ID: 1190435026

View in Genome Browser
Species Human (GRCh38)
Location X:50415743-50415765
Sequence CTAGTTCACCATTTCTATTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 196}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190435020_1190435026 25 Left 1190435020 X:50415695-50415717 CCTTGTTTTCTATTTCTCCCTTT 0: 1
1: 3
2: 18
3: 214
4: 1768
Right 1190435026 X:50415743-50415765 CTAGTTCACCATTTCTATTTTGG 0: 1
1: 0
2: 1
3: 14
4: 196
1190435022_1190435026 7 Left 1190435022 X:50415713-50415735 CCTTTTAGAATGAGAATGTCTAT 0: 2
1: 20
2: 108
3: 251
4: 715
Right 1190435026 X:50415743-50415765 CTAGTTCACCATTTCTATTTTGG 0: 1
1: 0
2: 1
3: 14
4: 196
1190435021_1190435026 8 Left 1190435021 X:50415712-50415734 CCCTTTTAGAATGAGAATGTCTA 0: 3
1: 21
2: 131
3: 330
4: 746
Right 1190435026 X:50415743-50415765 CTAGTTCACCATTTCTATTTTGG 0: 1
1: 0
2: 1
3: 14
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190435026 Original CRISPR CTAGTTCACCATTTCTATTT TGG Intronic
901899291 1:12344750-12344772 CTAGTTCCCCATTTCACTTCTGG + Intronic
902670745 1:17971524-17971546 GAAGTTAACCATATCTATTTAGG - Intergenic
903315354 1:22499778-22499800 CTCGTTTATAATTTCTATTTGGG + Intronic
904019992 1:27456507-27456529 ATAGTTCACCATTTTAATGTAGG + Intronic
905095517 1:35466811-35466833 CTACTTTACCTTTTCCATTTTGG - Intronic
905494987 1:38377922-38377944 TTAGGTCACCATCTCTGTTTAGG + Intergenic
906737031 1:48139826-48139848 ATAGTTCAGGATTTCTTTTTAGG + Intergenic
907236531 1:53054191-53054213 ATAGTTGACCATTCCCATTTTGG - Intergenic
909756474 1:79231855-79231877 CTACTTTACCATTTGTAATTAGG - Intergenic
910060339 1:83084171-83084193 TCAGTTTTCCATTTCTATTTTGG - Intergenic
911391910 1:97255911-97255933 CAAGTTCATCATTTCATTTTCGG + Intronic
912364809 1:109124628-109124650 CTATTTCTCCATTTATCTTTTGG + Intronic
912588106 1:110785437-110785459 CTAGTTCTCAATCTCTCTTTAGG - Intergenic
914436980 1:147669491-147669513 CCAGGTCAGCATTTCTATTAAGG - Intronic
917148756 1:171922412-171922434 CTTTTTCCCCATTTCTTTTTGGG + Intronic
919968563 1:202554729-202554751 CTTGTTAACAATTTCTTTTTGGG - Intronic
920597850 1:207291213-207291235 CAAGTTCCTCATTTCTGTTTGGG - Intergenic
921717608 1:218434411-218434433 CTAGTTCTTCACTTTTATTTGGG - Exonic
922955722 1:229597679-229597701 CAAATTAAACATTTCTATTTGGG - Intronic
923544772 1:234916177-234916199 CTCTTTCAACACTTCTATTTCGG - Intergenic
924564894 1:245189210-245189232 ACAGTTCACCATTTTTATTATGG - Intronic
1063270290 10:4501425-4501447 TTAGTTAATCATTTCTCTTTAGG - Intergenic
1064072329 10:12241430-12241452 CTTGTTCTCCATTTCAATATTGG + Intronic
1065645567 10:27830588-27830610 CTAGTGAAACAGTTCTATTTAGG + Intronic
1066006780 10:31153207-31153229 CTAGTTCATCAGTGCTAATTTGG - Intergenic
1068785717 10:60970941-60970963 ATAACTCACCATTTTTATTTCGG + Intronic
1071088310 10:81890098-81890120 CTACTTGACCTTTTCTCTTTAGG - Intronic
1071864889 10:89718097-89718119 AGCCTTCACCATTTCTATTTAGG + Intronic
1072476966 10:95771221-95771243 CTATTTAACCATTTCCTTTTGGG + Intronic
1073677602 10:105665909-105665931 CTACTTCACCATCTGTATTGAGG - Intergenic
1075699611 10:124460824-124460846 TTATTTCACCATTTCTTTTCAGG - Intergenic
1076446027 10:130514443-130514465 CTAGTTCACTTATTCTATTAAGG - Intergenic
1078047775 11:7932843-7932865 CTAGTTTTTCTTTTCTATTTTGG - Intergenic
1081264993 11:41009813-41009835 CTACTTCAACATATCTTTTTTGG - Intronic
1081564846 11:44252412-44252434 TTAGGTCACCATTTCTTTTTTGG - Intergenic
1082071746 11:47944917-47944939 CTTATTCACCATTTTTTTTTAGG - Intergenic
1082664203 11:55953454-55953476 CTACTTTACTATTTGTATTTTGG - Intergenic
1083555891 11:63627005-63627027 TAAATTCACCATTTCTGTTTTGG - Exonic
1085929847 11:81068826-81068848 CTAGTTTATCATTACTATTAAGG + Intergenic
1086242609 11:84714028-84714050 CTAGTTTCCCAGTACTATTTTGG - Intronic
1087115465 11:94520109-94520131 CTACTTCACCTATTCTAATTAGG + Intergenic
1087443756 11:98219588-98219610 CTAGTGCACCACTTCAATTTTGG + Intergenic
1087836187 11:102877641-102877663 CTAGTTCACCTTTCCTTTTATGG - Intergenic
1091520659 12:1237843-1237865 CTAGTTAACAATTTCTAATTGGG + Intronic
1093198696 12:16160877-16160899 CTAGCTCACCATTTCAGTTCAGG - Intergenic
1094212488 12:27907016-27907038 CTAGTTCCCCTCTTCTATATTGG + Intergenic
1096958861 12:55556787-55556809 CTAGCTCATTATTTCTACTTTGG - Intergenic
1098600146 12:72321482-72321504 CTTGTTCACCATTTCTGCTCTGG + Intronic
1098734871 12:74087840-74087862 CTAGTTCACCATTTTCTTCTAGG + Intergenic
1099196675 12:79625181-79625203 CTAGTTTTCCATTTCTCTATAGG + Intronic
1099585768 12:84510377-84510399 CTATTTCAAATTTTCTATTTTGG + Intergenic
1099914036 12:88869796-88869818 CAAGTTAACCATCTCTATTGTGG + Intergenic
1101046354 12:100810268-100810290 CTTGGACACCATTTCTCTTTTGG - Intronic
1102804519 12:115767857-115767879 CCAGTTCACCATCTCTTTATTGG + Intergenic
1107661751 13:42646098-42646120 GTAGGTCACATTTTCTATTTAGG + Intergenic
1108496770 13:51033274-51033296 TTCCTTCACCATTTCTATATTGG - Intergenic
1108763865 13:53602973-53602995 CTAGTGCAAAATTGCTATTTTGG + Intergenic
1109129408 13:58562660-58562682 CTAGTTTATTATTTCTTTTTGGG + Intergenic
1110011918 13:70346852-70346874 CTAATTAACCATTTCTGTTATGG - Intergenic
1110095365 13:71512079-71512101 CAATTTCAGCATTTCTTTTTTGG + Intronic
1112213748 13:97408445-97408467 CTAGTTCACTCTTTTCATTTTGG + Intergenic
1115900109 14:38136770-38136792 CTTGTACCCCATTTCTATGTTGG + Intergenic
1116495840 14:45559239-45559261 ATAATTCACTATTTCTAATTAGG + Intergenic
1117212566 14:53515999-53516021 CGATTTCACCAATTCTTTTTAGG + Intergenic
1119966255 14:78919024-78919046 CTAGTTTACCAATTATATTTGGG - Intronic
1120137945 14:80892252-80892274 TTAGTTGACCATATCTGTTTGGG - Intronic
1120477119 14:85002317-85002339 CAAGTTCACCATTTCAATCCTGG - Intergenic
1120683784 14:87513406-87513428 CAAATTCATCCTTTCTATTTGGG - Intergenic
1120891103 14:89492066-89492088 CTAGTTCAACTTTTGTTTTTTGG - Intronic
1122614272 14:103006252-103006274 CTCCATCACCATTTCTTTTTGGG - Intronic
1125631768 15:41153080-41153102 ATAGTTCAGGATTTCTTTTTAGG - Intergenic
1125918890 15:43512698-43512720 CTTGTTTAGCATTTTTATTTAGG + Intronic
1127823307 15:62679976-62679998 CTAGTTCAGCACATCTATATGGG + Intronic
1128961072 15:72005369-72005391 CTAGTGCATCATTTCTTCTTTGG - Intronic
1129943504 15:79519083-79519105 CTGGGTCACCCTTTCTACTTAGG - Intergenic
1132819205 16:1854295-1854317 CTAGTTTAATATTTCTAATTTGG - Intronic
1137952143 16:52793549-52793571 TTAATTCACCAATTCTAGTTGGG - Intergenic
1139210188 16:65069627-65069649 CTATTTTTCCGTTTCTATTTTGG - Intronic
1140563817 16:76016160-76016182 ATAGATCTCCATTTCTTTTTTGG + Intergenic
1141384400 16:83606144-83606166 AATGATCACCATTTCTATTTTGG - Intronic
1144655406 17:17032183-17032205 CTAGTTCACCATATCACTTCAGG - Intergenic
1146330584 17:31923847-31923869 CAAGTTCCCCAATTCTGTTTGGG + Intergenic
1146449782 17:32963868-32963890 CTACTGCACCATTCCTATATTGG - Intergenic
1147696159 17:42355130-42355152 TTATTTCACAATTTCAATTTTGG + Intronic
1151112867 17:71700163-71700185 CTAGTACTCCATTTTTATATGGG + Intergenic
1154040458 18:10849808-10849830 TTAGTTCACCATTTTTCTTCGGG + Intronic
1154391871 18:13944318-13944340 AAGGTTCACCATTTCTATTTTGG - Intergenic
1158378525 18:56901787-56901809 CTAGGTTGCCTTTTCTATTTTGG - Intronic
1159703059 18:71654172-71654194 CTAAATCACTATTTCTTTTTAGG - Intergenic
1160933132 19:1580143-1580165 CTATTTCACCATCTTCATTTCGG + Intronic
1162616454 19:11804717-11804739 CTAGTTCATCAGTGCTATTCAGG + Intronic
926049411 2:9734688-9734710 CTTTATCACTATTTCTATTTTGG + Intergenic
926645902 2:15289485-15289507 CTAATTCATCCTTTCTATTATGG + Intronic
929289280 2:40170782-40170804 CTAGTACACTATTTCTATAATGG - Intronic
931002327 2:57800813-57800835 TTAGTTCATCATTTCTGATTTGG - Intergenic
933292059 2:80448804-80448826 CCATTTCACCATTATTATTTAGG - Intronic
934914014 2:98283743-98283765 CTAGTTCCCTATTTCTGTTTAGG - Intronic
935094988 2:99935724-99935746 CTAGTGCCACTTTTCTATTTTGG + Intronic
936658898 2:114520249-114520271 GTTTTTCTCCATTTCTATTTAGG + Intronic
939376318 2:141372828-141372850 TTTGTTGATCATTTCTATTTTGG + Intronic
940698237 2:157007853-157007875 CAAGTTCAACATTTCCTTTTAGG - Intergenic
941035614 2:160565692-160565714 ATGATTCAGCATTTCTATTTTGG + Intergenic
941210609 2:162633627-162633649 TCAGTTTACCATTTCTATTTGGG - Intronic
941379133 2:164769929-164769951 CTTGTTCTCCCTTTCTCTTTAGG + Intronic
941672419 2:168309578-168309600 AGAGTTCAAAATTTCTATTTTGG - Intergenic
943696413 2:190939484-190939506 ATATTTCATCATTTTTATTTTGG - Intronic
947491549 2:230599753-230599775 CTAGTTGACCATGTATATATGGG - Intergenic
947658582 2:231849466-231849488 CTGGGGCACTATTTCTATTTTGG - Intergenic
947973842 2:234346970-234346992 CAAGGTCACTACTTCTATTTTGG - Intergenic
1169952994 20:11067917-11067939 TTAGATCACTTTTTCTATTTAGG + Intergenic
1173113028 20:40213208-40213230 CTATTTCACAATTTCCATTCTGG - Intergenic
1174964135 20:55192408-55192430 CTATTTCACTATTTAGATTTTGG + Intergenic
1178971911 21:37186766-37186788 CCAGTTCACCATTTTTATGAGGG - Intronic
1179335051 21:40443218-40443240 CTTGTTTAAGATTTCTATTTTGG - Intronic
1179342155 21:40522517-40522539 CTAGGTCACGTTTTCTCTTTGGG + Intronic
1182173861 22:28262782-28262804 CTAGTTCTCCATTTCTACTTGGG - Intronic
949158277 3:852326-852348 CCAGTTCACCCTTTCTCCTTAGG + Intergenic
949402346 3:3678941-3678963 CTAATTCCCCACTTTTATTTGGG - Intergenic
949453891 3:4217594-4217616 ATATTTCACGATTTCTTTTTAGG + Intronic
950133324 3:10562586-10562608 CTAGTCCTCCATCTCTTTTTAGG + Intronic
954235518 3:49254367-49254389 CTAGGTCCCCAAGTCTATTTGGG + Intronic
956319176 3:67976425-67976447 CTAGTTCTCCACTTCCATTTTGG + Intergenic
956343237 3:68249349-68249371 CTAGCTCAGCAATTCTACTTGGG + Intronic
958831431 3:99094908-99094930 CTAATTCAACCTTTCTATTTGGG - Intergenic
959428681 3:106224451-106224473 AGAGTTCACCATTTGAATTTTGG - Intergenic
960457625 3:117892418-117892440 CTGTTTCTCCATTTCTATTGGGG + Intergenic
960684095 3:120279946-120279968 CTACTTCACTATTTTTATTATGG + Intronic
963405894 3:144863840-144863862 CTAGATTTCCATTTCCATTTGGG + Intergenic
963677845 3:148335242-148335264 CTAGGTCACCAATTCTGTTTGGG - Intergenic
963723125 3:148886923-148886945 CTAGTTCACCATACAGATTTCGG - Intronic
966009906 3:175062156-175062178 CTAATTTAGCATTACTATTTGGG + Intronic
972089544 4:35264055-35264077 CTCTTACACCATTTCTATATTGG + Intergenic
973685858 4:53369106-53369128 CTAGTTCAACATTTGAACTTGGG - Intergenic
975577568 4:75877883-75877905 CTAGTTCATCGTTTCTGTCTGGG + Intronic
975962581 4:79930731-79930753 CTATTTCACTGTTTCTAATTTGG + Intronic
976337626 4:83908848-83908870 CTAGTTCCCCATATGCATTTAGG + Intergenic
980101309 4:128543883-128543905 CAAATTCACCATTTCCATGTTGG + Intergenic
980184074 4:129439849-129439871 GTGGTTCACAAGTTCTATTTTGG - Intergenic
980834149 4:138169989-138170011 ATAGGTCATCATTTCTACTTTGG + Exonic
981762252 4:148207404-148207426 CTAGTTCACAATTTCTAAGAAGG + Intronic
981917113 4:150046547-150046569 CTAGTTCCCCAGTCCTATTTTGG - Intergenic
982706893 4:158720170-158720192 GTAAATCACCATTACTATTTAGG + Intronic
984116239 4:175684232-175684254 CTAGTTTGCCATTTGTCTTTTGG + Intronic
986811650 5:11366025-11366047 CTAGTTCAGCCTCTCTATTCCGG + Intronic
988165339 5:27581941-27581963 TTAGTTTTCCATTTTTATTTGGG + Intergenic
988607495 5:32691529-32691551 CTGGTTCAGCTTTTCTCTTTGGG + Intronic
991953986 5:71973857-71973879 CAAGTCCACCATTTCCATGTAGG + Intergenic
993993829 5:94694782-94694804 CAAGTAAAACATTTCTATTTTGG - Intronic
995325309 5:110882874-110882896 CTTGTTCAGCATTTCATTTTTGG + Intergenic
996075386 5:119186725-119186747 CCATTTCTCCATTTCTGTTTTGG + Intronic
996188336 5:120507729-120507751 CTAGTTAACCATTTTTTTTAAGG + Intronic
998535760 5:142929502-142929524 ATAGTTCACCCTTTTTATCTTGG + Intronic
998965243 5:147532548-147532570 CAAATTCAACAATTCTATTTAGG - Intergenic
999116425 5:149168150-149168172 CTAGTTCACCAGTTCTCTATTGG - Intronic
999362210 5:150995340-150995362 ATAGTTCAGTATTTCTTTTTAGG - Intergenic
1001342504 5:170861219-170861241 CAAGTTCAGCATTTCCATTTGGG - Intergenic
1001386520 5:171343895-171343917 CTAGTTCAATAGTTCAATTTAGG + Intergenic
1001539853 5:172530193-172530215 GTAGATCCCCATTTCGATTTGGG + Intergenic
1004461462 6:15840821-15840843 CTACTTCTCCCTTTCTAGTTAGG + Intergenic
1004605621 6:17192536-17192558 CTAGTTGGCAATTTCTTTTTAGG - Intergenic
1005443989 6:25902266-25902288 CTAGTTCCTCATTTCTCTCTTGG + Intergenic
1009530365 6:64804397-64804419 ATGGTTCACCATTTAAATTTTGG - Intronic
1011866582 6:91836440-91836462 TTAATTCACCTTTTTTATTTAGG - Intergenic
1012376026 6:98562492-98562514 TTATTTCACCCTTTCTATTGTGG + Intergenic
1012906715 6:105075366-105075388 GTAGCTGAACATTTCTATTTTGG + Intronic
1013754360 6:113443604-113443626 CTAGTTTACCTGTTCCATTTAGG - Intergenic
1015166108 6:130201898-130201920 TTACTTCTCCATTTCTCTTTTGG + Intronic
1015712163 6:136154018-136154040 CTAGTATACCACTCCTATTTGGG + Intronic
1015975566 6:138787040-138787062 TTAGTTCAGCATTTGCATTTGGG + Intronic
1017255997 6:152334208-152334230 CTTATTCACCTTTTCTATTATGG + Exonic
1020499384 7:8897170-8897192 AGAGTTCACCATTTATATGTGGG + Intergenic
1020571853 7:9873246-9873268 CTAGTTGAACCTTTCTATTAGGG - Intergenic
1020786395 7:12578522-12578544 CTATTTCAACATTTAAATTTTGG + Intronic
1021551566 7:21876649-21876671 ATAGTTCACCATTTCTAGAATGG + Intronic
1022992182 7:35719407-35719429 CTAGTCCACTATTTCTCTTAAGG - Intergenic
1024288724 7:47784232-47784254 CTGCTTCAACATTTCTCTTTAGG + Intronic
1024391737 7:48821340-48821362 CTAGTTCACTAATTTTTTTTTGG - Intergenic
1026387772 7:69867564-69867586 CTAGTACAGCATTTCCTTTTTGG + Intronic
1027631633 7:80613516-80613538 CTACTTCATCTTTCCTATTTTGG + Intronic
1030450015 7:109696838-109696860 CTCTTTCGCCATTTTTATTTTGG - Intergenic
1031681720 7:124682915-124682937 CTAGTTCAAATTTTATATTTAGG + Intergenic
1041563183 8:59244229-59244251 TTAGTTGACCATATATATTTGGG - Intergenic
1044536782 8:93366099-93366121 CTAGTACACAATTTCTAAATGGG + Intergenic
1046096630 8:109570384-109570406 GTAGTTTCCCATTTCCATTTTGG - Intergenic
1048957208 8:139546988-139547010 CCAGTTCACCATTTCTCCCTAGG - Intergenic
1050037238 9:1450017-1450039 ATAACTCAACATTTCTATTTTGG + Intergenic
1050389774 9:5129256-5129278 CTACATCACTATTTCAATTTAGG - Intergenic
1050759810 9:9053872-9053894 CTAGTTATCCATTTAGATTTTGG - Intronic
1053127276 9:35592400-35592422 CTAGATCACCATCTCCTTTTTGG - Intergenic
1053602749 9:39627216-39627238 CAAGTACAACATTTCTGTTTGGG - Intergenic
1053860394 9:42380963-42380985 CAAGTACAACATTTCTGTTTGGG - Intergenic
1054250787 9:62715220-62715242 CAAGTACAACATTTCTGTTTGGG + Intergenic
1054564896 9:66749732-66749754 CAAGTACAACATTTCTGTTTGGG + Intergenic
1054821790 9:69529585-69529607 CTAGTTCACTAATTTCATTTTGG + Intronic
1055484294 9:76742225-76742247 CTAGTCCATCATTTATCTTTTGG - Intronic
1055971517 9:81916885-81916907 CTAGTCCTCTATTTCTGTTTAGG + Intergenic
1058036946 9:100263119-100263141 CTATTTCCTAATTTCTATTTTGG + Intronic
1058073717 9:100628751-100628773 CTAGTTCACCCTTATTCTTTGGG + Intergenic
1060000076 9:119950552-119950574 TTAGTTCACCCCTTCCATTTTGG + Intergenic
1186579377 X:10800917-10800939 CTAGTTTTACATCTCTATTTAGG - Intronic
1186978931 X:14938682-14938704 CTGATTCACCATTTTAATTTTGG - Intergenic
1187377671 X:18770611-18770633 TTAGTTGACCATTACTATTTGGG + Intronic
1187585290 X:20654213-20654235 TTACTTCAACAGTTCTATTTTGG + Intergenic
1188713831 X:33435755-33435777 CTAGCTCACCTTTTCTTTATTGG - Intergenic
1189194253 X:39139136-39139158 TTAGTTTAACAGTTCTATTTTGG - Intergenic
1189772583 X:44441236-44441258 GTTGTTGACCATTTCTGTTTTGG + Intergenic
1189772901 X:44443918-44443940 GTTGTTGACCATTTCTGTTTTGG + Intergenic
1190435026 X:50415743-50415765 CTAGTTCACCATTTCTATTTTGG + Intronic
1199588579 X:149442610-149442632 CTAGTTCACCATGACTAGGTAGG + Intergenic
1201483269 Y:14463787-14463809 GTACATCACCATTTCTATCTAGG + Intergenic
1202304368 Y:23452704-23452726 CTTGTTAACAATTTCTTTTTGGG - Intergenic
1202566442 Y:26217887-26217909 CTTGTTAACAATTTCTTTTTGGG + Intergenic