ID: 1190429561

View in Genome Browser
Species Human (GRCh38)
Location X:50366068-50366090
Sequence CATTAAGACCCAAAGCTCTA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 168}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190429561_1190429563 0 Left 1190429561 X:50366068-50366090 CCCTAGAGCTTTGGGTCTTAATG 0: 1
1: 0
2: 0
3: 7
4: 168
Right 1190429563 X:50366091-50366113 ATGTCTGAACATAATTGAGATGG 0: 1
1: 0
2: 2
3: 14
4: 204
1190429561_1190429565 15 Left 1190429561 X:50366068-50366090 CCCTAGAGCTTTGGGTCTTAATG 0: 1
1: 0
2: 0
3: 7
4: 168
Right 1190429565 X:50366106-50366128 TGAGATGGATATTTGGTGTTTGG 0: 1
1: 0
2: 2
3: 20
4: 218
1190429561_1190429564 8 Left 1190429561 X:50366068-50366090 CCCTAGAGCTTTGGGTCTTAATG 0: 1
1: 0
2: 0
3: 7
4: 168
Right 1190429564 X:50366099-50366121 ACATAATTGAGATGGATATTTGG 0: 1
1: 1
2: 2
3: 28
4: 302

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190429561 Original CRISPR CATTAAGACCCAAAGCTCTA GGG (reversed) Exonic
900250102 1:1664451-1664473 CTTTGAGACCCAGAGCTCCAGGG - Exonic
900261133 1:1730357-1730379 CTTTGAGACCCAGAGCTCCAGGG - Intronic
902094846 1:13934694-13934716 CTTTAAGACCCAAAGTTGGAAGG + Intergenic
904122593 1:28210706-28210728 CGTTACAACCAAAAGCTCTAAGG + Intronic
908043767 1:60145668-60145690 CATTGAGAGCCACTGCTCTAGGG - Intergenic
908909609 1:69058050-69058072 AATAAAGACCCAAATATCTATGG + Intergenic
910709066 1:90159978-90160000 CATTAAGACCTGTAGCTGTAAGG + Intergenic
910797884 1:91117036-91117058 AATGAAGACCCAAAGATCCAGGG + Intergenic
910820991 1:91345973-91345995 AATTAAGACCCAAAGACCCAGGG - Intronic
913292518 1:117286954-117286976 GATTAAGAGCATAAGCTCTATGG + Intergenic
918345346 1:183602817-183602839 CATTAGGCCCCTGAGCTCTATGG + Intergenic
920138546 1:203790488-203790510 CATTATGACCCAATGTTGTAGGG + Intergenic
920440522 1:205977717-205977739 CATCAAGACCCAAAGCCCTGAGG - Exonic
1063691572 10:8292679-8292701 CATGAAGACCCAAAGACCCAGGG + Intergenic
1065787218 10:29227815-29227837 GATTAAGACTCAAAACTCTGAGG - Intergenic
1065814535 10:29472187-29472209 GATTAAGACTCAAAACTCTGAGG + Intronic
1065864904 10:29906226-29906248 AATGAAGACCCAGAGATCTAAGG + Intergenic
1068433151 10:56958739-56958761 CAATAAGACCCCATGCTCTCTGG + Intergenic
1068778574 10:60894824-60894846 TATTAAGACACATGGCTCTAAGG + Intronic
1069549314 10:69351541-69351563 CAAAAAAACCCAAAGCTATAAGG + Intronic
1071223356 10:83496102-83496124 AATGAAGACCCAAGGCTCAAGGG + Intergenic
1071317994 10:84421799-84421821 AATGAAGACCCAAAGACCTAGGG + Intronic
1071827867 10:89343197-89343219 AATGAAGACCCAAAGATCCAGGG + Intronic
1075579230 10:123604213-123604235 CGTCAAGACCCACAGCTCTGTGG + Intergenic
1076412711 10:130263550-130263572 CATTGAGACCCACAAATCTATGG - Intergenic
1077399981 11:2350158-2350180 CATTAAATCTTAAAGCTCTAGGG - Intergenic
1078206004 11:9229859-9229881 AATGAAGACCCAAAGACCTAGGG - Intronic
1079684777 11:23345251-23345273 CATTATGACCCAAAGTTCATAGG - Intergenic
1079865686 11:25730587-25730609 AATGAAGACCCAAAGATCCAGGG + Intergenic
1080141543 11:28926756-28926778 CATTATAACCCAAATATCTATGG - Intergenic
1080377388 11:31729265-31729287 CAATCAGTACCAAAGCTCTATGG + Intronic
1083285147 11:61653893-61653915 AATGAAGACCCAAAGATCCAGGG - Intergenic
1088200559 11:107328764-107328786 CTTTATAACCAAAAGCTCTATGG - Intronic
1092338665 12:7656567-7656589 AATCAAGAGCCAAGGCTCTAGGG + Intronic
1092749211 12:11702686-11702708 CATGAAGAGCCAAGGTTCTATGG - Intronic
1093801852 12:23383061-23383083 CACTCACACCCGAAGCTCTAGGG - Intergenic
1094540994 12:31363111-31363133 CAGCCAGAGCCAAAGCTCTATGG - Intergenic
1096023470 12:48341443-48341465 CACTAAGACCCTTAACTCTAGGG - Exonic
1096192041 12:49625816-49625838 AAATAAGACCCAAAGTTTTATGG + Intronic
1097157391 12:57022892-57022914 AATGAAGACCCAAAGATATAGGG - Intronic
1097198769 12:57260483-57260505 CATTAAGACCTAAATCTTCATGG + Intronic
1097369715 12:58762892-58762914 CAGTAAGATCCAAAGTCCTATGG - Intronic
1098536870 12:71603163-71603185 CATTAAGAATCCAAGTTCTATGG - Intergenic
1099582178 12:84463700-84463722 CAGTAAGACCCACAGAACTAAGG - Intergenic
1100415808 12:94373062-94373084 GATTAAGAACCAAGGATCTAGGG - Intronic
1103809087 12:123599774-123599796 AATTAAGACCCAAAGTTACAGGG + Intergenic
1107013120 13:35687202-35687224 AATCCAGACCCAAAGTTCTAAGG + Intergenic
1110118005 13:71844009-71844031 CATTAAGACAGAAGTCTCTAGGG + Intronic
1113722256 13:112568132-112568154 CACTAAGACCCAAAGCCAAATGG + Intronic
1116182214 14:41549612-41549634 AATGAAGACCCAAAGACCTAGGG + Intergenic
1117054361 14:51896551-51896573 TAATAAAACCCAAAGCTCTTAGG - Intronic
1120289631 14:82550926-82550948 AAATAAGTCCCAAAGCTTTAGGG - Intergenic
1120322878 14:82988074-82988096 CAGTCAGACCCAGAGCTCAACGG - Intergenic
1120703574 14:87724914-87724936 CATGAAGACACAAATCTGTAGGG + Intergenic
1124353008 15:28972328-28972350 AATTAAGACCCAAATCTACATGG + Intronic
1124890969 15:33732540-33732562 CCTGAAGACCCAAGGCTCTTGGG - Intronic
1126140626 15:45435126-45435148 AATGAAGACCCAAAGATATAGGG + Intronic
1126640344 15:50818374-50818396 AATTACGACCAAAATCTCTAAGG - Intergenic
1130221106 15:82020400-82020422 CGTTAATACTAAAAGCTCTAGGG + Intergenic
1139559888 16:67735206-67735228 CATTATGCCCCAAAGCTTGAGGG + Intronic
1139937276 16:70580418-70580440 CATTAAGGTCCAAAGACCTACGG - Intronic
1147666540 17:42152425-42152447 CATAACGACCCAAAGCACTGGGG + Intronic
1152588907 17:81201490-81201512 CAACAACACCCAAAGCTCCAGGG - Intronic
1154046828 18:10913961-10913983 CATAAAAATCCAAACCTCTAGGG - Intronic
1154174830 18:12079048-12079070 CATAAAAATCCAAACCTCTAGGG + Intergenic
1154332492 18:13441242-13441264 CACTAACACCCGAGGCTCTAAGG - Intronic
1155851141 18:30775511-30775533 CATTAAGATCCAAAGAAATATGG + Intergenic
1156873977 18:41983410-41983432 CCTGAAGCCCCAAAGCTCTTTGG + Intronic
1157232594 18:45932856-45932878 CAGCAGGATCCAAAGCTCTAGGG + Intronic
1158013715 18:52759863-52759885 AATGAAGACCCAAACCCCTAGGG + Intronic
1159232727 18:65629937-65629959 AATTGAGACCCAAAGATATAGGG + Intergenic
1159307930 18:66669863-66669885 GATTAAGTACCAAAGCTGTAAGG - Intergenic
1161143594 19:2664015-2664037 AGTTGAGACCCAATGCTCTAAGG + Intronic
1162056740 19:8068995-8069017 CATTGCGACCCAGAGCCCTAAGG + Intronic
1162846405 19:13396031-13396053 AATGAAGACCCAAAGCTGCAGGG - Intronic
1167063943 19:47170096-47170118 CATTAGAACCCAGAGCTCAATGG - Intronic
1167352734 19:48985787-48985809 CAGGAAAACCCAAAGCTCTGGGG - Intronic
929084250 2:38152456-38152478 CATTAAGACATGCAGCTCTAAGG + Intergenic
930717839 2:54609571-54609593 CATTACTACACAAAACTCTATGG - Intronic
930989244 2:57631069-57631091 CATCACTACCCAAAGCACTAGGG + Intergenic
931051212 2:58417035-58417057 CATGAAGACCCTTAGCCCTATGG - Intergenic
931448636 2:62348639-62348661 CATGAAGACCCAAAGATACAAGG - Intergenic
932020997 2:68086511-68086533 TTTTGAGACCCAAAGATCTATGG + Intronic
932818311 2:74879028-74879050 CACCAAGACCCTCAGCTCTATGG - Intronic
938150171 2:128875602-128875624 CTCTAAAACCCAAAGCTTTAGGG - Intergenic
938565629 2:132515915-132515937 AATGAAGACCCAAAGACCTAGGG - Intronic
939265808 2:139871516-139871538 CATCAAGACCCAAAGGTGCAGGG - Intergenic
942618956 2:177826922-177826944 CATTAAGAGACAAAGCTCTGTGG - Intronic
1169319036 20:4616116-4616138 AATGAAGACCCAAAGATATAGGG + Intergenic
1169495947 20:6115435-6115457 AATAAAGACACATAGCTCTATGG + Intronic
1170624147 20:18018710-18018732 CCTTCAGACCCAAGGCTCCAGGG + Intronic
1171994443 20:31721346-31721368 CATTAAGTCCCAAACCTGTGAGG - Intronic
1174091368 20:48051266-48051288 AAATAAGACCCAAATCTCTAGGG + Intergenic
1177206658 21:18017972-18017994 CATTAAATCACAAAGCTCCAAGG - Intronic
1178456557 21:32759299-32759321 CATTTACATCCAAAGGTCTATGG + Intronic
1182670571 22:31992097-31992119 CTTTAAGAACCACGGCTCTAGGG - Intergenic
950991359 3:17441605-17441627 CATTAAAACCATAAGTTCTATGG - Intronic
951047160 3:18052781-18052803 CAATAACAGACAAAGCTCTATGG - Intronic
951714969 3:25632474-25632496 CATTTAGACCCAAAACTTTTGGG + Exonic
951737326 3:25882294-25882316 AATTAAGGCCAAGAGCTCTATGG - Intergenic
956543425 3:70370935-70370957 ACTTAAGACCCAAAACTATATGG - Intergenic
957219468 3:77363526-77363548 AATGAAGACCCAAAGATGTAGGG + Intronic
957307069 3:78470798-78470820 AATGAAGACCCAAAGATATAGGG - Intergenic
958748455 3:98165491-98165513 CCTTATGACCTAATGCTCTAAGG + Intergenic
959800692 3:110491664-110491686 CCTTATGACCCAGAGCTGTATGG - Intergenic
965481282 3:169222610-169222632 CATTCAGCCCCAAAGCTGTCAGG + Intronic
965701840 3:171465940-171465962 CAATAAGAACCAGAGCTCTATGG + Intergenic
969922711 4:10555900-10555922 CATTACCATCCAGAGCTCTAAGG - Intronic
972704224 4:41525871-41525893 CATTAAACCCCAGAGCTCCAGGG - Intronic
973683691 4:53347650-53347672 CTTTAAGAGCCAAAGCCCTGAGG + Intronic
973851189 4:54963180-54963202 CTTGAACACCCAAAGCTCAAAGG + Intergenic
975105474 4:70564043-70564065 CCTTATGACCTAATGCTCTAAGG - Intergenic
975423838 4:74203015-74203037 TTTTAAAACACAAAGCTCTATGG + Intronic
975864579 4:78713701-78713723 AATGAAGACCCAAAGATATAGGG - Intergenic
978107004 4:104915607-104915629 GATTGAGAACCAAAGCTGTAGGG - Intergenic
979118943 4:116867911-116867933 CTTTAATATCCAAAGCTATATGG + Intergenic
980270807 4:130581518-130581540 CATGAAGACCCAAAGATAGAGGG - Intergenic
980472952 4:133273420-133273442 AATGAAGACCCAAAGATATACGG + Intergenic
981921279 4:150087548-150087570 AATTAAGACCCAAAGATACAGGG + Intronic
982080771 4:151787324-151787346 AATAAAGACCCAAAGACCTAAGG - Intergenic
982172566 4:152675965-152675987 CATTACGACCAAATACTCTAAGG - Intronic
982560759 4:156926253-156926275 CATTAAGATCCTAAGCACTTAGG - Intronic
982990928 4:162272874-162272896 CATTTAGACACACAACTCTAAGG - Intergenic
984056537 4:174937178-174937200 CATTGAGAAAGAAAGCTCTATGG - Intronic
985296044 4:188438446-188438468 CCCTAAGACCTAATGCTCTAAGG - Intergenic
985423294 4:189805235-189805257 CATTTAGACCACAAGCTCTTGGG + Intergenic
986185403 5:5431371-5431393 CAGTAGGCCCCAAAGCTCGAAGG - Intronic
986754929 5:10826651-10826673 AACTAAGACCCAGACCTCTAAGG - Intergenic
987561747 5:19532643-19532665 GATTAAGACCCAAAGCCCAAAGG + Intronic
987918387 5:24246937-24246959 CTTTTATATCCAAAGCTCTATGG + Intergenic
988132076 5:27119695-27119717 CAGTATGACCTAATGCTCTAAGG - Intronic
989558314 5:42822477-42822499 AATTAAGACCCAAAGATACAGGG - Intronic
992258283 5:74944223-74944245 AATGAAGACCCAAAGATCCAAGG + Intergenic
992759790 5:79940966-79940988 AATGAAGACCCAAAGGTCCAGGG - Intergenic
996233224 5:121092155-121092177 CATTTATAACCAAAGCTCAAGGG + Intergenic
996662410 5:126020086-126020108 AATGAAGACCCAAAGATCCAGGG + Intergenic
1004755994 6:18610958-18610980 CATTGAGACCAAAAGATCAAGGG - Intergenic
1007286639 6:40752665-40752687 CAACAAAACCCAAATCTCTAGGG - Intergenic
1008188762 6:48428082-48428104 AATTAAGACCCAAAGAGATAAGG + Intergenic
1009903898 6:69844625-69844647 TTTTCAGACCTAAAGCTCTATGG - Intergenic
1010564945 6:77399445-77399467 CATCAGGAGCCAAAGCTTTAAGG + Intergenic
1010976957 6:82325969-82325991 CTTCAAGTCCCAAAGCTTTATGG + Intergenic
1011649404 6:89492010-89492032 AATAAAGACCCAAAGCAATAGGG - Intronic
1014832824 6:126122742-126122764 AATTAAAACCCAAAGATATAGGG - Intergenic
1015100973 6:129479889-129479911 CATTAAGAACTAAAACTGTAAGG + Intronic
1015836486 6:137425903-137425925 AATGAAGACCCAAAGATCCAGGG + Intergenic
1016578697 6:145602533-145602555 CATTATGACACAAAGCTGCAGGG - Intronic
1018695883 6:166391102-166391124 AATAAAGACCCAAAGATCTGGGG + Intergenic
1023679436 7:42669673-42669695 AATTATGAGACAAAGCTCTAAGG + Intergenic
1023864798 7:44233573-44233595 CAGCAAGCCCCAAAGCTCTTAGG + Intronic
1028047078 7:86134835-86134857 CATTAAGACACAAAGTTATTTGG + Intergenic
1029274630 7:99396812-99396834 CTTTCAGACCTAAAGTTCTAGGG - Intronic
1030396703 7:108995260-108995282 AATGAAGACCCAAAGCCCCAGGG + Intergenic
1033709747 7:143930196-143930218 CAGTAAGACCCAAAGTTCCCAGG + Intergenic
1035084285 7:156244430-156244452 AAATAAGACCCAATGATCTATGG - Intergenic
1038811509 8:30851139-30851161 TATAAATACCCAAAGTTCTATGG + Intronic
1042134633 8:65621224-65621246 AATTAAGCCCTAAAGCCCTAAGG - Intronic
1043578786 8:81688127-81688149 AATGAAGACCCAAAGGTATAAGG - Intergenic
1046154458 8:110269159-110269181 TTTTAAGAACCCAAGCTCTATGG - Intergenic
1047355077 8:124112628-124112650 CATCAACAACCAAAACTCTAAGG + Intronic
1048440461 8:134455741-134455763 CATTAAGACCCTAAACACTGGGG + Intergenic
1051876200 9:21796419-21796441 AATGAAGACCCAAAGATCCAGGG + Intergenic
1051986832 9:23099178-23099200 GATGAAGACCAAAAACTCTAGGG - Intergenic
1055393416 9:75847693-75847715 CAGTAAGTTACAAAGCTCTATGG - Intergenic
1055777164 9:79778934-79778956 AATGAAGACCCAAAGATCAAAGG - Intergenic
1057380245 9:94560921-94560943 CTTTAAGAGCCAGAGGTCTAGGG - Intronic
1059522878 9:114960364-114960386 CATTAACTTCCAAAGCTCTTTGG + Intergenic
1059994493 9:119895643-119895665 CATTAAGAACATAAGCTCTCAGG - Intergenic
1060092717 9:120758310-120758332 GATTAACACCCAAAGCGCAAGGG + Exonic
1187446507 X:19365460-19365482 CATGAAGACCCAAAGATCCAGGG - Intronic
1188529188 X:31119837-31119859 AAAGAAAACCCAAAGCTCTAAGG - Exonic
1190429561 X:50366068-50366090 CATTAAGACCCAAAGCTCTAGGG - Exonic
1193430403 X:81395433-81395455 CATTAAGACTGAATGCTTTATGG - Intergenic
1194683634 X:96884409-96884431 TATTAAGACCCAAAGACCTAAGG + Exonic
1198739832 X:139830150-139830172 GATTAAGAGTCAAAGATCTATGG - Intronic
1200492829 Y:3849631-3849653 CATTATCACCCAAAGGCCTAGGG + Intergenic