ID: 1190429712

View in Genome Browser
Species Human (GRCh38)
Location X:50367507-50367529
Sequence CCCTCTGTACTCAAGGGAAA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 191}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190429707_1190429712 4 Left 1190429707 X:50367480-50367502 CCATGTTTTTTCTGATCACTTCA 0: 1
1: 0
2: 1
3: 40
4: 412
Right 1190429712 X:50367507-50367529 CCCTCTGTACTCAAGGGAAAAGG 0: 1
1: 0
2: 0
3: 19
4: 191
1190429704_1190429712 21 Left 1190429704 X:50367463-50367485 CCTTCATTTCTCCAGGCCCATGT 0: 1
1: 0
2: 2
3: 32
4: 431
Right 1190429712 X:50367507-50367529 CCCTCTGTACTCAAGGGAAAAGG 0: 1
1: 0
2: 0
3: 19
4: 191
1190429705_1190429712 10 Left 1190429705 X:50367474-50367496 CCAGGCCCATGTTTTTTCTGATC 0: 1
1: 0
2: 3
3: 29
4: 323
Right 1190429712 X:50367507-50367529 CCCTCTGTACTCAAGGGAAAAGG 0: 1
1: 0
2: 0
3: 19
4: 191
1190429706_1190429712 5 Left 1190429706 X:50367479-50367501 CCCATGTTTTTTCTGATCACTTC 0: 1
1: 0
2: 5
3: 38
4: 358
Right 1190429712 X:50367507-50367529 CCCTCTGTACTCAAGGGAAAAGG 0: 1
1: 0
2: 0
3: 19
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190429712 Original CRISPR CCCTCTGTACTCAAGGGAAA AGG Exonic
900795147 1:4703314-4703336 CCCCCTCTACTCAGGGGACATGG - Intronic
901380344 1:8869462-8869484 CATTCTGTACACGAGGGAAAAGG - Intronic
904009109 1:27379968-27379990 CCCTGGGTACTGAAGGGGAACGG + Exonic
904394265 1:30207737-30207759 CCCTCTCCACTCAAGGCAGATGG + Intergenic
906379062 1:45320140-45320162 CCCTCCCTACTCAAGGCAAATGG + Intergenic
907230812 1:52996674-52996696 CCTTCTCTAATCAGGGGAAAGGG - Intronic
908237517 1:62161172-62161194 CCCTCTCTGCTCAGGAGAAATGG + Exonic
908868164 1:68576070-68576092 CCCTCTGCTCTCAAGGCCAAGGG + Intergenic
912159971 1:106970310-106970332 CCAACTGTTCTCATGGGAAATGG - Intergenic
915336696 1:155147569-155147591 GCCTCTGTACTGAAGATAAAAGG + Intergenic
919847920 1:201653262-201653284 CCTTCTGTCCTCCAGGAAAAGGG + Intronic
922135596 1:222822230-222822252 CCTTCTGAACACAAGTGAAATGG - Intergenic
922325524 1:224524823-224524845 ACCACTGTGATCAAGGGAAAGGG - Intronic
922368833 1:224889931-224889953 CCCTTCCTACTCAAGGCAAATGG + Intergenic
1065908816 10:30283553-30283575 CCCTGTGTCCTAATGGGAAAGGG + Intergenic
1070337935 10:75471451-75471473 CCCTCTGATCTTCAGGGAAATGG + Intronic
1073935938 10:108631967-108631989 CTCTCTTTACTCAAGCTAAAAGG + Intergenic
1074369851 10:112891468-112891490 CCTTTTTTTCTCAAGGGAAACGG + Intergenic
1074562103 10:114543957-114543979 CCCTCTGTGCTTCATGGAAAGGG + Intronic
1076686936 10:132202420-132202442 CCCTTTGTCCTCGAGAGAAACGG + Intronic
1079595098 11:22234634-22234656 CCCTTTGTACTCCAAGAAAAAGG + Intronic
1080139106 11:28893258-28893280 ACCTCTGTACTCAAGGCAGTAGG - Intergenic
1080386127 11:31812085-31812107 CCCTCTGTACACAAAGTAAGTGG - Intronic
1080596438 11:33777774-33777796 CCCTCTCTACTCCTGAGAAAAGG - Intergenic
1080797999 11:35583284-35583306 CCCTCTATACACAGGGGACAGGG + Intergenic
1080994185 11:37580257-37580279 CCCTCCTTACTCAAGGCAAATGG - Intergenic
1081667216 11:44923570-44923592 TCCTCTGTGCTTAAGGGAAAGGG - Intronic
1084668627 11:70592217-70592239 CCCTCTGCACGCAGGGGACAGGG + Intronic
1087693441 11:101348407-101348429 CCCCCTGTACTTCAGGAAAAGGG + Intergenic
1089093496 11:115898402-115898424 CACTCTGTTCTCAATCGAAAAGG + Intergenic
1091653556 12:2327411-2327433 CCCTTTCTACTCAAAGAAAATGG + Intronic
1091715792 12:2775290-2775312 CCCCCTGGACTCTAGGGAAAAGG - Intergenic
1092148350 12:6230199-6230221 CCCTCTCTAGTCACGGGAAAAGG - Intronic
1095751855 12:45721403-45721425 CCTACTGAACTGAAGGGAAAGGG - Intergenic
1104046581 12:125167528-125167550 CCCTCTAGACTGAGGGGAAATGG + Intergenic
1106605880 13:31228300-31228322 CCTTCTGAACTCATGGGAGATGG + Intronic
1107460411 13:40596713-40596735 CGCTCTGTTCTCAATGAAAACGG + Intronic
1110755656 13:79171203-79171225 CCCTTAGCACTGAAGGGAAAAGG + Intergenic
1111957254 13:94773176-94773198 CACTGTGTAAACAAGGGAAACGG + Intergenic
1113015280 13:105822283-105822305 CACACTGTGCTCAGGGGAAAGGG + Intergenic
1113125622 13:106975697-106975719 GCCTGTGTAGTCAAGTGAAAAGG - Intergenic
1113235882 13:108273469-108273491 CCCTTTGTAGTCTAGAGAAATGG + Intronic
1115887254 14:37986222-37986244 CCCTCTGCCCTCTGGGGAAAAGG - Intronic
1117926938 14:60791084-60791106 ATATTTGTACTCAAGGGAAAAGG - Intronic
1118005669 14:61562541-61562563 CCATTTGTACTCAAGGTCAAGGG + Intronic
1118331254 14:64817694-64817716 CCTCCTGTACATAAGGGAAAAGG + Intronic
1118806990 14:69246469-69246491 TACACAGTACTCAAGGGAAAGGG - Intergenic
1118887369 14:69878620-69878642 CCCTCTGAACTGGAGGGCAAGGG - Intronic
1119800552 14:77441202-77441224 CCCTCTATACACAAGATAAATGG + Intronic
1119851672 14:77870838-77870860 CCCTCTCTTCTCCAGGGAGAAGG + Intronic
1120307631 14:82790604-82790626 CCCTCACTACTCCAGGGAAAAGG - Intergenic
1122671503 14:103376235-103376257 CCCACTGTACTCCAGCGACAGGG + Intergenic
1123684597 15:22787664-22787686 CCCTCTGGAAGCAATGGAAACGG - Intronic
1125155158 15:36577738-36577760 CACTCTGTACAAAAGGGAAGAGG + Intergenic
1128548528 15:68583301-68583323 CCCTCATTTCTCAAGGGAAAGGG - Intronic
1128786524 15:70401507-70401529 ACCTTTGCACACAAGGGAAATGG - Intergenic
1130767931 15:86891695-86891717 CCTTCTCTACTCAAGTGACATGG + Intronic
1133931316 16:10234592-10234614 ACATCTGTTCTCATGGGAAAGGG - Intergenic
1134365957 16:13579393-13579415 CCCTCTGTCAGCAAGGGCAAAGG + Intergenic
1134835923 16:17360605-17360627 CCCTCTGCACACACTGGAAATGG + Intronic
1134846740 16:17446936-17446958 ACCTCTGGACTCAAGGGAAGAGG + Intronic
1138784036 16:59824759-59824781 CTCTGTGTACTCCAGTGAAAGGG + Intergenic
1140789884 16:78381392-78381414 GCCACTATATTCAAGGGAAATGG + Intronic
1144248253 17:13389416-13389438 CTCTTTGGACTGAAGGGAAATGG + Intergenic
1145297022 17:21600084-21600106 CTGTTTGTACTCAAGGCAAATGG + Intergenic
1145366938 17:22272818-22272840 CTGTTTGTACTCAAGGCAAATGG - Intergenic
1148124792 17:45231098-45231120 TCCTCTGGACCCAAGGCAAAAGG - Intronic
1149256296 17:54831178-54831200 CCCTGTGTAGAGAAGGGAAAAGG - Intergenic
1151503096 17:74505057-74505079 CCCTCTCCACTCAAGGCAGATGG + Intergenic
1155741220 18:29290496-29290518 CTCTATGTATTCAAGTGAAAGGG + Intergenic
1156082851 18:33360317-33360339 CCCTCTGTACTATAGACAAAGGG + Intronic
1157613637 18:48974752-48974774 CACTCTGTACTTAATGGAACTGG + Intergenic
1158684515 18:59600931-59600953 CCCTCTGAAAGCAAGGGAAATGG - Intronic
1158825407 18:61213073-61213095 CCATCTGCACTCAAGGGAAGAGG + Intergenic
1159929488 18:74296471-74296493 CCCTCCCCACTCAAGGTAAATGG + Intergenic
1162273808 19:9637401-9637423 CCCTTCCTACTCAAGGCAAATGG - Intronic
1162287053 19:9746676-9746698 CCCTTCCTACTCAAGGCAAATGG + Intergenic
1163953215 19:20610422-20610444 CCCTCTGTTCTCCAGTCAAAGGG + Intronic
1164146663 19:22516938-22516960 TCCCCTGTATTCAAGAGAAAAGG + Intronic
1164220382 19:23187942-23187964 CCCTCCCCACTCAAGGCAAATGG + Intergenic
1165729810 19:38137828-38137850 CCATCAGTACCTAAGGGAAAAGG + Intronic
1168335857 19:55597486-55597508 CCCACTGTACTCTGGGCAAAAGG - Intronic
1168540609 19:57206680-57206702 CCTTCTGAACTCTAGGGAATAGG + Intronic
1168580522 19:57552001-57552023 CTTTCTGGACTCAAGAGAAAGGG - Intronic
926777224 2:16434544-16434566 CCTTCTGTACTCCATGGCAATGG - Intergenic
929546385 2:42857507-42857529 GCCTCTGTCCTCTGGGGAAATGG + Intergenic
930253304 2:49060508-49060530 CACTCTGCATTCCAGGGAAATGG + Intronic
930404156 2:50932564-50932586 CTCTGGGGACTCAAGGGAAAGGG + Intronic
930423538 2:51183468-51183490 CCTTGGGTACTCAGGGGAAAGGG + Intergenic
930733098 2:54747068-54747090 TCCTGTGAACACAAGGGAAAAGG - Intronic
932029572 2:68169613-68169635 CCATTTGTAGTCAAGAGAAATGG - Intronic
933841703 2:86292171-86292193 GTCTCTGTACTCAAGGAAACTGG - Intronic
936876613 2:117197390-117197412 TCCTCTGTGCTCAAAGGAAGTGG + Intergenic
937698587 2:124837555-124837577 CCCTCTTTTATCCAGGGAAAGGG + Intronic
939341277 2:140898436-140898458 CCCTCGGTACTCAAGTGGAATGG + Intronic
939430584 2:142100884-142100906 TCCTCTGTTCTCAAAGCAAAAGG - Intronic
942801206 2:179878367-179878389 TCCTCTTTACTCTAGGAAAAGGG + Intergenic
944189370 2:196984910-196984932 CAATCTATACTCAAGGGCAAGGG - Intronic
945510594 2:210697617-210697639 CCCTCTGCACTCAAAGGCGATGG - Intergenic
945543367 2:211117730-211117752 CCCTATGGACCCAAGGTAAATGG + Intergenic
946339278 2:219057831-219057853 CCCTCTGTTCCTAAGGGAGAGGG - Intronic
947005464 2:225506307-225506329 CCATTTGTACTCAAGGCCAATGG + Intronic
1168904187 20:1390994-1391016 CCATCTGTTCTCATAGGAAAAGG + Intronic
1169790203 20:9402141-9402163 CCCCCTGTAGTTTAGGGAAAGGG + Intronic
1170062202 20:12271074-12271096 CCCTCTCTCATCAAAGGAAAGGG - Intergenic
1170680083 20:18518615-18518637 CCCTCTCCACTCAAGGCAGATGG - Intronic
1170928038 20:20743713-20743735 GCCTGTTTACTCAAGCGAAAGGG + Intergenic
1171099227 20:22366976-22366998 CCCTCTGTATACAAAGGAAGGGG - Intergenic
1173546803 20:43903959-43903981 GCCTCTGTACCCAAGAGCAAGGG - Intergenic
1177343280 21:19833963-19833985 CTCTCTGCATTCAAAGGAAAGGG + Intergenic
1177737652 21:25112775-25112797 CTCTGGGGACTCAAGGGAAAGGG - Intergenic
1178917281 21:36713287-36713309 CCCTCTTTCCTCTAAGGAAACGG - Intronic
1180055978 21:45359483-45359505 CCCTCTGTCCTCATGGGCACCGG + Intergenic
1180336154 22:11578451-11578473 CCCTGTGTCCTCGAGGGAGAAGG + Intergenic
1181840819 22:25658875-25658897 TCCTCTGTACTCCAGCCAAACGG - Intronic
1182170170 22:28220743-28220765 CCATCCATACTCAAGGGAAACGG + Intronic
1182510383 22:30815428-30815450 TCCTCTGTCCTCTTGGGAAAGGG + Intronic
1182855988 22:33518033-33518055 CCCTCTCTTCTCAAGGCAATGGG + Intronic
1183241831 22:36663368-36663390 CCCTCTATACTCAGGGAAATTGG + Intronic
1184370362 22:44078037-44078059 CCCCCTGTCCTCAAGGGACCTGG - Intronic
1185288126 22:50011307-50011329 CCCTCAGTACTCCAAGGAAAGGG - Intronic
951706831 3:25552125-25552147 CCCTCTGTAGTCAAGGTACATGG + Intronic
953511342 3:43543015-43543037 CACTCTGAAGTCAAGGGAATGGG + Intronic
956134216 3:66083026-66083048 GCACCTGTACTCAAGGGACAGGG - Intergenic
960226225 3:115172392-115172414 CACACCATACTCAAGGGAAAGGG - Intergenic
962021898 3:131510616-131510638 CCCTCTCTACTCAAGGCAGATGG - Intergenic
962926236 3:139995728-139995750 CCATCTGTGCTCAGGGGTAAAGG + Intronic
963854862 3:150242960-150242982 CCCTCTGTGCTGAATAGAAAGGG + Intergenic
964605352 3:158554962-158554984 CCCTCTGTCCTCCGGAGAAAAGG + Intergenic
967947954 3:194818966-194818988 TCCTCTTAACTCAAGGGACATGG - Intergenic
969844991 4:9913611-9913633 CCCTCTCAACCCAAGGGACAGGG + Intronic
972368309 4:38396370-38396392 CCTTCTGCTATCAAGGGAAAGGG + Intergenic
973637002 4:52869805-52869827 ACCTCTGCACCCAGGGGAAATGG + Intergenic
973821665 4:54667136-54667158 CCCTGAGTAATCAAGAGAAAAGG - Intronic
975800315 4:78054830-78054852 CCCTAAGTAGTCAAGGGAGAAGG - Intergenic
978802880 4:112771960-112771982 CACTCTGTACCCAGAGGAAAGGG - Intergenic
980544252 4:134237484-134237506 CTTTCAGGACTCAAGGGAAAGGG - Intergenic
982319183 4:154061141-154061163 CCCTCCCCACTCAAGGCAAATGG + Intergenic
983018128 4:162640234-162640256 CCCTCTGCCAGCAAGGGAAAGGG - Intergenic
983257677 4:165419339-165419361 CCTTCAGTTCTCAAGGGAAAAGG - Intronic
985856847 5:2435029-2435051 CCCTCAGTACTAACTGGAAAAGG - Intergenic
988385653 5:30561231-30561253 CCTTGTGAACTCAGGGGAAAGGG + Intergenic
989614827 5:43329162-43329184 CCCTCCCCACTCAAGGCAAATGG - Intergenic
990531261 5:56675634-56675656 GCCTCTTTGCTCAAAGGAAAAGG + Intergenic
992811085 5:80389408-80389430 CCGTCTGTCCTAAAGGGAAGTGG - Intergenic
993252856 5:85550410-85550432 CCCTGTGTCCTCAAGGGTCATGG + Intergenic
995246315 5:109939333-109939355 CCCTACGTACTCAAGGGAAGGGG + Intergenic
995989933 5:118225530-118225552 CTGTCTGTACTCATGTGAAAAGG - Intergenic
996024374 5:118628834-118628856 CCCCCTTTGCTCCAGGGAAAGGG + Intergenic
996899196 5:128524123-128524145 CCCACTTTACTCCAGGGACATGG + Intronic
997157686 5:131576729-131576751 CCCTTCCTACTCAAGGCAAATGG + Intronic
998885592 5:146690804-146690826 CCTTCTGTACTGAAGGTACAGGG - Intronic
999692347 5:154159049-154159071 CTTTCTGAACTCAAGGGAGAAGG - Intronic
999785549 5:154886756-154886778 CACTCTTTACTCAAGTGGAAGGG + Intergenic
999977745 5:156928620-156928642 TCCTTTGTACTTAAGGCAAAAGG + Intronic
1000895573 5:166851088-166851110 CCCTTTGTACTCAAGAAAATGGG + Intergenic
1003038292 6:2664111-2664133 CCGTCTGTCCTAAAGGGAAGTGG - Exonic
1003171486 6:3724840-3724862 CCCGCTGACCTCAAGGGACAGGG + Intronic
1006580398 6:35073812-35073834 CCCTCTTTACTCAGGGAGAAGGG - Intronic
1006946416 6:37787342-37787364 CCCTCTGTCCTCAGAGGAAGTGG - Intergenic
1007662644 6:43496114-43496136 CCCTCTGTAGAGAAGGGGAAAGG + Intronic
1008106860 6:47448568-47448590 CCCTCTGTAAACCAGGAAAAGGG + Intergenic
1008250814 6:49237871-49237893 TCCTCCTTACTCTAGGGAAAGGG + Intergenic
1008324730 6:50163840-50163862 CCCTGTGAACTCAAGATAAAAGG + Intergenic
1012179429 6:96133094-96133116 CCCTGGGGACTCCAGGGAAAGGG - Intronic
1016848608 6:148593840-148593862 TCCTCTGAATGCAAGGGAAATGG - Intergenic
1018100136 6:160430689-160430711 CACTCTCTATTCATGGGAAAAGG - Intronic
1019898162 7:3999234-3999256 TGCTCTGTACCCAAGGGAATGGG - Intronic
1020215497 7:6186969-6186991 ACCTCTGTCCAAAAGGGAAACGG + Intronic
1020564536 7:9778712-9778734 CCCTCTGCCATCAAGGGCAAAGG + Intergenic
1020794548 7:12664157-12664179 CCCTCTCCACTCAAGGCAGATGG + Intergenic
1022254289 7:28640801-28640823 CCCTCAGTACTCTAGGGAAGCGG - Intronic
1022545154 7:31180346-31180368 CCCTCTGTGCGGAAAGGAAAAGG - Intergenic
1029618272 7:101673663-101673685 CCCTATGTATTCAAGGGGAGGGG + Intergenic
1033625878 7:143109150-143109172 CCCTCTCCACTCAAGGCAGATGG + Intergenic
1035867513 8:3100872-3100894 CCCTCTGTGAACTAGGGAAAAGG + Intronic
1035917867 8:3644631-3644653 CCCTCTTTACTGAAGGTAATAGG - Intronic
1036460271 8:8946441-8946463 CCCTCTGTATTGACAGGAAAAGG - Intergenic
1036991729 8:13605645-13605667 CTCTCTGTACTCCAGGTACATGG + Intergenic
1037801350 8:22037544-22037566 CCCTCTGCACACCAGGGAGAGGG - Intergenic
1042945162 8:74146816-74146838 TCCTCTGTGCTCTAGGGAGAAGG + Intergenic
1043823264 8:84894620-84894642 CCATCTGTTCTCAACAGAAATGG + Intronic
1050687860 9:8191357-8191379 CCCTCTGTACTCCATGGATCAGG + Intergenic
1051547974 9:18297749-18297771 TCCTCTTAACTGAAGGGAAAGGG + Intergenic
1052201074 9:25781021-25781043 TCTTCTGTACTGAAGGAAAAGGG - Intergenic
1053826274 9:42028021-42028043 CCTTCTGTACTAAAGGAAGATGG + Intronic
1054604286 9:67159376-67159398 CCTTCTGTACTAAAGGAAGATGG - Intergenic
1055635430 9:78272991-78273013 CCCTCTCTTCTCATGGCAAATGG - Intronic
1056707192 9:88961175-88961197 CCTGCTGTAATCAAGTGAAAAGG + Intergenic
1058483674 9:105422200-105422222 CCCTCTGTACTGCACAGAAAGGG + Intronic
1058747629 9:108007366-108007388 GCCTCTCTTCTCAAGGGAAGGGG + Intergenic
1061099844 9:128484326-128484348 TCCTCATTACCCAAGGGAAAGGG + Intronic
1187103447 X:16218201-16218223 CCCTCTCCACTCAAGGCAGATGG - Intergenic
1188243864 X:27819122-27819144 CCCTCTGTAGTCCAGGGATATGG + Intronic
1189260742 X:39677163-39677185 CCCACTGGACTCAAAGGGAAGGG + Intergenic
1190429712 X:50367507-50367529 CCCTCTGTACTCAAGGGAAAAGG + Exonic
1190480930 X:50876039-50876061 CCATCCATATTCAAGGGAAAAGG + Intergenic
1191013879 X:55789712-55789734 CCCTCTCCACTCAAGGCAGATGG - Intergenic
1191164441 X:57372881-57372903 CTCTCGGGACTCGAGGGAAAGGG - Intronic
1192454997 X:71269126-71269148 CCCTCCCCACTCAAGGCAAATGG + Intergenic
1192700845 X:73470047-73470069 GTTTCTGTTCTCAAGGGAAATGG + Intergenic
1192913781 X:75633372-75633394 CCCTCCCCACTCAAGGCAAATGG - Intergenic
1195615236 X:106906660-106906682 CCCTCTCTTCTCAGGGGACAAGG + Intronic
1196216523 X:113058665-113058687 TCCTATTTACTCAAGAGAAAGGG - Intergenic
1196399586 X:115300091-115300113 CCCTCTCTTCTCAAGTGGAAGGG + Intronic
1198336233 X:135669313-135669335 CCCTCTGTCAGCAAGGGCAAAGG - Intergenic
1198363394 X:135917340-135917362 CCCTCTGTCAGCAAGGGCAAAGG + Intergenic
1199241944 X:145557111-145557133 TCCTATAAACTCAAGGGAAAGGG + Intergenic
1200009249 X:153108908-153108930 ACCTCTGTGCTCCAGGGCAATGG - Intergenic
1200030351 X:153291014-153291036 ACCTCTGTGCTCCAGGGCAATGG + Intergenic
1200973792 Y:9184927-9184949 CACTCTGCACTCCAGGCAAAGGG - Intergenic