ID: 1190436656

View in Genome Browser
Species Human (GRCh38)
Location X:50432224-50432246
Sequence TCCCACTGCTTCCTGTGCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 205}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190436654_1190436656 14 Left 1190436654 X:50432187-50432209 CCACGCAGGTCTGCAAGGACTGT 0: 1
1: 0
2: 1
3: 6
4: 101
Right 1190436656 X:50432224-50432246 TCCCACTGCTTCCTGTGCTAAGG 0: 1
1: 0
2: 1
3: 30
4: 205
1190436652_1190436656 27 Left 1190436652 X:50432174-50432196 CCAGATCTTTCTACCACGCAGGT 0: 1
1: 0
2: 0
3: 6
4: 65
Right 1190436656 X:50432224-50432246 TCCCACTGCTTCCTGTGCTAAGG 0: 1
1: 0
2: 1
3: 30
4: 205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190436656 Original CRISPR TCCCACTGCTTCCTGTGCTA AGG Intronic
904395594 1:30219364-30219386 TCCCCCTGCTCCCTTTGCTCCGG - Intergenic
904897399 1:33827164-33827186 TCCCTCTGGTTCTTGTGCTAAGG - Intronic
907934568 1:59030861-59030883 TCCCTGAGCTTCCTGGGCTAAGG - Intergenic
910966688 1:92815145-92815167 TCCCTCTGCATCCTGTTCTTTGG - Intergenic
913160803 1:116144957-116144979 TCCCCCTCCTTCCAGTGCTAAGG + Intergenic
913558735 1:119996935-119996957 ACCCACTACCTCCTGTGCTAGGG + Intronic
913639113 1:120793536-120793558 ACCCACTACCTCCTGTGCTAGGG - Intergenic
914279339 1:146156418-146156440 ACCCACTACCTCCTGTGCTAGGG + Intronic
914540383 1:148607348-148607370 ACCCACTACCTCCTGTGCTAGGG + Intronic
914626262 1:149463866-149463888 ACCCACTACCTCCTGTGCTAGGG - Intergenic
919920625 1:202164591-202164613 TCCCCCTGCTGCCTATACTATGG - Intergenic
920205587 1:204288605-204288627 TCCCACTGCTTCCCATCCCAGGG - Intronic
921701917 1:218278523-218278545 GGTCCCTGCTTCCTGTGCTAGGG + Intergenic
922339765 1:224645863-224645885 CCCCACTGCTTCCTGCCCTTTGG - Intronic
1063819146 10:9814171-9814193 TCCCACTGCTTCCAGTTACATGG + Intergenic
1064244725 10:13659453-13659475 CCGCACAGCTTCCTGTGCTGGGG + Exonic
1069550466 10:69360561-69360583 TTCCTCTGCTTTCTGTGCCAAGG - Intronic
1069812530 10:71173005-71173027 TCCCACCTCTTCCTGTGCTCTGG - Intergenic
1069844059 10:71358511-71358533 TCCCCGTGCTTCCTGTGCCCTGG + Intronic
1072798447 10:98374705-98374727 TGCTCCTGCTTCCTGGGCTAAGG + Intergenic
1073089032 10:100917817-100917839 TCCTCCTGCTTCCTGTACTTTGG + Intronic
1074218312 10:111409832-111409854 TCCTACTTCCTCCTATGCTATGG + Intergenic
1075038309 10:119087638-119087660 CCCCACTGTTTTCAGTGCTATGG - Intergenic
1075612059 10:123862256-123862278 TGCCACTGCCTCGTGTGCCACGG + Intronic
1083598177 11:63929834-63929856 TCCCTCTGCTTTCTCTTCTAAGG + Intergenic
1084341090 11:68501836-68501858 TCCTAGCGCTTCCTGTGCTTTGG + Intronic
1084544481 11:69807842-69807864 GCCCGCTGCTTCCGGTGCCACGG - Intergenic
1085409006 11:76280790-76280812 CCCCACTGTTCCCTGTTCTAAGG - Intergenic
1088287662 11:108204642-108204664 TGCCACTGCTTCCTGTCATGTGG - Intronic
1088879941 11:113965204-113965226 TCCCACTGCTGCCTGGACTCTGG - Intergenic
1089129115 11:116198670-116198692 CCCCCCTGCTTCCGGTGCCAAGG - Intergenic
1090455943 11:126849839-126849861 CCTCACTGCTGCCTGTGCCATGG - Intronic
1092490971 12:8944673-8944695 ACCCACTGATTTTTGTGCTATGG - Intronic
1092843506 12:12564191-12564213 TCCCACTGCTCCCTGTCCTCTGG + Intergenic
1096492637 12:52021123-52021145 TCCCACTGCTTCTGGTCCCAGGG + Intergenic
1096753090 12:53775721-53775743 TTCCACTGGTTCCCGTGCTGGGG - Intergenic
1096814047 12:54190399-54190421 TCTCACTTCTTCCTGTTCTGGGG - Intergenic
1097376271 12:58846625-58846647 TGCCACTGCTTCCTGGGGAAGGG + Intergenic
1100407654 12:94285286-94285308 TCTCACTTCTTCCTGGGCAAGGG - Intronic
1103514791 12:121500503-121500525 TCCCACTGCTTCCTAGGCTGGGG + Intronic
1104749646 12:131230152-131230174 TCCAACTGTTTCCTGTCCTCTGG - Intergenic
1104764363 12:131316885-131316907 CCCCACTTCTGCCTGTGCAATGG - Intergenic
1105288724 13:19031171-19031193 TCCCATCGCTTCCTCTCCTAAGG - Intergenic
1108092727 13:46866338-46866360 TCTGCCTGCTTCCTGTCCTAGGG + Intronic
1109037059 13:57277324-57277346 TCCCTCTGCTTCATGTTGTAAGG - Intergenic
1110730716 13:78876372-78876394 TGCCACTGCTTCCTGTCACATGG + Intergenic
1112846157 13:103646693-103646715 GCCCACTGCTACCACTGCTAGGG - Intergenic
1113420205 13:110165227-110165249 TCCCACTGCATTCTGGGCTCTGG + Intronic
1113898037 13:113778002-113778024 GCCCACAGCTGCCTGTGCCAGGG + Intronic
1114062884 14:19037049-19037071 GCCCCCCGCTTCCTGGGCTAAGG - Intergenic
1114099375 14:19362948-19362970 GCCCCCCGCTTCCTGGGCTAAGG + Intergenic
1116871305 14:50071196-50071218 TCCCACTCCTTTCTCTTCTAAGG + Intergenic
1117662643 14:58023279-58023301 TGCCACTGCTTGGTGAGCTAAGG + Intronic
1117715070 14:58572096-58572118 TCACTCTCCTCCCTGTGCTAGGG - Intergenic
1121300017 14:92862735-92862757 TCCTGCTGCTTGCTTTGCTAAGG + Intergenic
1122652174 14:103231990-103232012 TGCCACTGCTCCCTGGGCTGCGG + Intergenic
1123113366 14:105883043-105883065 CCCCACTGCCTCCCCTGCTAGGG - Intergenic
1123402701 15:20003471-20003493 CCCCACTGCCTCCCCTGCTAGGG - Intergenic
1123512040 15:21010125-21010147 CCCCACTGCCTCCCCTGCTAGGG - Intergenic
1124343461 15:28904842-28904864 TCCCACTGCCTCGTGTGTCATGG - Intronic
1126354257 15:47778257-47778279 TTCCACTGCTCCCTGTGGTTGGG + Intergenic
1126724793 15:51621976-51621998 TCCCCCTGCCCGCTGTGCTAGGG - Intronic
1127764650 15:62173199-62173221 GCCCTCTGGTTCCTGTGCTGGGG - Intergenic
1128138011 15:65278250-65278272 TCCAACTGCTTCCTGCCCTAGGG + Intronic
1128686731 15:69691956-69691978 TCCAAATGCTTTCTGTGCTTTGG + Intergenic
1129077646 15:73010978-73011000 TCCTGCTGCTTCCTGTTCCATGG - Intergenic
1131206515 15:90452996-90453018 ACCCACTTCTTCCTGTGGTTAGG + Intronic
1133289934 16:4713745-4713767 TTTCACTGTTTCCTGAGCTATGG - Intronic
1133346261 16:5072547-5072569 TCCCACTTCTTCCTGAGATGGGG - Intronic
1133831642 16:9328874-9328896 TTCCACTTCTTCCAGAGCTATGG + Intergenic
1136008128 16:27345060-27345082 TCCCACAGCTGCCTGGGCTGAGG + Intronic
1141020244 16:80488750-80488772 TCCCAGAGCTTCCAGTTCTAAGG + Intergenic
1142142605 16:88479267-88479289 TACCACTGCTCTCTGTGCTTCGG + Intronic
1142161275 16:88558849-88558871 TCCCATGCCCTCCTGTGCTATGG + Intergenic
1143380090 17:6490653-6490675 CCCCACTGCTTCCTTTTCTAAGG - Intronic
1143434106 17:6909764-6909786 CCCCACTGATTCCTGTGGAAGGG - Intronic
1143671231 17:8397447-8397469 TCCCACTGGCTCCTGTGCTGAGG - Intronic
1144457554 17:15431501-15431523 ACCCAGTGCTGCCTGTGCCAGGG - Intergenic
1145717573 17:27036676-27036698 TCCCATTGCTTCCTCTCCTAAGG - Intergenic
1145989264 17:29069009-29069031 TCTCACTGCATCCTCTGCCAAGG + Intergenic
1147199772 17:38792854-38792876 TCCCACTGCTCCCTGTGAGGTGG + Intronic
1148844009 17:50518092-50518114 TCCCACTGCTTCCTGGGCCACGG + Intronic
1149413588 17:56434792-56434814 TCTCTCTTCTTCTTGTGCTATGG + Intronic
1150227110 17:63530231-63530253 TCCCAGAGCTTCCTGGGCTCCGG + Exonic
1151608093 17:75153343-75153365 TCCCACTGCTTTTTGGGCTTGGG - Intronic
1151841941 17:76625272-76625294 TCCCACTGTATCCTGTGCCTTGG + Exonic
1156490070 18:37490938-37490960 TCCCACCTCTTCCTGAGTTACGG + Intronic
1157738226 18:50069661-50069683 TCCCTGTGCTTCCTGTCCCATGG - Intronic
1157830419 18:50852114-50852136 TACCACTGGTTTCTGTGCCATGG - Intergenic
1160304576 18:77719909-77719931 CCCCACTGCTCGCTGTGCAATGG - Intergenic
1161295633 19:3518934-3518956 TCCCACTACCTCCTCTGGTAGGG + Intronic
1162121896 19:8475553-8475575 CCCCACTGCTCCCTGTGCACCGG - Intronic
1162475198 19:10895656-10895678 ACCCACTGCCCCCTGTGCTTAGG + Intronic
1163192268 19:15685987-15686009 TCCCACACCTTTCTGTGCTCTGG + Intronic
1163546875 19:17945940-17945962 TCACACTGCTTCCTGTTCAACGG + Intergenic
1163898531 19:20080460-20080482 TCCTTCTGCTTCTTGTGGTAGGG + Intronic
1164128156 19:22337200-22337222 TCCCAATGCTTTCTGTGTTAGGG + Intergenic
1164171323 19:22728126-22728148 TCCCAATGCTTTCTGTGTTAGGG - Intergenic
1164227845 19:23261578-23261600 TCACAATGCTTCCTGTGATCAGG + Intergenic
1164293497 19:23888394-23888416 TCACAATGCTTCCTGTGGTCAGG - Intergenic
1164471352 19:28537327-28537349 TCATGCTGCTTGCTGTGCTATGG - Intergenic
1167464738 19:49644860-49644882 TCCCACTCCACCCTGTGCTTGGG - Intronic
1167489000 19:49781196-49781218 CCCCACTGCCTCCTGTTCTCTGG - Intronic
1168161384 19:54512690-54512712 TCACACAGCCTCCTCTGCTAAGG - Intergenic
1168564697 19:57413229-57413251 TCCCACTTCTTACGGTGTTAAGG - Intronic
926052501 2:9753888-9753910 TCCCACGGCTGCCTCTGCTGTGG - Intergenic
926909834 2:17842278-17842300 TTCCACTGATCCTTGTGCTATGG + Intergenic
927408673 2:22800625-22800647 TCCCACTGCTGTCTGTGCTGGGG - Intergenic
928817573 2:35318063-35318085 TCCCACTGCTTCAGTTGCCAGGG + Intergenic
928904277 2:36354981-36355003 TCGCTCTGCTTTCTGTGCCAAGG - Intergenic
929165837 2:38880489-38880511 TCTCACTGGTTTCAGTGCTAGGG + Intronic
931066752 2:58596362-58596384 TCCCACTGCTCCTAGGGCTAGGG - Intergenic
931769998 2:65489163-65489185 TCCCACTGGACCCTGTGCTGGGG + Intergenic
934074097 2:88412801-88412823 TCCCTGTGGTTCCTGTGCTGTGG - Intergenic
934219165 2:90065536-90065558 TCCCAGTGACTCCTGTGATAGGG - Intergenic
934871396 2:97869623-97869645 TCCCTTTGCTTCCTGTGGTGTGG - Intronic
937484276 2:122297764-122297786 TCTCACTGCCTCCTGGGCTCTGG - Intergenic
938480276 2:131657320-131657342 TTCCACTGCACCCTGGGCTATGG - Intergenic
940020185 2:149148105-149148127 TTCCAGTGCCTCCTGTTCTATGG + Intronic
943503513 2:188722956-188722978 TCTCCCTTCTCCCTGTGCTATGG - Intergenic
943693522 2:190895809-190895831 GGCCACTGCTTCCTGTGTAATGG + Intronic
945000655 2:205346514-205346536 TCCCCTGGCTTACTGTGCTAAGG + Intronic
946359246 2:219209286-219209308 TCCAACTGCAGCCTGTGCTAGGG + Exonic
947155904 2:227163548-227163570 TCTCGCCGTTTCCTGTGCTACGG - Intronic
1170928273 20:20745415-20745437 ACCCACTCCTGCCTCTGCTAAGG + Intergenic
1171445076 20:25196961-25196983 TCCCACCGCCTCCTGTGTAAAGG + Intronic
1172224708 20:33297608-33297630 TCCCACTTTTTCCTTTACTACGG + Intronic
1172525538 20:35598975-35598997 TCCTACTGCTGCCTGTACTTGGG - Intergenic
1172962609 20:38809149-38809171 TCCCACCTCCTCCAGTGCTAGGG + Intronic
1173583643 20:44165508-44165530 TCCCTCTGATTGCTGTGTTAGGG - Intronic
1173906996 20:46636753-46636775 TCCCACTGCTTCTTGGGCCCTGG + Intronic
1175735183 20:61380902-61380924 TCCCACATCTTCCCCTGCTAAGG - Intronic
1178879383 21:36436457-36436479 TCCCACAGCTTGCTGAGCTTTGG + Intergenic
1179574447 21:42298977-42298999 CCCCACTGCTTTTTGTGTTAAGG + Intergenic
1180481378 22:15759676-15759698 GCCCCCCGCTTCCTGGGCTAAGG - Intergenic
1181131772 22:20736328-20736350 TCCCCTTGCTTGCTGTGCTGTGG - Intronic
1181465748 22:23109763-23109785 TCCCACAGCTTCCAGGGCTGGGG - Intronic
1182761779 22:32728343-32728365 CCCCTGTGCTTCCTGTGCTCCGG + Intronic
1184089518 22:42284888-42284910 TCCCAATGCTTCCTGGGCCTTGG - Intronic
1184568624 22:45308749-45308771 TCCCACTGTTTTCTGGGCTCTGG + Intergenic
1184598813 22:45530442-45530464 TCCCACTGCTACCAGTGCCATGG + Intronic
1184924282 22:47626263-47626285 TCCCACAGGTTCCTGTGATTAGG - Intergenic
1184925990 22:47637790-47637812 TCCCAGGGCTTCCTCTTCTAAGG - Intergenic
953160607 3:40416008-40416030 ACACACAGCTTCCAGTGCTATGG + Exonic
955158531 3:56441920-56441942 TCCCACTGCTTGCGAGGCTAAGG + Intronic
955395806 3:58556423-58556445 TCCCCCAGTTTCCTGAGCTAAGG + Intergenic
955675510 3:61444068-61444090 ACCCAAAGATTCCTGTGCTATGG - Intergenic
961434958 3:126910487-126910509 TCGCACTGCTGCCTGTGTTCAGG + Intronic
961714945 3:128851813-128851835 TCCCACTGCTGCTGGTGCTCTGG + Intergenic
961774601 3:129275342-129275364 TGCCACTGGATCCTGGGCTAAGG + Intronic
962481782 3:135804165-135804187 CACCACTGCTTCTTGTGCTGTGG - Intergenic
963723746 3:148895198-148895220 TCTCACTGCTCCCTTTGCTCTGG + Intronic
964717934 3:159742247-159742269 TTGCGCTTCTTCCTGTGCTAGGG + Intronic
964850790 3:161094166-161094188 TCACTATGCTTCCTATGCTAAGG + Intronic
965518227 3:169645339-169645361 TCCCATTGCTTCCTTTGCATGGG + Intronic
968873152 4:3251592-3251614 AGCCACAGCTTCCTCTGCTAAGG - Intronic
968928995 4:3566166-3566188 TCCCACTGCTTCCAGAGCCAAGG + Intergenic
969276585 4:6139911-6139933 TCCCCTGGCTTCCTGTGCTTTGG - Intronic
970734168 4:19146618-19146640 TCCCTCTTTTTCCTGTGCTCTGG + Intergenic
974515089 4:62897915-62897937 TGCCACTGCTTCCTGTTGTGTGG - Intergenic
977003745 4:91538472-91538494 TCCAACTTCTTCCAGTGCTGAGG - Intronic
978766281 4:112408350-112408372 GGCCAGTCCTTCCTGTGCTAAGG - Intronic
981652941 4:147079543-147079565 TCTGCCTGCTTCCTGTGCCAAGG + Intergenic
982418326 4:155163499-155163521 TGCCACAGCTTCTTGTGCCAGGG + Intergenic
982461566 4:155675953-155675975 TCCCACTTGGTCCTGTCCTAAGG + Intronic
984313190 4:178090848-178090870 TGCCACTGCTTCCTGTCATGTGG - Intergenic
984459041 4:180009420-180009442 ACCCCCTGCTTCCTGGCCTATGG + Intergenic
985852207 5:2397175-2397197 TCCCACTGCCTCCTCTCCCAGGG + Intergenic
986793861 5:11190432-11190454 TCCAACGGCTGCCTGTGCCATGG + Intronic
987031490 5:13980480-13980502 TCCCCCTCCTTCCATTGCTAAGG + Intergenic
988963104 5:36389374-36389396 TTCCACTGCTTCTTTTGCTGTGG + Intergenic
992564877 5:77986924-77986946 GCCCATGGCTTCCTGTGCTGGGG + Intergenic
997913521 5:137900558-137900580 TCCCCCTGCTTCCAGGGCAATGG - Intronic
1000095762 5:157969567-157969589 TCCCTCTGTTACCTGGGCTAGGG - Intergenic
1000565293 5:162839641-162839663 ACCCACTGCTTCATTTGATAAGG + Intergenic
1001087425 5:168710894-168710916 ACCCACCGCTTCCAGTGCAAAGG - Exonic
1001451357 5:171827119-171827141 TGCCACTGCTACCTATTCTACGG - Intergenic
1002417609 5:179128824-179128846 CACCACTGCTTCCTGGGCTTAGG + Intronic
1002542269 5:179914062-179914084 TCACACAGCTCCCTGGGCTATGG - Intronic
1006613908 6:35312053-35312075 TCCCACTCCTTCCTGTCTTAAGG - Intronic
1009649823 6:66461327-66461349 TCACATTTCTTCCTCTGCTATGG + Intergenic
1009884232 6:69605173-69605195 TCCCACTTTTCCCTGTGCTTTGG - Intergenic
1010833730 6:80561566-80561588 TCCCAAAGTTTCCTGTGCCATGG + Intergenic
1011133527 6:84075516-84075538 TCCTCCTGCTTTCTGAGCTAAGG + Intronic
1012132861 6:95519005-95519027 TGCCACTGCTTCCTGTCATGTGG + Intergenic
1014248768 6:119094995-119095017 TCCCACTGCTTCCTTGGTAAAGG + Intronic
1014286587 6:119505666-119505688 TCCCAAAGCTTCCTGTACTGGGG + Intergenic
1018040140 6:159914769-159914791 TCCCAGTGGTTCCTGTGGGACGG + Exonic
1019978700 7:4605221-4605243 TCCAACTGGTGCCTCTGCTAGGG + Intergenic
1020006402 7:4785663-4785685 GCCCACTTCTTCCTGAGCCACGG + Exonic
1020937291 7:14483551-14483573 TCCCACTGCTAACTGTCCTCTGG - Intronic
1023258503 7:38335609-38335631 TCCTACTGCCTTCTGTGCTAGGG - Intergenic
1023259162 7:38341265-38341287 CCCCACTGCCTTCTGTGCTAGGG - Intergenic
1023259635 7:38345594-38345616 TCCTACTGTCTTCTGTGCTAGGG - Intergenic
1023260106 7:38349919-38349941 TCCTACTGTCTTCTGTGCTAGGG - Intergenic
1023260570 7:38354278-38354300 TCCTACTGTCTTCTGTGCTAGGG - Intergenic
1023261085 7:38359074-38359096 TCCTACTGTCTTCTGTGCTAGGG - Intergenic
1023261542 7:38363423-38363445 TCCTACTGTCTTCTGTGCTAGGG - Intergenic
1023882279 7:44327100-44327122 TCCCTCTGCTTCCTCAGCTGGGG - Intronic
1024762386 7:52614623-52614645 TTCCACTTCTTCCTGAGTTATGG - Intergenic
1025748856 7:64272949-64272971 TCCCATTTATTTCTGTGCTATGG + Intergenic
1026563531 7:71470449-71470471 TCCCAGTGCTTCCTGTGTAAAGG + Intronic
1027539880 7:79453581-79453603 CACCACTGCTTCCTCTGCTGCGG - Intergenic
1027746570 7:82082166-82082188 TGCCACTGCTTCCTGATGTATGG + Intronic
1028439305 7:90840556-90840578 TCCCATCCCTTCCTTTGCTAGGG + Intronic
1033640337 7:143257030-143257052 TCCCACTGCTTCCTTTTAAATGG - Intronic
1034587559 7:152108537-152108559 TCCCAGGGCTTCCTCTGCAATGG - Intronic
1036058155 8:5283520-5283542 TCCCAACCCTTCCTGTACTATGG - Intergenic
1037707337 8:21326255-21326277 TCCCACTGCTGTCTGAGCTTGGG - Intergenic
1038416096 8:27397214-27397236 TCTCACAGCTGCCTTTGCTAAGG + Intronic
1039072540 8:33659930-33659952 TCCCACTGCTTCCTGTCACATGG - Intergenic
1044749328 8:95401082-95401104 TCCCACTGCTTCCTGAGGGCAGG + Intergenic
1046341646 8:112866043-112866065 TCCTACTGCCTGCTGTTCTAAGG + Intronic
1047678861 8:127233105-127233127 TCCCTCTGCTTCCTGTAGAATGG - Intergenic
1048180910 8:132193402-132193424 TCGCACTGGTTCCTGTCCTGAGG - Intronic
1051994632 9:23200413-23200435 TCCTACATCTTCCTGTACTATGG + Intergenic
1054141567 9:61535373-61535395 TCCCACTGCTTCCAGAGCCAAGG - Intergenic
1054192002 9:61991142-61991164 TCCCCCTGCTTCCAGAGCCAAGG + Intergenic
1054461264 9:65466096-65466118 TCCCACTGCTTCCAGAGCCAAGG - Intergenic
1054646377 9:67596648-67596670 TCCCCCTGCTTCCAGAGCCAAGG - Intergenic
1057070733 9:92097656-92097678 TCCCACTCCTTCCTCTGCCCAGG - Intronic
1059736470 9:117105031-117105053 TCCCACTCCTCCCTGTGGGATGG + Intronic
1062543283 9:137050945-137050967 ACCCACAGCTTCCTCTGCTATGG - Exonic
1062597391 9:137305445-137305467 TCAGGCTGCTTCCTGGGCTAGGG - Intergenic
1190436656 X:50432224-50432246 TCCCACTGCTTCCTGTGCTAAGG + Intronic
1192220618 X:69195224-69195246 TCACACGGCTTCCTCTGCTGAGG + Intergenic
1192364660 X:70461480-70461502 TCTCACTGCTTTGTGTGCTCGGG + Intronic
1192863141 X:75100408-75100430 TACCACTGCTTTCAGTGCTTAGG + Intronic
1192996892 X:76521255-76521277 TCCCAATGACTCCTGTGCAAGGG - Intergenic
1193917902 X:87388540-87388562 TCAAGCTGCTTCCTGTGCCATGG - Intergenic
1196783286 X:119401104-119401126 GCACAATGCTTCCTGTCCTATGG - Intronic
1197272901 X:124445328-124445350 TTCAAATGCTTCCTGTGTTAGGG - Intronic
1197339918 X:125254999-125255021 TCCCATTTCTTCCTTTGGTATGG + Intergenic
1199704417 X:150411484-150411506 TGCCACTGCTCCCTGTGCTTTGG + Intronic
1199748748 X:150794407-150794429 TCCCACTGTTTCCTTTGGTCCGG - Intronic
1200256711 X:154586220-154586242 CCCCACCGCTTCCCGTGCCAGGG + Exonic
1200261058 X:154618183-154618205 CCCCACCGCTTCCCGTGCCAGGG - Exonic