ID: 1190431276

View in Genome Browser
Species Human (GRCh38)
Location X:50379854-50379876
Sequence CCTTCCTCCCATGAGCTGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 456
Summary {0: 1, 1: 0, 2: 3, 3: 36, 4: 416}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190431274_1190431276 3 Left 1190431274 X:50379828-50379850 CCATTACATGGAAATCTATCTTC 0: 1
1: 0
2: 0
3: 20
4: 215
Right 1190431276 X:50379854-50379876 CCTTCCTCCCATGAGCTGTGAGG 0: 1
1: 0
2: 3
3: 36
4: 416

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190431276 Original CRISPR CCTTCCTCCCATGAGCTGTG AGG Intronic
900184515 1:1326743-1326765 GCTTCCTCCCAGGAGCTGCCTGG - Intronic
900403041 1:2480480-2480502 CCTGCCTGCCATAGGCTGTGGGG - Intronic
901235661 1:7666351-7666373 CCTGCGTCCTATGACCTGTGTGG - Intronic
901536243 1:9884363-9884385 CCCTCCTCCCTTGAGCTGTGGGG - Intronic
902374548 1:16024155-16024177 CCTTCCTCCTCTGAGCTCTCTGG + Intronic
902400376 1:16154006-16154028 CCTGCATCCCATGGGGTGTGGGG + Intronic
903327342 1:22576989-22577011 CCATCTTCCCAGGGGCTGTGTGG - Intronic
903330516 1:22594746-22594768 CCTCCATCCCATGTACTGTGTGG + Intronic
903463459 1:23535334-23535356 CCTTCCTCCCCTGAGATGCCAGG + Intergenic
903474764 1:23612011-23612033 CCCACCCCCTATGAGCTGTGTGG - Intronic
903490827 1:23726905-23726927 TCTGCCTCCAATTAGCTGTGTGG + Intergenic
904342441 1:29845588-29845610 ACTTCATCCCATGAGCAGCGAGG - Intergenic
904566089 1:31429190-31429212 CAGTCCTCCCATGAGATGGGAGG + Intronic
905444533 1:38017692-38017714 CCTTCTTCCGAAGAGCTTTGAGG - Exonic
906248509 1:44293761-44293783 CCTTCCTCAAAGAAGCTGTGTGG - Intronic
907158238 1:52353633-52353655 CCTTCCATCCAGGACCTGTGAGG + Exonic
907430862 1:54410453-54410475 CCATCCTCCTAGCAGCTGTGAGG - Intronic
907713142 1:56903205-56903227 GATTCCTCCCATGAGACGTGGGG - Intronic
908992295 1:70106805-70106827 CCTTCTTCCCCTTACCTGTGTGG + Intronic
909068048 1:70960127-70960149 GGTTTCTTCCATGAGCTGTGAGG - Intronic
909229151 1:73062813-73062835 AATCCCTCCCATGACCTGTGGGG - Intergenic
910278100 1:85469284-85469306 CCTTCATCACATCAGCTGTGGGG + Intronic
911165575 1:94721467-94721489 GCTTCCTCCCCCGTGCTGTGGGG - Intergenic
911798913 1:102109509-102109531 GCTCCCTCCCATGAGACGTGGGG + Intergenic
912135665 1:106657524-106657546 CCTTGCTCCCTTGACATGTGGGG - Intergenic
912222940 1:107698940-107698962 CCTCCCTCCCTTGATATGTGGGG + Intronic
912475332 1:109931093-109931115 CCTTCCTCCCCTGTGTTTTGTGG - Intergenic
913511971 1:119570409-119570431 GCCGCCTCCCCTGAGCTGTGTGG - Intergenic
913516194 1:119607572-119607594 GCCGCCTCCCCTGAGCTGTGTGG - Intergenic
915283494 1:154838405-154838427 CCTTCATCCCAGAGGCTGTGGGG - Intronic
915635272 1:157181913-157181935 CCTTCCTCCCTTGAGGGCTGAGG - Intergenic
917486203 1:175456940-175456962 CCTTTCTCCCAATTGCTGTGGGG + Intronic
917497645 1:175555854-175555876 CCTTCCAACCATGAGTTGTGTGG + Intronic
917762113 1:178173119-178173141 CCTTCCTCCCCAGTGTTGTGGGG + Intronic
917894356 1:179473680-179473702 CCTTCCTCCATTGACATGTGGGG - Intronic
918565567 1:185926555-185926577 CTTACCTCCCAGGAACTGTGTGG - Intronic
920266530 1:204727993-204728015 CCTTTCTCCCATGGGCTGTGTGG + Intergenic
920897167 1:210065256-210065278 GGTTCCTCCCATGACATGTGGGG - Intronic
922161283 1:223080633-223080655 CCTTCCCCCCCAGGGCTGTGAGG - Intergenic
922712441 1:227844327-227844349 CCTACCCCCCATGAGTGGTGAGG + Intronic
923420523 1:233810441-233810463 CCTTCCACCCATGAGCCATCTGG - Intergenic
923961603 1:239090837-239090859 CCTCCCTCCCTTGACATGTGGGG - Intergenic
1063078528 10:2741584-2741606 CCTCCCTCCCTTGACATGTGGGG - Intergenic
1063520832 10:6739220-6739242 CATCCCACACATGAGCTGTGGGG + Intergenic
1063529206 10:6814652-6814674 CATGCCTCGCAAGAGCTGTGGGG - Intergenic
1064034287 10:11902693-11902715 CTTTCTTCCCTTGAGCAGTGGGG + Intergenic
1066018360 10:31271077-31271099 CCTTCCTCCACTGAGGAGTGTGG - Intergenic
1067810070 10:49419206-49419228 CATTCCTGCCAAGGGCTGTGGGG + Intergenic
1068030363 10:51698405-51698427 CCTTCCTCACATGAGATGAGGGG - Exonic
1068600602 10:58952665-58952687 CCTTCCACCGATTAGCTGTATGG + Intergenic
1069046667 10:63750601-63750623 CCTGCCTCCCTTGACATGTGGGG + Intergenic
1070064265 10:73018208-73018230 CCTGCATCCCATGAGATGTCTGG + Intronic
1071266344 10:83968143-83968165 ACTCCCTCCCATGATATGTGGGG + Intergenic
1071673391 10:87632526-87632548 GCTCCCTCCCATGACATGTGGGG + Intergenic
1073118482 10:101107040-101107062 CCTGCCTCCCAGTTGCTGTGGGG - Intronic
1073487273 10:103827460-103827482 TCCACCACCCATGAGCTGTGTGG + Intronic
1076405132 10:130206632-130206654 CCTGCCTGCCTTGTGCTGTGTGG + Intergenic
1076732397 10:132445257-132445279 GTTTCCTCCCAGGAGCTGAGAGG + Exonic
1076795117 10:132794609-132794631 CCCTCTGCCCAGGAGCTGTGGGG + Intergenic
1076798164 10:132808757-132808779 CCTGCCTCCCATCAGCTGCTGGG - Exonic
1077231803 11:1461131-1461153 CCTTCCTCCCACGGGCCGTGCGG - Exonic
1077340590 11:2024683-2024705 CCTTCCTCCAAGGTGCTCTGGGG + Intergenic
1077895434 11:6449980-6450002 CTCTCCTCCCAAGAGCTATGGGG - Intronic
1079130145 11:17742488-17742510 ACTGCCTCCCATCAGCTCTGGGG + Intronic
1079480628 11:20876164-20876186 CCTTCTTCCCATGCTCTATGTGG + Intronic
1079783912 11:24646017-24646039 TCTGCCTCTCATGAGTTGTGTGG + Intronic
1080288309 11:30641481-30641503 CCTTTCTCCCAGCACCTGTGAGG + Intergenic
1081176870 11:39938168-39938190 CCTTCCTGCCATGTGCTATGAGG - Intergenic
1081641040 11:44754726-44754748 CCTGACTCCTCTGAGCTGTGCGG + Intronic
1081795930 11:45819510-45819532 GCCTCCTCCCATGAGAGGTGGGG - Intergenic
1083831546 11:65236775-65236797 CCTGCCACCCGTGAGCTTTGGGG + Intergenic
1084206913 11:67600453-67600475 CCATCCTCCCAGCAGCTGAGGGG + Intergenic
1084436151 11:69141789-69141811 GGTACCTCCCATGACCTGTGGGG - Intergenic
1084524404 11:69686769-69686791 CCTTCTCCCCATGAGTTGTGTGG - Intergenic
1085261561 11:75208416-75208438 CCTATCTCCCAGAAGCTGTGAGG + Intergenic
1085445198 11:76596813-76596835 GCTTCCTCCCGAGAGCTGAGAGG - Intergenic
1087609472 11:100416781-100416803 ACTTCCTTCTAAGAGCTGTGAGG + Intergenic
1087989331 11:104729056-104729078 CATTCTTCCCATGACATGTGAGG - Intergenic
1088566607 11:111179122-111179144 TCTCCCTCTTATGAGCTGTGTGG - Intergenic
1089412000 11:118252103-118252125 CCTTCCTTCCCAGAGCTATGCGG + Intronic
1202823575 11_KI270721v1_random:79872-79894 CCTTCCTCCAAGGTGCTCTGGGG + Intergenic
1091647171 12:2282578-2282600 CTCTGATCCCATGAGCTGTGAGG - Intronic
1092166581 12:6346402-6346424 CCTGCCTCCCATCAGCTGTCTGG - Intergenic
1094438914 12:30453271-30453293 CTTTCCTGCCAAGAGCTGTCCGG + Intergenic
1096492255 12:52019210-52019232 CCGTCATCCCATCAGCTGAGAGG - Intergenic
1097402620 12:59148039-59148061 GGTTCCTCCCATGACATGTGGGG - Intergenic
1100150334 12:91728895-91728917 TCTTCCTCCCATGAGCCTTGTGG - Intergenic
1100222605 12:92522164-92522186 GGTTCCTCCCATGACATGTGGGG - Intergenic
1100453554 12:94730670-94730692 CGTCCCTCCCATGACATGTGGGG + Intergenic
1101033714 12:100684816-100684838 GGTTCCTCCCATGACATGTGGGG + Intergenic
1101127353 12:101650606-101650628 CGTCCCTCCCATGACATGTGAGG + Intronic
1102569064 12:113816277-113816299 CCTACCTCCCCAGAGCAGTGAGG - Intergenic
1102684005 12:114710213-114710235 CCTGCCTCCCGTGAGCTCTGAGG - Intergenic
1103679425 12:122681503-122681525 CCCTTCTCCCTTGTGCTGTGTGG + Intergenic
1104393009 12:128407106-128407128 GTTTCCTCCCATGATATGTGGGG - Intronic
1104425296 12:128671896-128671918 TCTTCCTCCCATGGGCTTTGTGG - Intronic
1104745530 12:131208007-131208029 CGTTCCGCCCCTGAGATGTGCGG + Intergenic
1106178105 13:27348385-27348407 CCTTCATTCCCTGAGCGGTGAGG + Intergenic
1106786487 13:33113100-33113122 TCTGCCTCCCATGAGCTGCGAGG - Intronic
1108029232 13:46211793-46211815 CCTTCCTCCGACGCACTGTGGGG - Intronic
1110062575 13:71061696-71061718 GGTTCCTCCCATGACATGTGGGG + Intergenic
1110496380 13:76173401-76173423 GGTTCCTCCCATGACATGTGGGG + Intergenic
1110973599 13:81800534-81800556 CTTTCCTCCCATTCGCTCTGGGG - Intergenic
1111585076 13:90273107-90273129 CGTCCCTCCCATGACATGTGGGG + Intergenic
1112700721 13:102004713-102004735 GATGCCTCCCATGACCTGTGGGG - Intronic
1113045636 13:106151859-106151881 CCTCCCTCCCTTGACATGTGGGG - Intergenic
1113150404 13:107257197-107257219 CCTCCCTCCCTTGACATGTGGGG + Intronic
1113225780 13:108158430-108158452 AATCCCTCCCATGACCTGTGGGG + Intergenic
1114278986 14:21172666-21172688 GGTTCCTCCCATGAAATGTGGGG + Intergenic
1114680358 14:24479160-24479182 GGTTCCTCCCATGACATGTGGGG + Intergenic
1114989639 14:28271562-28271584 GGTTCCTCCCATGACATGTGGGG + Intergenic
1119061939 14:71483745-71483767 ACTTTCTCCAGTGAGCTGTGAGG - Intronic
1119778658 14:77263974-77263996 CCATCCTCCCATAAGAAGTGAGG + Intergenic
1120856742 14:89219139-89219161 CCTCCCTCCCCTGACATGTGGGG - Intronic
1120999883 14:90443902-90443924 CCACCCTCCCATGAGCTACGTGG - Intergenic
1121313141 14:92945906-92945928 CCTGCCACCAATGTGCTGTGGGG + Intronic
1121325010 14:93014777-93014799 ACTTGCTCCCATGAGCTGTAAGG - Intronic
1121421884 14:93821754-93821776 AGTCCCTCCCATGACCTGTGGGG - Intergenic
1121446685 14:93983328-93983350 CGTCCCTCCCATGACATGTGGGG + Intergenic
1121655822 14:95594823-95594845 GGTTCCTCCCATGACATGTGAGG - Intergenic
1122298208 14:100717324-100717346 CCTCCCTCCCCTGATCTGTTGGG - Intergenic
1202863972 14_GL000225v1_random:103909-103931 GCTTCCTCCCATGGCCTGGGTGG - Intergenic
1124373711 15:29117448-29117470 CTTTCCTCCCTGAAGCTGTGCGG + Exonic
1125108612 15:36004236-36004258 ACTTCCACCCATGAGCAATGTGG + Intergenic
1125458228 15:39882884-39882906 CCTTCCTGACATTATCTGTGTGG - Intronic
1128259762 15:66224972-66224994 CCTTCCTCCCAGGAGGAGAGGGG - Intronic
1128419863 15:67481482-67481504 CGTTCCTCCCATGACACGTGGGG + Intronic
1128612714 15:69086984-69087006 CCTACCTCCCATGACCAGGGTGG + Intergenic
1128669370 15:69563051-69563073 CCTTCCTCCCATGAGATCTTGGG + Intergenic
1129150439 15:73684666-73684688 CCCTCCTGCCCTGGGCTGTGGGG + Intronic
1129250432 15:74305846-74305868 TCCACCTCCCAAGAGCTGTGTGG + Intronic
1129792463 15:78350451-78350473 CCTTCCTCTAAGAAGCTGTGGGG - Intergenic
1130306552 15:82715508-82715530 CCTTCCTCCTAGCAGCTCTGAGG + Intergenic
1130376727 15:83335779-83335801 GTTTCTTCCTATGAGCTGTGAGG + Intergenic
1130445053 15:83992841-83992863 CCCTCCTGCCCTGTGCTGTGGGG + Intronic
1130820619 15:87491345-87491367 ACTCCCTCCCATGACATGTGGGG - Intergenic
1131921302 15:97331741-97331763 ACTCCCTCCCATGACATGTGGGG - Intergenic
1132757005 16:1490428-1490450 TCTTATTCCCATGAGCTGGGCGG - Intergenic
1133076737 16:3285790-3285812 CCTTCCTCCCCTGAGTGTTGGGG + Intronic
1133640716 16:7714686-7714708 CCTCCCTCCCACCACCTGTGAGG - Intergenic
1134116310 16:11551423-11551445 CCTGCCTCTCACTAGCTGTGTGG - Intronic
1134156958 16:11851720-11851742 CCAGCTTTCCATGAGCTGTGGGG + Intergenic
1135470565 16:22725931-22725953 CCTTCTTCCCATTGGCTGGGAGG - Intergenic
1136472651 16:30491984-30492006 TCTTCCTTCCATGTGCTGTAGGG + Intronic
1136871262 16:33809966-33809988 CCTCCCTCCCATCCGCTATGAGG - Intergenic
1138650581 16:58458731-58458753 CCTTTCTCCCATGATATGTAAGG - Intergenic
1138653064 16:58472752-58472774 CCTTCCTCGCAAGGGCAGTGTGG + Intronic
1139699805 16:68701138-68701160 CCTTCCTCCCCTGAGATATTTGG + Intronic
1141287673 16:82687655-82687677 ACTTCCTCCCATGACATGTGGGG + Intronic
1142407895 16:89901354-89901376 GCCTCCTCCGAGGAGCTGTGAGG + Intronic
1203100910 16_KI270728v1_random:1306092-1306114 CCTCCCTCCCATCCGCTATGAGG + Intergenic
1142594485 17:1022866-1022888 CCTTCCTCCCATGAGGCTTGGGG - Intronic
1142905828 17:3041208-3041230 CCTTCCTCCCAGAAAATGTGAGG + Intergenic
1142933968 17:3311679-3311701 TCTTCCTCCCCTCAGCTGAGCGG - Intergenic
1143191359 17:5042417-5042439 ACCTCCTCCCCTGAGCTCTGAGG - Intronic
1143738745 17:8935713-8935735 CCATCCTGCCAGGAGCTGTCCGG - Intronic
1143968098 17:10771310-10771332 CCTTCCTCCCCAGACCTGTCTGG - Intergenic
1144395569 17:14839492-14839514 GGTTCCTCCCATGACCTGTGGGG - Intergenic
1144782125 17:17813633-17813655 GCTTCCGCCCTTGAGCTGCGTGG - Exonic
1144836669 17:18159920-18159942 CCTGCCCCCCTTCAGCTGTGCGG + Exonic
1144839303 17:18175836-18175858 CCTTCCTCCCATGACCTTTGTGG + Intronic
1144959998 17:19039561-19039583 CCTGACTCCCATGGGCCGTGAGG + Intronic
1144975162 17:19134963-19134985 CCTGACTCCCATGGGCCGTGAGG - Intronic
1145246273 17:21271945-21271967 CTCCCCTCCCATGAGCAGTGCGG - Intergenic
1145255816 17:21321808-21321830 CCTCCCTCCTGTTAGCTGTGTGG + Intergenic
1146619644 17:34387524-34387546 CCTTGCTCTCTGGAGCTGTGGGG - Intergenic
1146899690 17:36575178-36575200 CCTTGCCTCCATGAGCTCTGCGG + Intronic
1146978922 17:37141311-37141333 CCTTGCCTCCATGAGCTCTGTGG + Intronic
1147595670 17:41715630-41715652 CCTACCTGCCACGAGGTGTGGGG - Exonic
1147880258 17:43648873-43648895 TCTCCCTGCCTTGAGCTGTGTGG + Intronic
1147883346 17:43668301-43668323 CCTTCCTCCTTCGTGCTGTGTGG - Intergenic
1147998125 17:44372472-44372494 ACTTCCTCACATGTGCTCTGGGG - Intronic
1148067994 17:44887210-44887232 CCTTTTTCCCATCAGCAGTGTGG - Intronic
1148197723 17:45726737-45726759 CCTCCCTCCCTTGACATGTGGGG - Intergenic
1148841713 17:50502958-50502980 GCTGCCTTCCATGATCTGTGGGG - Intergenic
1149078959 17:52631525-52631547 GGTTCCTCCCATGACATGTGGGG - Intergenic
1149875788 17:60231622-60231644 CCTCTCTCCCATGGGCTTTGGGG - Intronic
1150353782 17:64466237-64466259 GGTCCCTCCCATGAGATGTGGGG + Intronic
1150649793 17:67002329-67002351 GGTCCCTCCCATGAGATGTGGGG + Intronic
1151482836 17:74380290-74380312 CCTCCCTCCGAAGAGCGGTGTGG - Intergenic
1151653847 17:75486275-75486297 CTTTCCTCCCACCAGCCGTGGGG + Exonic
1152003062 17:77659025-77659047 CTTTCTTGCCATGAGCTGCGTGG - Intergenic
1152638433 17:81439647-81439669 CCGGGCTCCCAGGAGCTGTGCGG - Intronic
1152860599 17:82694743-82694765 CCTGGCTCACATGTGCTGTGGGG - Intronic
1153084495 18:1268802-1268824 CCTTCCTGCCATTGGATGTGAGG - Intergenic
1156397823 18:36715180-36715202 GGTCCCTCCCATGACCTGTGGGG - Intronic
1157011342 18:43652641-43652663 CCTCCCTCCCTTGACATGTGGGG + Intergenic
1157870502 18:51225997-51226019 CCTTCCTCCTTTAAGCTGGGTGG + Intergenic
1158516599 18:58135780-58135802 CTTTCCTCCCATGACAAGTGTGG - Intronic
1159218138 18:65423873-65423895 CTTCCCTCCCATGACATGTGGGG - Intergenic
1159386759 18:67735750-67735772 ACTTCCTCCCAGCAGCTGTTGGG - Intergenic
1160414787 18:78701029-78701051 CCTTCCTCACAGCAGCAGTGAGG + Intergenic
1160712762 19:560264-560286 CCTTCGTCCCGTGAGCTCCGGGG - Intergenic
1161009631 19:1954055-1954077 GCTTCCTCCCATGGGGTGGGCGG + Intronic
1163320909 19:16574121-16574143 CCTACCACCCACCAGCTGTGTGG - Intronic
1164506765 19:28867380-28867402 CCTGCCTCTAATGAGCTGTATGG + Intergenic
1166647625 19:44543834-44543856 CCTTCCTCCAAGGAGCACTGTGG - Intergenic
1166859675 19:45802399-45802421 CCCACCTCCCCTTAGCTGTGCGG - Intronic
1167133057 19:47600330-47600352 CCTGCCTCCCAGAAGCTGTCAGG + Intergenic
925117596 2:1393448-1393470 TCTTCCACCCAGGTGCTGTGTGG - Intronic
925443791 2:3910345-3910367 CCTCCCTCCCATCAGGTGTGAGG + Intergenic
925689759 2:6509797-6509819 GGTTCCTCCCATGACATGTGGGG - Intergenic
926329915 2:11815817-11815839 CCTTCCTCCCTTCACCTATGGGG + Intronic
926423764 2:12723100-12723122 CCTGCCTCCTACCAGCTGTGTGG - Intronic
927151438 2:20198643-20198665 CCTTTCTCCCAGATGCTGTGGGG + Intergenic
928363371 2:30683524-30683546 CCTCCCTCCCTTGATGTGTGAGG + Intergenic
929022062 2:37563253-37563275 CCTTCCTTTCCTGAGCTTTGAGG + Intergenic
930512315 2:52360076-52360098 GGTTCCTCCCATGACATGTGGGG - Intergenic
931229951 2:60365704-60365726 GCTTCCACCCATGAAATGTGGGG + Intergenic
931778094 2:65556983-65557005 GCTTCCACCCATGGGCTCTGGGG - Intergenic
931994803 2:67829681-67829703 CTTCCTTCCCAGGAGCTGTGAGG + Intergenic
933085232 2:78046887-78046909 CATCCCTCCCATGACCCGTGGGG - Intergenic
933141253 2:78794587-78794609 GCCTCCTTCCATGAGCTGGGGGG + Intergenic
934700689 2:96437615-96437637 CCTTCCTCCCTTGATGTGTGGGG - Intergenic
935140092 2:100345236-100345258 AGTTCCTCCCATGACATGTGGGG - Intergenic
935276623 2:101480903-101480925 GCTTCCTCCCGTGGGCTCTGTGG - Intergenic
936523716 2:113228700-113228722 TTTTCCTCCCAGGACCTGTGTGG + Intronic
937205879 2:120236924-120236946 CTTTCCTCCCAAGTGCAGTGGGG + Intergenic
937293038 2:120793478-120793500 CCTGCCTCAGATGAGCTTTGGGG + Intronic
937836807 2:126479406-126479428 GCTCCCTCCCATGACATGTGGGG - Intergenic
939462525 2:142515290-142515312 CCCTCCTCTCAACAGCTGTGTGG + Intergenic
940360162 2:152788312-152788334 CCTCCCTCCCTTGACGTGTGGGG + Intergenic
940797848 2:158099470-158099492 CCCTACTCCCATAGGCTGTGAGG + Intronic
940907327 2:159180846-159180868 CCTGCCTCCCCTGCCCTGTGTGG - Intronic
943371520 2:187022694-187022716 CTTTCCTCCCTTGACATGTGGGG + Intergenic
943372234 2:187029116-187029138 GGTTCCTCCCATGACATGTGGGG - Intergenic
943882504 2:193164124-193164146 GCTTCCTCCCTTGACATGTGGGG - Intergenic
943926936 2:193796370-193796392 GGTCCCTCCCATGACCTGTGGGG + Intergenic
944971910 2:205002897-205002919 CACTCCTCCCATGTGCTGGGTGG + Intronic
945166530 2:206953044-206953066 GCTTCCTCCCATGATATCTGGGG + Intronic
945695313 2:213094617-213094639 CCTTCATCCCAAGAGCTTTGTGG - Intronic
945896301 2:215486190-215486212 CATGCCTCCATTGAGCTGTGGGG + Intergenic
946447723 2:219754099-219754121 GCTTCCTCCCATGACATGTGAGG - Intergenic
947817099 2:233044931-233044953 CCTGCCTCTAATCAGCTGTGTGG - Intergenic
947819613 2:233060839-233060861 CCAGCTTCCCATGAGCTGTATGG + Intronic
1168910523 20:1443317-1443339 CCTTCCTCCAGTCATCTGTGGGG + Exonic
1170567522 20:17615422-17615444 CCTGCCTGCCTTCAGCTGTGAGG + Exonic
1170723869 20:18908338-18908360 CCTTCATCTCATGGGCTGTTTGG + Intergenic
1170859375 20:20088580-20088602 GCTTCCTCCCATGACATGTGGGG + Intronic
1171069071 20:22048803-22048825 TCTTCCTTCCATCTGCTGTGGGG - Intergenic
1171226012 20:23442720-23442742 TCTTCCTCCCAGGAGCAGTGTGG + Intronic
1172111474 20:32547855-32547877 TTCTCCTCCCATGAGCTCTGGGG + Intronic
1172219453 20:33263430-33263452 GGTGCCTCCCATGATCTGTGGGG - Intergenic
1172272133 20:33660587-33660609 CCTCCCTCCCCGGAGGTGTGAGG + Intronic
1173061587 20:39666850-39666872 CCTGCCTCTCATGGGCCGTGAGG - Intergenic
1174160725 20:48548638-48548660 TCATCCCCCCATGAACTGTGAGG + Intergenic
1174488155 20:50874173-50874195 CCTTGATCCCATGAGCACTGAGG - Intronic
1174661835 20:52220464-52220486 CCTTCCTCCCTTGACGTATGGGG + Intergenic
1174985943 20:55452200-55452222 GGTTCCTCCCATGACATGTGGGG - Intergenic
1175286487 20:57840253-57840275 CTTTCCTCCCATGGGCTCTGTGG + Intergenic
1175735805 20:61386244-61386266 TGTTCCTTCCAGGAGCTGTGAGG - Intronic
1175991145 20:62789922-62789944 CCTGCCTGCCATGGGGTGTGTGG - Intergenic
1176587613 21:8604041-8604063 GGTTCCTCCCATGACATGTGTGG - Intergenic
1177351157 21:19943823-19943845 CCTCCCTCCCTTGACATGTGGGG + Intergenic
1177401659 21:20613554-20613576 CCTTCCTCTCTTGACATGTGAGG - Intergenic
1178087362 21:29125434-29125456 CATTCCTCTCTTGAGCTTTGGGG + Intronic
1178494706 21:33076942-33076964 CCTTCCTCCCCTTAGCTCTTGGG + Intergenic
1179300002 21:40099706-40099728 CTTTCCTAACAAGAGCTGTGAGG + Intronic
1179522129 21:41952718-41952740 TCTGCCGCCCACGAGCTGTGTGG + Intronic
1179644404 21:42766847-42766869 CCTTCCTCCTCTGAGGTGGGAGG + Intronic
1179714044 21:43278725-43278747 CCTTCCTCCTAGGGTCTGTGGGG - Intergenic
1179835740 21:44031560-44031582 CTTTCCTCCCAGGAGTTATGGGG + Intronic
1180270443 22:10581039-10581061 GGTTCCTCCCATGACATGTGTGG - Intergenic
1180353848 22:11823635-11823657 CCTTCCTCTCATGGGCTTTCTGG + Intergenic
1180384400 22:12168690-12168712 CCTTCCTCTCATGGGCTTTCTGG - Intergenic
1183063342 22:35348477-35348499 GCTTCCTCCTCTGAGCTGGGCGG - Intergenic
1183342766 22:37290925-37290947 CTTTCCTCCCAGCAGCTGGGGGG + Intronic
1183371593 22:37435611-37435633 CCTTCCTACCAGGGGCTGAGTGG + Intergenic
1184115535 22:42419714-42419736 CCTTCCTCTCCTGGGCTTTGGGG + Intronic
1184279420 22:43428520-43428542 GCTCCCTCCCAGGAGCGGTGGGG + Intronic
1184587970 22:45460561-45460583 CCCTCCTCCCTTCAGCCGTGTGG + Intergenic
1184998393 22:48227006-48227028 TCTTTCTCCCAGGACCTGTGCGG + Intergenic
1185191681 22:49441129-49441151 CCTTCCTCCCACGTCCTGTCCGG + Intronic
1185225180 22:49648056-49648078 CCGCCCTCCCAGGGGCTGTGGGG - Intronic
949139739 3:617710-617732 GGTTCCTCCCATGACATGTGTGG + Intergenic
949391991 3:3572511-3572533 TCTTCCTCCCAAGAGCTAGGAGG - Intergenic
949483017 3:4511770-4511792 CCTGCCTGCCATGGGCTGAGAGG + Intronic
949624151 3:5848950-5848972 CCTTCTTCCCATGAGGTGGGAGG - Intergenic
950611023 3:14126512-14126534 TCTTCCACCCAGTAGCTGTGTGG + Intronic
950684392 3:14605995-14606017 CACTCCTCCCATGAGAGGTGGGG - Intergenic
950920054 3:16685077-16685099 CCTCCCTCCCTTGACATGTGGGG + Intergenic
950934385 3:16823903-16823925 CCTTTCTGCCCTGAGCTGTCAGG - Intronic
951636180 3:24780141-24780163 CCTCCCTCCCTTGACATGTGGGG + Intergenic
951814993 3:26744575-26744597 CCTCCCTCCCTTGACATGTGGGG + Intergenic
952854167 3:37753956-37753978 CCTGCCTCCCATAAGCTGTCTGG - Intronic
953044605 3:39283268-39283290 CCTACCACACATGAGCTGTGTGG - Intergenic
954980669 3:54742468-54742490 CTTCCCTCAAATGAGCTGTGAGG - Intronic
955737987 3:62059725-62059747 GGTTCCTCCCATGACATGTGAGG - Intronic
955822854 3:62914727-62914749 CCTTCCTCCCATGTGGATTGAGG - Intergenic
957425588 3:80035100-80035122 CCTTCCTCCCTTGACACGTGAGG + Intergenic
957703202 3:83745310-83745332 GGTTCCTCCCATGACATGTGGGG - Intergenic
958983286 3:100750661-100750683 CCTTCAATCTATGAGCTGTGAGG - Intronic
959169698 3:102830227-102830249 CCTGTCTCCCAGGAGCTGTTGGG - Intergenic
960323367 3:116264925-116264947 CCTTCCTTCCCTGAGGTCTGTGG + Intronic
961233879 3:125346550-125346572 TCTTCCTCCCTTGACATGTGGGG - Intronic
961435038 3:126911152-126911174 CAGTCCTCCCAGGTGCTGTGGGG - Intronic
961735412 3:128999325-128999347 CCTTACTTCCCTGAGCTGTAGGG + Intronic
962046571 3:131766149-131766171 CCTGCCACTCATTAGCTGTGTGG + Intronic
962330328 3:134472530-134472552 CCTTCCTCCCATGGTCAGTGAGG + Intergenic
963018106 3:140844953-140844975 CCTCCCTCCCTTGACATGTGGGG + Intergenic
963480245 3:145863738-145863760 CCTCCCTCCTATGTGCTTTGTGG + Intergenic
964221218 3:154347491-154347513 GGTTCCTCCCATGATGTGTGGGG + Intronic
964992145 3:162827694-162827716 GTTTCCTCCCATGACATGTGGGG + Intergenic
966273303 3:178134889-178134911 CCTTCCTCTCTTGACATGTGGGG + Intergenic
966643486 3:182216489-182216511 CCTCCCTCCCACGACCTGTGGGG + Intergenic
966971408 3:185048770-185048792 CCTACGTACCATGAGCTGTGAGG + Intronic
967366027 3:188687387-188687409 CCTCCCTCCCTTGACATGTGGGG - Intronic
967430608 3:189381059-189381081 GGTTCCTCCCATGACATGTGGGG - Intergenic
968144182 3:196284655-196284677 CTCTCCTCCCATAAGCAGTGGGG - Intronic
968310875 3:197682216-197682238 CTTTCCTCCCAGTAGTTGTGTGG - Intronic
968570329 4:1336999-1337021 CCTACCTCCCGTGCGCAGTGCGG + Intronic
968905030 4:3447044-3447066 CCTGGCTCCCATCTGCTGTGTGG - Intronic
969151046 4:5168791-5168813 CCTTCCTGCCATCAGCTGTATGG - Intronic
969499066 4:7542140-7542162 CCCTCCGCCCATGAGGGGTGAGG - Intronic
969507970 4:7599785-7599807 GCTTCATCCTAAGAGCTGTGGGG + Intronic
970146811 4:13044486-13044508 GGTTCCTCCCATGACATGTGGGG + Intergenic
970180144 4:13383637-13383659 GGTCCCTCCCATGACCTGTGAGG - Intronic
971039320 4:22733866-22733888 CCTCCCTCCCTTGATGTGTGGGG - Intergenic
971790266 4:31161464-31161486 TCTTCCACTCATTAGCTGTGGGG + Intergenic
974513202 4:62873042-62873064 GGTTCCTCCCATGACATGTGGGG - Intergenic
974763517 4:66308860-66308882 CGTCCCTCCCATGACATGTGGGG - Intergenic
976259759 4:83134730-83134752 GGTTCCTCCCATGACATGTGGGG + Intronic
976545939 4:86335890-86335912 CCTCCCTCCCTTGACATGTGGGG + Intronic
976703688 4:87999533-87999555 CCTCCCTCCCTTGACATGTGGGG + Intergenic
976820570 4:89201898-89201920 GTTCCCTCCCATGACCTGTGGGG + Intergenic
978036255 4:103998973-103998995 CTTGCCTCCCATTAGCTGTCTGG - Intergenic
978105667 4:104899066-104899088 GGTTCCTCCCATGATGTGTGGGG + Intergenic
981120306 4:141042776-141042798 CCTTCCGCCCATGTGTTCTGGGG + Intronic
981363183 4:143871115-143871137 GGTTCCTCCCATGACATGTGGGG + Exonic
981373913 4:143991909-143991931 GGTTCCTCCCATGACATGTGGGG + Intergenic
981477048 4:145197529-145197551 CCTTCCTCCAAGGAGATGAGTGG + Intergenic
981737616 4:147969425-147969447 CCATCTTTCCATGAGCTGTCTGG - Intronic
983138727 4:164121586-164121608 GCTCCCTCCCATGACATGTGAGG + Intronic
983760262 4:171396388-171396410 GGTTCCTCCCATGACATGTGGGG - Intergenic
986507928 5:8471914-8471936 CGTCCCTCCCATGACATGTGAGG + Intergenic
987152710 5:15058057-15058079 ACTTATTCCCTTGAGCTGTGTGG + Intergenic
987335445 5:16894516-16894538 TCTACCTCCCAGGAACTGTGGGG + Intronic
987872660 5:23640933-23640955 GGTTCCTCCCATGACATGTGGGG - Intergenic
989369279 5:40688707-40688729 TCTTCCTTCCATAAGCTTTGAGG - Intronic
991086112 5:62649594-62649616 CCTCTCTCCCCTCAGCTGTGAGG + Intergenic
991178926 5:63725856-63725878 CCTCCCTCCCTTGACCTGTGGGG + Intergenic
993325168 5:86525495-86525517 CCTTCCTTCAGTGAACTGTGAGG + Intergenic
994666968 5:102716751-102716773 CCATCCTCCCATGTTCTGGGAGG - Intergenic
995566437 5:113436073-113436095 CCTTCCTCACATGAGCCAGGTGG + Intronic
995833285 5:116376882-116376904 CCCTGATCCAATGAGCTGTGTGG + Intronic
996699896 5:126439780-126439802 GCTCCCTCCCATGACATGTGGGG - Intronic
997059171 5:130479721-130479743 CCTCCCTCCCTTGAGCTGGAAGG + Intergenic
997091703 5:130865670-130865692 CGTTCCTCCCTTGACATGTGGGG + Intergenic
997720181 5:136071854-136071876 GCTTCCTCCCGTGACATGTGGGG + Intergenic
998163615 5:139827847-139827869 CCTTCCTCCCTTGACATGTGGGG + Intronic
999857856 5:155614661-155614683 GCTTCCTCTCATGAGCTGACTGG + Intergenic
1000659622 5:163921161-163921183 GCTCCCTCCCATGACATGTGGGG - Intergenic
1000691036 5:164320965-164320987 GCTCCCTCCCATGACATGTGGGG + Intergenic
1001041615 5:168339617-168339639 ACTTCCTTCCCTGGGCTGTGAGG + Intronic
1002538123 5:179889416-179889438 CCTGCCTCCTGTGACCTGTGAGG - Intronic
1003781221 6:9429284-9429306 CCTCCCTCCCATGACATGCGGGG + Intergenic
1007021660 6:38527406-38527428 CCTCCCTCCCTTGACATGTGGGG - Intronic
1007077449 6:39076886-39076908 CCTTCCTCACATGACATATGAGG - Intronic
1007273671 6:40657797-40657819 CCTTCTCTGCATGAGCTGTGGGG + Intergenic
1008337732 6:50326521-50326543 GGTCCCTCCCATGAGATGTGGGG + Intergenic
1008557501 6:52688591-52688613 CTTGCTTCCCATTAGCTGTGAGG - Intergenic
1009468594 6:64003731-64003753 GGTTCCTCCCATGACATGTGGGG - Intronic
1011886589 6:92104047-92104069 CCTTCCTCCCTTGACATGTGGGG - Intergenic
1012162650 6:95905454-95905476 CCTTACTCCTTTGAGCAGTGTGG - Intergenic
1012609718 6:101201563-101201585 CCTACCACACATGAGCTGAGGGG - Intergenic
1012711910 6:102617551-102617573 TCTGCCTCCCATGAGATGTATGG + Intergenic
1012767338 6:103385688-103385710 GCTCCCTCCCATGATATGTGGGG - Intergenic
1013539679 6:111095617-111095639 CCTCCCTCCCATGACAAGTGTGG - Intronic
1013549072 6:111189809-111189831 GCTTGCTCCCATGATATGTGGGG + Intronic
1014958181 6:127648347-127648369 GGTTCCTCCCATGACATGTGGGG - Intergenic
1015159651 6:130138354-130138376 GCTTCCTCCCGAGGGCTGTGAGG + Intronic
1016894931 6:149042393-149042415 CATTCCTCTCATTAGCAGTGTGG + Intronic
1018445688 6:163856030-163856052 CCTCGCTCCCGTGATCTGTGGGG - Intergenic
1019199177 6:170300388-170300410 ACTTCCTCCCACGACATGTGGGG + Intronic
1019353188 7:564712-564734 CCCCCCTCCCCTGAGCTGTGAGG - Intronic
1019558783 7:1645625-1645647 CCCTCCACCCTTGAGCTTTGGGG - Intergenic
1019943328 7:4308196-4308218 CCTTCCTCCCGTTGGCTCTGCGG + Intergenic
1025155940 7:56606003-56606025 CCTTCCTTGCATGAGGTGGGGGG - Intergenic
1025813173 7:64888284-64888306 CCTTCCTCCTGTGAGCTCCGTGG + Intronic
1028119992 7:87046576-87046598 CCTCCCTCCCTTGACATGTGGGG - Intronic
1028174426 7:87637106-87637128 GCTCCCTCCCATGATATGTGGGG + Intronic
1029044148 7:97609850-97609872 ACTTCCTACCTTGAGCTGTTTGG - Intergenic
1029250450 7:99232663-99232685 CCTTCCTCCCATTACCCTTGTGG - Intergenic
1029445185 7:100607986-100608008 CCTTCCTCCAGAGAGCTTTGTGG + Exonic
1031783257 7:125997330-125997352 CCTTCCTATCATAAGCTGAGAGG + Intergenic
1031818405 7:126469487-126469509 AGTCCCTCCCATGAGATGTGGGG - Intronic
1032397368 7:131600378-131600400 TCTTCCTCCCATGACCTTTATGG + Intergenic
1032507640 7:132447654-132447676 CCTTCCTAAGATGTGCTGTGTGG - Intronic
1033168231 7:139059972-139059994 CTTGCCACCCATTAGCTGTGTGG - Intronic
1033303357 7:140206137-140206159 CCTGCCTCCCATGAGATAAGAGG - Intergenic
1034163237 7:149007416-149007438 GCTTCCCACCAGGAGCTGTGGGG + Intronic
1034487952 7:151377730-151377752 TCTTCCTTCCAAGTGCTGTGGGG + Exonic
1035227835 7:157443329-157443351 CCATCCGCACATGGGCTGTGGGG + Intergenic
1035324551 7:158056407-158056429 CCGTCCTCCCATGAGCCCAGGGG + Intronic
1035557715 8:579114-579136 CCTTGGTCCCATGTGCTGTGGGG - Intergenic
1036990772 8:13591293-13591315 CGTCCCTCCCATGATATGTGGGG - Intergenic
1037410139 8:18587204-18587226 CCCTCCTCACAGGACCTGTGTGG - Intronic
1037801659 8:22039209-22039231 CCTCCCTCCCATCAGCAGAGTGG - Intergenic
1040565014 8:48557076-48557098 CCTTTCTCCATTTAGCTGTGCGG + Intergenic
1040721625 8:50330897-50330919 CCTCCCTCCCTTGACATGTGAGG + Intronic
1042859362 8:73297004-73297026 CCTTCCTCCCATGAAGTCTTTGG - Intronic
1043030561 8:75129445-75129467 GCTTCCTCCCTTGACATGTGGGG - Intergenic
1043492363 8:80762550-80762572 CCTCCCTCCCTTGACATGTGGGG + Intronic
1044868415 8:96594958-96594980 GCTCCCTCCCATGACATGTGGGG + Intronic
1045871445 8:106932068-106932090 GGTTCCTCCCATGACATGTGGGG + Intergenic
1047247005 8:123154866-123154888 CCTTGCTCCAATGTGCTGTTTGG - Intergenic
1047311543 8:123696644-123696666 CCTCCCACCCAGGAGCAGTGAGG - Intronic
1048222142 8:132551851-132551873 TCATGCTCACATGAGCTGTGTGG + Intergenic
1048278552 8:133087425-133087447 CCTTCCTCCCTCGGGGTGTGAGG + Intronic
1048503775 8:135002333-135002355 CCTTCCGCATTTGAGCTGTGTGG + Intergenic
1048633377 8:136268755-136268777 GCTCCCTCCCATGACTTGTGGGG - Intergenic
1049564628 8:143331763-143331785 CCTGCCTCCGAGGAGCTGGGTGG + Intronic
1049614984 8:143572160-143572182 CCCTCCTCCCAGGAACTCTGGGG + Exonic
1050740469 9:8813681-8813703 CTCTCCTTTCATGAGCTGTGAGG + Intronic
1050985040 9:12071681-12071703 GATTCCTCCCATGACATGTGGGG - Intergenic
1051267665 9:15324149-15324171 GGTCCCTCCCATGAGATGTGGGG - Intergenic
1052993109 9:34533679-34533701 CCTTCCTGACATGAGCTTTCAGG + Intergenic
1054969048 9:71063187-71063209 CCTTCCTCCCATGAGCCATTTGG + Intronic
1055151686 9:73008277-73008299 GATTCTTCCCCTGAGCTGTGTGG - Intronic
1055653939 9:78435376-78435398 CCTTCCTCCAATGACATGTCTGG - Intergenic
1056113044 9:83415130-83415152 CCTGGCTCCCCTGACCTGTGAGG - Intronic
1058367969 9:104232894-104232916 CATTCCTTCCATGACATGTGAGG + Intergenic
1058810146 9:108631199-108631221 GGTCCCTCCCATGACCTGTGGGG - Intergenic
1060452532 9:123756703-123756725 CCCTCCTCCCCTGTGGTGTGAGG + Intronic
1060940356 9:127539865-127539887 TCTGCCACCTATGAGCTGTGTGG + Intronic
1061487859 9:130929358-130929380 CCTGGCTCCCAGTAGCTGTGCGG + Intronic
1062097204 9:134709623-134709645 GCCTCTTCCCATGTGCTGTGGGG + Intronic
1062141511 9:134961598-134961620 CCTCCCTCCCGTGGGCTGTTCGG + Intergenic
1062411968 9:136430208-136430230 CCGTCGTCCCATGAGCTAAGAGG - Intronic
1203617580 Un_KI270749v1:82219-82241 GGTTCCTCCCATGACATGTGTGG - Intergenic
1186138039 X:6540458-6540480 GGTCCCTCCCATGACCTGTGGGG - Intergenic
1186332551 X:8550908-8550930 GGTTCCTCCCATGACATGTGGGG - Intronic
1187322339 X:18251056-18251078 GGTCCCTCCCATGACCTGTGGGG + Intronic
1187734522 X:22290361-22290383 CTTTCCTCCCTTGACATGTGGGG - Intergenic
1188182765 X:27075726-27075748 GCTCCCTCCCATGAGGGGTGGGG + Intergenic
1188213502 X:27450604-27450626 GGTTCCTCCCATGACATGTGGGG - Intergenic
1188532990 X:31163192-31163214 GGTTCCTCCCATGATATGTGCGG - Intronic
1188864997 X:35304027-35304049 GGTTCCTCCCATGACATGTGGGG - Intergenic
1189069178 X:37846530-37846552 CCTACCTCCCGTGAGGTCTGGGG + Intronic
1189110217 X:38281790-38281812 CCCTCCACTGATGAGCTGTGTGG - Intronic
1189335433 X:40168278-40168300 TCTGCCTCCCAGGAGCTGTCCGG - Intronic
1189688842 X:43594200-43594222 CCTACTTCCCATGACCTATGAGG - Intergenic
1190431276 X:50379854-50379876 CCTTCCTCCCATGAGCTGTGAGG + Intronic
1191592046 X:62897135-62897157 CCTAACTCTCATGAGCTGAGTGG - Intergenic
1191716306 X:64196098-64196120 CCTTGCTCCTATGCTCTGTGAGG + Intronic
1192205927 X:69096096-69096118 CCTTCATCCCTTTAGCTTTGAGG - Intergenic
1194451718 X:94051598-94051620 CATTCGTCACATGAGCTTTGTGG - Intergenic
1194799111 X:98249498-98249520 CCTTCCTCACCTGAGTTTTGGGG + Intergenic
1195428736 X:104763807-104763829 CCCTCCTCCCATGACACGTGGGG + Intronic
1195924812 X:110014864-110014886 CCTTTCACCCAGGAGCTCTGGGG - Intronic
1195974708 X:110513875-110513897 CCTCTCTCCCTTGAGATGTGGGG + Intergenic
1196066422 X:111469540-111469562 CATCCCTCCCATGACATGTGGGG - Intergenic
1197971611 X:132120577-132120599 CCCTCCTCCTTTCAGCTGTGGGG + Intronic
1201178398 Y:11323203-11323225 GCGTCCTCCCATGTGCTGGGTGG + Intergenic
1201685360 Y:16695838-16695860 CCTCCCTCCCATTACATGTGGGG - Intergenic
1201867082 Y:18667437-18667459 CCTTCCCCACTTGATCTGTGTGG + Intergenic