGGAAGAAAGGAGTGGCAGG - Intronic
1128448416 15:67785356-67785378 TGAGCGAAGAAAGCTGTTTGCGG + Intronic
1128579544 15:68799309-68799331 TGAGGGAAGAAAGGAGTTGGAGG + Intronic
1129228102 15:74181465-74181487 TGGGAGAAGAAAGCTGAGGCAGG + Intronic
1129294066 15:74590020-74590042 TGGGAGAAGGAAGCTGAGGCTGG + Intronic
1131612465 15:93979378-93979400 AGGATGAAGAAAGCTGCTGCTGG + Intergenic
1132475216 16:132306-132328 TGGGCAAAGAAAGCAGTTTCTGG - Intronic
1132969983 16:2682513-2682535 CGGTGGAAGGGAGCTGTTGCGGG + Exonic
1135406129 16:22199290-22199312 AGGGGGATGAGAGCTGTTTCTGG + Intergenic
1135907274 16:26524525-26524547 TGTGGATAGAAAGCTGTTACGGG - Intergenic
1136383907 16:29911059-29911081 TGGGGGACGAGATCTGCTGCTGG - Exonic
1137434935 16:48447388-48447410 TGGGGGAATACAGATGTTGATGG + Intronic
1138480424 16:57299222-57299244 TGGGAGAAGAAAGAGTTTGCTGG - Intergenic
1138488864 16:57364451-57364473 TGGGGGAAGAAAGGTGAATCTGG - Exonic
1139589507 16:67925787-67925809 TGGGTGAAGACAGCAGCTGCAGG + Intronic
1141364791 16:83432641-83432663 TGGGTGGAGAAAGGTGTAGCCGG + Intronic
1142030739 16:87837218-87837240 TGGGGGAAGCAGCCTGTTGGGGG + Intronic
1142485856 17:247291-247313 TGGGGGAAGAGAGCTGCTTGGGG + Intronic
1142840652 17:2626537-2626559 GGGGGGAAGAAAGGTGATGCCGG - Intronic
1145693234 17:26766267-26766289 TGGGGGCAAAAAGCTGCGGCGGG - Intergenic
1146647951 17:34587684-34587706 TGGTGGAAGAATGGTGTTGGTGG + Intronic
1147304418 17:39553447-39553469 TGGGGTAAGAATGCTGTTTCAGG - Intronic
1149131075 17:53303065-53303087 TGGGGAAAGAACTCTGGTGCTGG - Intergenic
1149853537 17:60057229-60057251 TGGTGGAAGAAAGCCCCTGCAGG - Exonic
1151665322 17:75542374-75542396 TGGGGGAAGGAAGCAGATCCAGG - Intronic
1151815708 17:76470438-76470460 TGGGGCAGGGAAGCTGGTGCAGG + Intergenic
1152620000 17:81358363-81358385 TGGGGGATGGAAGCTGGGGCTGG + Intergenic
1154058878 18:11039351-11039373 GGGCGGAAAAAAGCTATTGCAGG + Intronic
1157730517 18:50000470-50000492 TGGGGAATGAAAGCTGTCCCAGG + Intronic
1159501880 18:69282473-69282495 TGGGATAAGGAAGCTGTTGGGGG - Intergenic
1161451717 19:4350067-4350089 TGGGGGAAGAAGGTGGTTGGGGG + Intronic
1162081889 19:8223031-8223053 TGGGGGAAGATAGTTGTCCCTGG + Intronic
1162990371 19:14298090-14298112 TGGGGGAAGGATGCGGCTGCTGG + Intergenic
1163337753 19:16684624-16684646 TGGGGGAAATAAGCTGATGGGGG + Intronic
1163771130 19:19192071-19192093 AAGGGGAAGAAAGGTGGTGCGGG - Exonic
1164015877 19:21255677-21255699 TGGGAGAAGAAAGCTGGACCTGG + Intronic
1164965214 19:32477549-32477571 TGCGGGAAGCATGCAGTTGCTGG + Exonic
1165285439 19:34838206-34838228 TGGGCGAAGGAAGATGTTGATGG - Intergenic
1165902614 19:39175713-39175735 TGGAGGAAGAAGCCTGTGGCGGG - Intronic
1166374063 19:42317139-42317161 AGGAGAAAGAAAGCTGCTGCGGG - Intronic
1167034833 19:46988926-46988948 TGGGGGAGGTAAGCTGGTACAGG - Intronic
1167786043 19:51637040-51637062 TGGGGGAATGAAGCTGTCCCAGG - Intronic
1202680625 1_KI270712v1_random:4286-4308 TGGGGGCAGAAAGCCGCGGCGGG + Intergenic
1202680644 1_KI270712v1_random:4353-4375 TGGGGGCAGAAAGCCGCGGCGGG + Intergenic
924992072 2:320821-320843 TGGGCGATCAAAACTGTTGCTGG + Intergenic
925326231 2:3024092-3024114 TGGAGAAAGGAAGCAGTTGCTGG + Intergenic
932017907 2:68051630-68051652 TGGGGGAAGAACAATGTGGCTGG - Intronic
932067630 2:68583266-68583288 TAGGGTAGTAAAGCTGTTGCAGG - Intronic
932810616 2:74822631-74822653 AGGGGAAAGAAAGCTGCTGAGGG + Intergenic
933792411 2:85893685-85893707 GGCGGGAAGAAAGATGTTGGTGG + Intergenic
934188946 2:89767669-89767691 GGGGGGCAAAAAGCTGTGGCGGG + Intergenic
934248146 2:90324562-90324584 GGGGGGCAGAAAGCTGAGGCGGG + Intergenic
934257882 2:91442953-91442975 CGGGGGCAGAAAGCGGCTGCGGG - Intergenic
934261079 2:91477702-91477724 GGGGGGAAAAAAGCCGTGGCGGG - Intergenic
940088977 2:149895161-149895183 TGGGGGAAGAAACATGGAGCAGG + Intergenic
941042952 2:160643987-160644009 TGGGGATAGGGAGCTGTTGCAGG + Intergenic
941442551 2:165556082-165556104 TAGGGGAAGACAGCAGTAGCAGG + Intronic
941970080 2:171340835-171340857 TGGGGGAAGAATGGAGTTACGGG - Intronic
942683568 2:178507232-178507254 TGGGGGAAGAAAAATGTGGGAGG - Exonic
943004289 2:182370596-182370618 TGTGGCAAGACTGCTGTTGCTGG + Intronic
943736929 2:191366513-191366535 TGGGGCAATAAAGATGATGCTGG - Intronic
945637433 2:212372879-212372901 TGGGTGAATAAGGCTGTTCCAGG - Intronic
946198613 2:218056402-218056424 TGGGGGAAAAAAGCTCTCTCAGG - Intronic
947054071 2:226080449-226080471 AAGGGGAAGAAGGCTGTGGCAGG + Intergenic
947319831 2:228904616-228904638 TTGTGGTAGAAACCTGTTGCTGG + Intronic
948028564 2:234798422-234798444 TGAGAGAAGAAAGTGGTTGCAGG - Intergenic
948193641 2:236078991-236079013 TGGGGGAAGATACCTGATGCCGG + Intronic
948403961 2:237703670-237703692 TGGGGGAAGAAACGTGTGGCAGG - Intronic
1169335076 20:4749142-4749164 TGGGGGAAGAAAGCCATTCCCGG + Intergenic
1170495247 20:16917190-16917212 TGGGGGAAGAACACTGAAGCAGG - Intergenic
1171988697 20:31678885-31678907 TGGGGAGAGAAGGGTGTTGCAGG - Intronic
1172481619 20:35274990-35275012 TGGGGGATGAGAGCTAGTGCTGG - Exonic
1175789999 20:61735126-61735148 TGGGGAGAGGAAGCTGTGGCCGG + Intronic
1179567596 21:42258819-42258841 TTAGGGAACAAAGCTGCTGCTGG - Intronic
1182269829 22:29146292-29146314 TGAGGGGAGACAGCTGTGGCTGG - Intronic
1182580695 22:31308743-31308765 TGGGGGATGAATTCTGTTCCTGG - Intergenic
1183404835 22:37625257-37625279 TGGGGGAAGAAGTCTGGTGGGGG + Intronic
1183493536 22:38129142-38129164 TGGGGAAAGAAGGCTGCTGCTGG + Intronic
1183589227 22:38770193-38770215 TGCGGGAAGAGAGCTGCTGCTGG + Intronic
950107344 3:10396671-10396693 TGGGGGAGGCAGGCTGCTGCAGG + Intronic
953314401 3:41912846-41912868 TTTTGGAAGAAAGCTTTTGCTGG - Exonic
957866626 3:86033441-86033463 TGGGGGAAGAAATGTCTTCCTGG - Intronic
960386396 3:117026500-117026522 TGGGGCGAGAAAGATGTTACCGG - Intronic
960604965 3:119496001-119496023 TGGTGGAAGAATGGTGTTCCAGG + Intergenic
960932565 3:122868641-122868663 TGGGGGAAGGTAGCTGTGTCAGG - Intronic
961104372 3:124228596-124228618 TGGGGTAAGCAATCTGTAGCTGG + Intronic
961423524 3:126827316-126827338 TGGAGGATGAAAGCAGTTCCAGG + Intronic
961446854 3:126985005-126985027 GGGGGGAAGACAGCTGCTCCTGG - Intergenic
962473739 3:135737611-135737633 TTGGGGAATTAAGCTGTTTCTGG + Intergenic
962600096 3:136984977-136984999 TGGGGGCTGGCAGCTGTTGCTGG + Intronic
962855703 3:139342892-139342914 TGGGGGAAAATAGCTGAGGCTGG + Intronic
967948502 3:194822842-194822864 TGGGGGAAGGCAGCTGATGAGGG - Intergenic
973298342 4:48552157-48552179 TGGGGTAAGAAGGATGTTGGGGG - Intronic
974369195 4:60992236-60992258 TGTGGGAAGAAAGCTGTGGGAGG + Intergenic
974815968 4:67003879-67003901 TGTGGGAATAGAGCTGCTGCAGG - Intergenic
975491949 4:74998937-74998959 TGGAGGAAGGAGGCTGTTGATGG - Intronic
976974264 4:91147416-91147438 TCTGGGTAAAAAGCTGTTGCTGG + Intronic
977667467 4:99657403-99657425 TGGAGGAAGCAAGATGCTGCAGG - Intergenic
977688710 4:99878355-99878377 TTGGGGAAGAAAGTTGTCTCAGG - Exonic
977955279 4:103019164-103019186 TGGGGGAAGAGAGCTTTCTCAGG + Intronic
979194259 4:117901055-117901077 TGAGGGAAGAAAGCTGTCACAGG - Intergenic
980062844 4:128150591-128150613 TGGGGGAAAAAAGATGAAGCTGG - Intronic
981696516 4:147564356-147564378 TCTGTGAAGTAAGCTGTTGCGGG + Intergenic
982635001 4:157884440-157884462 TGGGGAATGAAAGCAGGTGCTGG - Intergenic
985319506 4:188694082-188694104 TGGGAGATGAAAGCTGTGCCAGG + Intergenic
989643173 5:43603090-43603112 GGCGGGAAGAAAGCTGGGGCGGG + Intronic
990247812 5:53881068-53881090 TCTGTGAAGAAAGCTGTTTCTGG - Intergenic
991259122 5:64647891-64647913 TGGGGTAAGAAAGCTGGGGGCGG + Intergenic
992767626 5:80015667-80015689 TGGGGAAGGTCAGCTGTTGCAGG + Intronic
992946938 5:81820277-81820299 TGTGGGGAGCAAGTTGTTGCTGG - Intergenic
996077550 5:119214809-119214831 TTTGGGAAGAAAGCTCCTGCAGG - Intronic
998501502 5:142636822-142636844 TGAGGGGAGAAGGCTGTGGCTGG + Intronic
998975370 5:147640142-147640164 TGGGGGAAAAAACAAGTTGCTGG - Intronic
999082892 5:148861005-148861027 TGGGGGAAGAGAGGTGCTACTGG - Intergenic
999243541 5:150140929-150140951 TGAGGGAGGGAAGCTGTTGCTGG - Intronic
999246447 5:150157535-150157557 AGGGTGAAGAAAGCTGTCCCAGG + Intergenic
999247646 5:150163746-150163768 GGCGGGAAGACAGCTGTGGCTGG - Intergenic
1000861082 5:166456846-166456868 TGGGGGGAAAAAGATGTTGCTGG - Intergenic
1001519164 5:172378413-172378435 AGAGGGAAGAAAGCTTTTGTTGG + Intronic
1002863194 6:1097743-1097765 TGGGGGAAGACAGCCCTGGCGGG - Intergenic
1003290057 6:4772776-4772798 TGGGGGTACAAAACTGTTGAAGG + Intronic
1005102861 6:22192019-22192041 TGGGGCATGAAAGCTTATGCAGG + Intergenic
1005380387 6:25228202-25228224 TGGGGGAAGACTTCTTTTGCAGG + Intergenic
1005585704 6:27274297-27274319 TGGGGACAGAAAGCTGTTCAGGG + Intergenic
1005585749 6:27274925-27274947 TGGGGACAGAAAGCTGTTCAGGG - Intergenic
1005759061 6:28951004-28951026 TGCAGGAAGAAGGCTTTTGCAGG + Intergenic
1006933784 6:37703499-37703521 TGGGGGAAGACTGCTATTACAGG + Intergenic
1007267070 6:40604613-40604635 TGGGAGAAGGAAGGGGTTGCAGG + Intergenic
1007642516 6:43353885-43353907 TGTGGGAAGAAAGCAGTGACTGG - Intronic
1009423458 6:63488545-63488567 TGGGAAAAGAAAGCTGTAGGGGG - Intergenic
1009748617 6:67854055-67854077 TGGGGGAGGAACACTGTTTCAGG - Intergenic
1011240620 6:85267817-85267839 TGGCGGAAGAAAGAGGGTGCTGG - Intergenic
1012563450 6:100616633-100616655 TGGGGGAAAAAATCTGAAGCAGG - Intronic
1013624060 6:111919818-111919840 TGGGGGAAGAAAGGTGTCAAAGG - Intergenic
1013738912 6:113260280-113260302 TGGGGCAAGACATCTGTGGCAGG - Intergenic
1014317280 6:119883775-119883797 TGGGGGAAGAGGGCAGTGGCAGG - Intergenic
1014703592 6:124719638-124719660 TAGGAGAAGAAAGCTGTTTAGGG - Intronic
1015961624 6:138655962-138655984 TGGGGGAGGTAAGCTCTTTCTGG - Intronic
1015989376 6:138921018-138921040 AGCGGTAAGGAAGCTGTTGCTGG - Exonic
1016094299 6:140017095-140017117 TAGGCGAAGAAAGCAGGTGCTGG + Intergenic
1017019342 6:150127746-150127768 TGGGGGAAGACGGTTGCTGCTGG - Intergenic
1017120838 6:151022630-151022652 AGGGGGAAGACAGCTTTTCCAGG - Intronic
1018630408 6:165817161-165817183 TGGGAGAAGAAAGATGTGACAGG - Intronic
1020732378 7:11897605-11897627 TGAGCAAAGGAAGCTGTTGCTGG - Intergenic
1021640723 7:22733878-22733900 TGGAGGAAGAAGTCTGTAGCGGG - Intergenic
1022704667 7:32791025-32791047 TGGGGGAAGAAGTCTGGAGCTGG + Intergenic
1022909999 7:34891626-34891648 TGGGGGAAGAAGTCTGGAGCTGG + Intergenic
1023226671 7:37976876-37976898 TGGTGGCAGAAAGCTGATTCTGG - Intronic
1023651920 7:42379721-42379743 AGCTGGAAGACAGCTGTTGCAGG - Intergenic
1025838687 7:65123092-65123114 TGGGGGCAGAAAGCCGCAGCGGG - Intergenic
1025840256 7:65140706-65140728 TGGGGGCAGAAAGCCGCAGCGGG - Intergenic
1025882806 7:65555259-65555281 TGGGGGCAGAAAGCCGCAGCGGG + Intergenic
1025884385 7:65572890-65572912 TGGGGGCAGAAAGCCGCAGCGGG + Intergenic
1025890638 7:65647345-65647367 TGGGGGCAGAAAGCCGCAGCGGG - Exonic
1026762024 7:73134023-73134045 TGGTGGAAGATAGAGGTTGCAGG - Intergenic
1027038365 7:74942847-74942869 TGGTGGAAGATAGAGGTTGCAGG - Intergenic
1027085198 7:75258635-75258657 TGGTGGAAGATAGAGGTTGCAGG + Intergenic
1028504611 7:91557371-91557393 TGGGGGAAGAAAATTCATGCTGG + Intergenic
1030485166 7:110156423-110156445 TTGGGGAATAATGCTGTTGAAGG - Intergenic
1031082670 7:117273658-117273680 GGGGGGAAGAAAGCTAGAGCTGG + Intergenic
1031617987 7:123903631-123903653 TCCAGGAAGAAACCTGTTGCAGG - Intergenic
1032427523 7:131833568-131833590 TTTTGGAAGAAAGCTGTGGCAGG + Intergenic
1033432107 7:141299003-141299025 TGGGAGTAGAAGGCTGTTTCTGG + Intronic
1033848247 7:145462036-145462058 TGAATGAAGAAAGCTGTTTCAGG - Intergenic
1033985304 7:147219053-147219075 TGCAGCAAGAAAGCTTTTGCAGG - Intronic
1037913221 8:22756720-22756742 AGGGAGAAGAAAGTGGTTGCTGG + Intronic
1039249934 8:35651611-35651633 TGGGGGAAGAGAGAGGTTGCAGG - Intronic
1039978592 8:42387754-42387776 TGGAGGAAGTCAGCTGCTGCAGG - Intergenic
1046529744 8:115428049-115428071 TGGGGCAAGAAAAATGGTGCTGG + Intronic
1046778620 8:118191291-118191313 TGGTGGAAGAAAGGTGGTGGTGG + Intronic
1047175691 8:122538264-122538286 TGAGGGTAGAAAGCTGTTCTTGG - Intergenic
1049718971 8:144106900-144106922 TGGAGGAAGAAAGCAGAAGCGGG + Exonic
1049960017 9:729424-729446 TGGGGGAAGAAAGGTATTCCAGG + Intronic
1050847830 9:10245748-10245770 AGGGGGAAGACAGATGTGGCAGG + Intronic
1050922238 9:11218359-11218381 TGTGGGAAGGAAGGTTTTGCTGG - Intergenic
1051140213 9:13970578-13970600 GGTGGGAACAAAGCTGTTCCAGG - Intergenic
1054330262 9:63746572-63746594 TGAGATAAGAAAGCTGTTGAAGG - Intergenic
1054407434 9:64774096-64774118 GGGGGGTAAAAAGCTGTGGCGGG + Intergenic
1055875203 9:80933866-80933888 TGGTGTTAGACAGCTGTTGCTGG - Intergenic
1057489447 9:95509976-95509998 TGGGGGGAGAAAGCGGCTGGGGG - Intronic
1058967832 9:110053668-110053690 TGGAGGCAGAATGCTGCTGCTGG + Intronic
1059523231 9:114963553-114963575 TGGTGGCAGACACCTGTTGCAGG - Intergenic
1059621879 9:116014667-116014689 TGGGGGAAGAAAACAGTAGGGGG + Intergenic
1061470968 9:130825297-130825319 TGGGGGAAGAAGGCAGCTGGAGG - Intronic
1061480760 9:130896747-130896769 TGGGGGATGGAAGCTGGTTCTGG - Intergenic
1185567512 X:1107230-1107252 TGGTGGCAGACAGCTGTTGATGG + Intergenic
1186402221 X:9270421-9270443 TGGGTGAAGGACCCTGTTGCTGG - Intergenic
1188033762 X:25294066-25294088 TAGGGGAAGAAACCTGGTTCAGG - Intergenic
1189787821 X:44575068-44575090 TGAAGGAAGAAATCTGTTGTTGG - Intergenic
1190427387 X:50345909-50345931 TGGGGGAAGAAAGCTGTTGCGGG + Intronic
1194607978 X:96005563-96005585 TGGGGGAAGCATGGTGTTACAGG - Intergenic
1196049933 X:111294032-111294054 TGGGGGAAGAGGGGTGTTACAGG + Exonic
1198921798 X:141737297-141737319 TGGGGGAAGAAGGTTGTTTTTGG + Intergenic
1199601436 X:149543676-149543698 TGGGGCAGGAACGCTGTAGCTGG + Intronic