ID: 1190437040

View in Genome Browser
Species Human (GRCh38)
Location X:50435814-50435836
Sequence CAGTGGTAGGTGAGAGCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 460
Summary {0: 1, 1: 0, 2: 1, 3: 35, 4: 423}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190437040 Original CRISPR CAGTGGTAGGTGAGAGCAGG AGG Intronic
902871250 1:19314814-19314836 CAGTGGTGGCTGAGAACATGAGG + Intronic
903336767 1:22629565-22629587 GAGTGCCAGGTGAGAGTAGGAGG + Intergenic
903358245 1:22761309-22761331 CAGTGGTCGCGGAGAGCGGGAGG + Intronic
903744284 1:25576281-25576303 CTTTGGGAGGTGAAAGCAGGTGG + Intergenic
904197144 1:28794412-28794434 CAGTGGCAGGCTAGGGCAGGGGG - Intergenic
904597255 1:31654673-31654695 GTGTGGAGGGTGAGAGCAGGAGG + Intronic
904627711 1:31816185-31816207 CAGAGGTAGGTGGGTGCATGGGG + Intergenic
904648557 1:31987068-31987090 CTGTGAGAGGTGTGAGCAGGTGG + Intergenic
904670441 1:32160911-32160933 CTTTGGTAGGCCAGAGCAGGTGG + Intronic
905702489 1:40028646-40028668 AAGTGGGAGGTGAGAAAAGGGGG - Intergenic
906013609 1:42552886-42552908 CAGTGTGAGGGGAGACCAGGTGG - Intronic
906649674 1:47503706-47503728 CAGAGGAAGGTGAGAGCCTGGGG + Intergenic
906720218 1:47998592-47998614 CAGAGGTAGCTTAGAGAAGGAGG + Intergenic
907407107 1:54260395-54260417 CAGTGGTCAGGGAGGGCAGGAGG + Intronic
907407305 1:54261534-54261556 TGGTGGAAGGTGAGAGGAGGAGG + Intronic
907633297 1:56106573-56106595 CAGTTGATGGTGAGGGCAGGTGG + Intergenic
907948637 1:59159149-59159171 CAGTAGTAGGAGATAGGAGGGGG + Intergenic
910243668 1:85115699-85115721 CAGGGGGAGGTGGGGGCAGGGGG + Intronic
910655377 1:89612974-89612996 CTGTGGGAGGTAAGAGCAAGTGG + Intergenic
911120886 1:94295205-94295227 CAGTTATAGGTTAGAGAAGGTGG + Intergenic
912246787 1:107968296-107968318 GAGCAGTAAGTGAGAGCAGGAGG + Intergenic
912552047 1:110490724-110490746 CAGTAGGTGCTGAGAGCAGGAGG + Intergenic
912697858 1:111855072-111855094 CAGGGGGTGGTGAGAGCAGCTGG - Intronic
912865500 1:113252645-113252667 CAAGGGGAGGTGTGAGCAGGTGG + Intergenic
913679620 1:121176803-121176825 CAATGGGAGTTGAGAGGAGGAGG - Intronic
914031454 1:143964450-143964472 CAATGGGAGTTGAGAGGAGGAGG - Intronic
914157993 1:145103514-145103536 CAATGGGAGTTGAGAGGAGGAGG + Intronic
915053513 1:153103142-153103164 CAGTGTTAGGAGTGAGCAGGTGG - Intronic
916493975 1:165328062-165328084 CAGTGGAAGGAGAGATAAGGAGG + Intronic
917926249 1:179791389-179791411 CCTTGGAAGGAGAGAGCAGGGGG - Intronic
918004244 1:180526769-180526791 CAGTGGTGTGGGAGAGAAGGGGG + Intergenic
918976234 1:191490000-191490022 CACTTGTAAGTGAGAGCATGTGG + Intergenic
919508383 1:198429291-198429313 CAGTGGTAAGTGTGCGCATGTGG + Intergenic
920466926 1:206195347-206195369 CAATGGGAGTTGAGAGGAGGAGG - Intronic
921165551 1:212504277-212504299 TACTGGAAGGTGAGACCAGGGGG + Intergenic
921555500 1:216593827-216593849 CTGAGGTGGGTGAGACCAGGAGG - Intronic
922132365 1:222792512-222792534 CAGTGGTAGGCAAGAAAAGGGGG - Intergenic
923994050 1:239471632-239471654 CAGTGGGAGAGGAGAGAAGGGGG - Intronic
1063040492 10:2332643-2332665 CAGTGGGAGGTGGGAGCTGAGGG - Intergenic
1066011952 10:31202391-31202413 CAGGGGTGGGGCAGAGCAGGAGG - Intergenic
1066067378 10:31772198-31772220 CAGTGCCAAGGGAGAGCAGGAGG + Intergenic
1067485514 10:46646276-46646298 GAGGGGTAGGTGGGAGCTGGTGG - Intergenic
1067609244 10:47695376-47695398 GAGGGGTAGGTGGGAGCTGGTGG + Intergenic
1070003895 10:72403458-72403480 CTTTGGTAGGTCAAAGCAGGAGG - Intronic
1070041537 10:72785321-72785343 AAGTGGTAGGGGGCAGCAGGAGG - Intronic
1071292654 10:84198600-84198622 CTGTGGTGGTGGAGAGCAGGTGG - Intronic
1071439898 10:85680899-85680921 CACTTGTAAGTGAGAGCATGTGG - Intronic
1072018954 10:91379781-91379803 CAGGGGCAAGTGAGAGGAGGGGG + Intergenic
1073053340 10:100683733-100683755 CACAGGTAGGTGACAACAGGTGG - Intergenic
1074301244 10:112234983-112235005 GAGTGGGCGGTGAGAGCAGGAGG + Intergenic
1074912633 10:117925444-117925466 CAGGGGGAGGTAAGAGCAGGCGG - Intergenic
1075589969 10:123684195-123684217 CAGTGGAAGGTCTGGGCAGGTGG + Intronic
1077156263 11:1093076-1093098 CAGGGGAAGGTGAGAGCCCGAGG - Intergenic
1078059716 11:8035423-8035445 CAGCGGGAAGTGAGAGCAGTGGG - Intronic
1078441563 11:11372633-11372655 CAGGGGCAGGGGAGAGCAGAAGG + Intronic
1078452809 11:11453028-11453050 CAGGGCTGGGTGAGGGCAGGGGG - Intronic
1078706442 11:13748312-13748334 CAGTGGTTAAGGAGAGCAGGAGG - Intergenic
1079105951 11:17572512-17572534 CAGAGGGCGGTGAGAGTAGGAGG - Intronic
1080875051 11:36267248-36267270 CAGTGGTGGGGAGGAGCAGGTGG - Intergenic
1081574462 11:44310492-44310514 CAGTGGAAGGAGAGAGGAGGAGG - Intergenic
1083102922 11:60328784-60328806 AACTGGTAGGGGAGAGCAGCAGG + Intergenic
1083266019 11:61547093-61547115 CAGAGGTGGGTGGGGGCAGGAGG + Intronic
1083281166 11:61628127-61628149 CCTTGGAAGGTGAGAGCAGGAGG + Intergenic
1083301784 11:61743506-61743528 CAGAGGGAGAGGAGAGCAGGGGG - Intronic
1085101058 11:73800409-73800431 GAGTGGGTGGTGAGAGCAGTGGG - Intronic
1085529457 11:77182912-77182934 CAAGGGTAGGGGTGAGCAGGTGG + Intronic
1085865282 11:80283403-80283425 CAGTGGGAAGAGGGAGCAGGAGG - Intergenic
1086607552 11:88714276-88714298 CAGTGGTAGGTGAAAGGGGAGGG + Intronic
1089214448 11:116827342-116827364 CAGTGGTAGATGGGAGGAAGAGG - Intergenic
1089638152 11:119829810-119829832 CAGTGGAAGATGAGTCCAGGAGG - Intergenic
1089761097 11:120723973-120723995 CAGTGGTTGCCAAGAGCAGGGGG - Intronic
1089766667 11:120772611-120772633 GGCTGGTAGGTGAGAACAGGTGG + Intronic
1089797491 11:120993594-120993616 CTGTGGTAGGTGGGAGTAAGGGG - Intergenic
1090397226 11:126427020-126427042 CAGTGTCAGGTGGGAGCAGAAGG - Intronic
1091090707 11:132768846-132768868 CACAGGTAGGTGAAAGCAGTGGG + Intronic
1091626383 12:2124078-2124100 CAGTGGAAGGAGAGACCAGAGGG - Intronic
1091945722 12:4539549-4539571 CAGTGGGAGGTGAGGTTAGGGGG + Intronic
1093011372 12:14110961-14110983 GAGTGGAAGGTAAGGGCAGGAGG + Intergenic
1093322715 12:17734017-17734039 CAGTGGTAGCAGAGAAGAGGAGG - Intergenic
1094736471 12:33240428-33240450 CAGTGGCAGGAGAGAACAAGGGG - Intergenic
1096453573 12:51766659-51766681 CAGAGGTAGAAGAGAGCAGGTGG - Intronic
1096653768 12:53075703-53075725 CAGTGGGTGGGCAGAGCAGGGGG - Intronic
1097147475 12:56951705-56951727 CTGGGGTGGGTGTGAGCAGGTGG - Exonic
1097190021 12:57215226-57215248 CAGTAGTAGGTGGGAACAGTGGG - Intergenic
1097705385 12:62863270-62863292 CTTTGGGAGGTGAGAGCAGGGGG - Intronic
1098365956 12:69703312-69703334 CAGGGGTAGGCGAGAGGAGGAGG + Intergenic
1098878946 12:75896928-75896950 CACTTGTAAGTGAGAGCATGGGG - Intergenic
1099950872 12:89302432-89302454 CTTTGGGAGGTCAGAGCAGGGGG + Intergenic
1100144470 12:91660518-91660540 CAGAGGTAGATGAGGGGAGGGGG + Intergenic
1101718261 12:107330116-107330138 CTGTGGCAGGGGAGAGCATGGGG + Intronic
1102820713 12:115907065-115907087 CTTTGGGAGGTGGGAGCAGGTGG + Intergenic
1103512626 12:121485613-121485635 CAGTGGGAGGGGAGAACGGGGGG + Intronic
1103677972 12:122671465-122671487 CACTTATAAGTGAGAGCAGGTGG + Intergenic
1105007318 12:132729485-132729507 GAGGGGAAGGTGAGAGGAGGGGG + Intronic
1106384964 13:29275503-29275525 TAGTGGTGGGTGGGAGCAGAGGG - Intronic
1107262783 13:38515104-38515126 GAGTGGTAGGAGAGAGCATCAGG - Intergenic
1107697621 13:43015850-43015872 CAGTGGAAGGAGAGGGGAGGAGG - Intergenic
1108200344 13:48037405-48037427 CCGAGGTTGGTAAGAGCAGGCGG + Intergenic
1109602304 13:64647748-64647770 CAGTGGTTGGTGAGGGTATGGGG + Intergenic
1110311545 13:74055907-74055929 CAGTGGTAGATGTGCACAGGTGG + Intronic
1110680730 13:78309069-78309091 AAGTGGGAGGTGAGGGAAGGAGG + Intergenic
1112092848 13:96100558-96100580 CAGTAGTAGGAGAGAGCCGAAGG + Intronic
1113409437 13:110071978-110072000 CACTAGTAAGTGAGAGCATGTGG + Intergenic
1113735371 13:112674770-112674792 CAGGGAGAGGTGGGAGCAGGTGG + Intronic
1114395703 14:22358367-22358389 CACTTGTAGGTGAGAACATGTGG + Intergenic
1114626798 14:24135816-24135838 CAGGGGAAGAAGAGAGCAGGTGG + Intergenic
1114726329 14:24941545-24941567 CAGGGGGAGGAGGGAGCAGGAGG + Intronic
1114730293 14:24986040-24986062 TTGTGGAAGGTGAGAACAGGTGG + Intronic
1114898985 14:27032732-27032754 CATTGGTAGGTGTGAGTAGAAGG + Intergenic
1115017609 14:28635893-28635915 CACTGATAAGTGAGAGCATGCGG + Intergenic
1115981071 14:39052071-39052093 CACTTGTAAGTGAGAGCATGTGG - Intronic
1117304848 14:54463238-54463260 CAATGGGAGGTGGGAGCGGGAGG - Intergenic
1117320616 14:54619717-54619739 CACTGGTAAGTGAGAACATGCGG + Intronic
1117930755 14:60838630-60838652 CAGTGGGAGCTGGGAACAGGTGG + Intronic
1118416405 14:65541511-65541533 CTCTGGTATTTGAGAGCAGGAGG + Intronic
1118753046 14:68820327-68820349 AAGGGGGAGGTGAGGGCAGGTGG - Intergenic
1118878720 14:69808225-69808247 AAGTGGTGGGTTAGAGAAGGGGG + Intergenic
1119485662 14:74984974-74984996 CTGTGGGAGGTGGGAGCAAGAGG + Intergenic
1119636559 14:76278084-76278106 GAGGGGTAGGTTGGAGCAGGGGG + Intergenic
1120235834 14:81889914-81889936 CAGTGGGAGGTGGGAGGTGGGGG - Intergenic
1121411479 14:93751369-93751391 AAGTGGTAGGGTGGAGCAGGGGG - Intronic
1122079580 14:99257501-99257523 CTTTCGTGGGTGAGAGCAGGTGG + Exonic
1122141332 14:99664609-99664631 AAGTGGGAGCTGAGGGCAGGGGG - Intronic
1122148009 14:99705453-99705475 CTTTGGAAGGCGAGAGCAGGAGG - Intronic
1122298708 14:100719801-100719823 CAGGGGCAGGTGGCAGCAGGGGG + Intergenic
1122757904 14:103997280-103997302 CAGCGGTAGGGGACAGGAGGTGG + Intronic
1123977036 15:25563495-25563517 CAGTGGTTGGGGTGACCAGGGGG - Intergenic
1123986253 15:25648966-25648988 CACTGGTAGCTGAGAGCATCTGG - Intergenic
1124562267 15:30785834-30785856 CTTTGGGAGGTGAAAGCAGGAGG + Intergenic
1124918267 15:33998007-33998029 AAGTGGAAGGAGAGAGCAGAAGG - Intronic
1128107574 15:65055898-65055920 CAGAGGCAGGAGAGGGCAGGGGG + Intronic
1128332778 15:66766705-66766727 GTGTGATAGGTGAGAGGAGGGGG - Intronic
1129109516 15:73329431-73329453 CAGTGTGAGGGAAGAGCAGGAGG - Intronic
1129327623 15:74809465-74809487 GAGGGGTCGGGGAGAGCAGGTGG + Intergenic
1129889958 15:79065449-79065471 CCGTGGGAGGAGAGAGCAGCAGG + Intronic
1130355353 15:83124952-83124974 CAGGAGGAGGTGACAGCAGGAGG - Intronic
1130577790 15:85107583-85107605 CAGTGGAAGGAGAGGGGAGGGGG + Intronic
1132288664 15:100684226-100684248 CACTTGTAGGTGAGAACATGTGG + Intergenic
1132450576 15:101966010-101966032 CTGTGGTGGGTGGGTGCAGGTGG + Intergenic
1132555837 16:572286-572308 CAGTGGTCAGAGAGGGCAGGCGG - Intronic
1132582020 16:689128-689150 CAGAGGCAGGTCAGGGCAGGTGG - Intronic
1132655896 16:1041543-1041565 CAGGGGAAGGTGGGAGCTGGGGG - Intergenic
1132764445 16:1527160-1527182 CAGGCTCAGGTGAGAGCAGGAGG - Intronic
1132846184 16:2001914-2001936 CAGTGGGAAGGGAGAGGAGGAGG + Intronic
1133053392 16:3131920-3131942 CACTGTCAGGTCAGAGCAGGAGG + Intronic
1133059592 16:3165670-3165692 CAGTGATAGGTGAGGTCACGTGG + Intergenic
1133647245 16:7775849-7775871 CAGGGAGAGGGGAGAGCAGGGGG + Intergenic
1134617327 16:15661685-15661707 CATTGGTAGGCCAAAGCAGGTGG - Intronic
1138430076 16:56962942-56962964 CAGTTGGGGGTGGGAGCAGGGGG + Intronic
1138560994 16:57801116-57801138 CAGTGGTGGGTGAATGCAGAGGG + Intronic
1140067138 16:71621165-71621187 GAGAGGTAGGTTAGACCAGGAGG + Intergenic
1140326060 16:74004957-74004979 CAGTGGTGGGTCATGGCAGGTGG + Intergenic
1141234486 16:82202958-82202980 TGGTGGTAGGTGAGAACATGTGG + Intergenic
1141479125 16:84294691-84294713 CAGTGGGCGGTGGCAGCAGGAGG - Exonic
1142690670 17:1604726-1604748 CAGCAGGAGGTGAGGGCAGGGGG - Intronic
1143020938 17:3916939-3916961 CAGTGGGAGAGGAGAGCTGGGGG - Intergenic
1143711756 17:8740603-8740625 CAGAGGTAGGAGAGAGAGGGAGG + Intronic
1146173964 17:30653017-30653039 CAGTGGAAGGTGGGAGCGGCGGG + Intergenic
1146347419 17:32069039-32069061 CAGTGGAAGGTGGGAGCGGCAGG + Intergenic
1146589151 17:34113315-34113337 CTTTGGGAGGTGAAAGCAGGAGG + Intronic
1147332474 17:39706969-39706991 CACTGGCAGGAGAGAGCAGATGG - Exonic
1148083005 17:44977773-44977795 CAGGGGTAGGAGTGAGCAGAGGG - Intergenic
1148794298 17:50189787-50189809 CGGTGGCAGGTGAGGGCAGCTGG - Intronic
1149256975 17:54837354-54837376 CAGTGGGAGCTGGGAACAGGGGG - Intergenic
1149395641 17:56239591-56239613 CAGAGGTAGGTGATACCATGAGG - Intronic
1151330455 17:73403445-73403467 GAGCGTGAGGTGAGAGCAGGAGG - Intronic
1151335609 17:73437950-73437972 CAGTGCTGGGTGAGAGAGGGTGG - Exonic
1151366934 17:73623651-73623673 CAGTGTCAGGTGAGATCAGGGGG - Intronic
1151560150 17:74865694-74865716 GAGTGGTAGGTCAGGGCTGGCGG - Intronic
1151601140 17:75106919-75106941 CTTTGGGAGGTCAGAGCAGGAGG + Intergenic
1153518421 18:5927497-5927519 CAGTGCTTGTTGAGAGCAGGAGG + Intergenic
1153552222 18:6273584-6273606 CAGTCGGAAGTGGGAGCAGGCGG + Intronic
1153747567 18:8195653-8195675 CACTTGTAAGTGAGAACAGGTGG - Intronic
1155215638 18:23641211-23641233 CAGTGGGAGCTGGAAGCAGGTGG + Intronic
1155247090 18:23920828-23920850 CAGCTGAAGCTGAGAGCAGGGGG + Intronic
1155322174 18:24630569-24630591 CACGGGTAGGTGGCAGCAGGTGG - Intergenic
1155611136 18:27669155-27669177 CAGTGGGAGGGGAGGGCAAGTGG - Intergenic
1156542511 18:37928935-37928957 CACTGATAGGTGAGAACATGTGG + Intergenic
1157108234 18:44794733-44794755 CAGTGGTATGTGAAGGTAGGAGG - Intronic
1157202014 18:45667696-45667718 TGGTGGCAGGTGACAGCAGGTGG + Intronic
1157320173 18:46628289-46628311 CAGTGCTAGGTGGGAGCAGATGG + Intronic
1157327783 18:46681385-46681407 CAGTGGGAGATGAGAGGAGGGGG - Intronic
1157619632 18:49008860-49008882 CAGTGGTGGGTTTCAGCAGGAGG + Intergenic
1157893212 18:51438635-51438657 CAGAGGCAGGAGAGGGCAGGAGG + Intergenic
1158160489 18:54477625-54477647 CAGTGGTGGGGAGGAGCAGGAGG + Intergenic
1159331399 18:66998591-66998613 CACTTGTAAGTGAGAGCAAGTGG - Intergenic
1160353089 18:78201682-78201704 CAATGGTAGGTGAGCGAAGAGGG - Intergenic
1160922799 19:1528680-1528702 AGGTGGGAGGTGTGAGCAGGTGG - Intronic
1161284870 19:3463809-3463831 CGGTGGGAGGTGAGAGCGAGTGG + Intronic
1161865764 19:6831119-6831141 CTGTGGTAGGTGAGGGTGGGAGG + Intronic
1161956697 19:7500024-7500046 CAGTGAGAGGTCAGAGCAAGAGG - Intronic
1161967054 19:7554738-7554760 CCGAGGTGGGTGAGATCAGGGGG - Intronic
1162320613 19:9969088-9969110 AGGTGGAAGGTCAGAGCAGGGGG + Intronic
1162569056 19:11460335-11460357 CAGTGGGGGATGGGAGCAGGGGG - Intronic
1162988450 19:14287019-14287041 CAGTGGAAGGTGGGAGCGGCAGG - Intergenic
1163097131 19:15067298-15067320 CTTTGGGAGGTGAGGGCAGGAGG + Intergenic
1163498484 19:17661363-17661385 CAGTTGAAGGAGAGAGAAGGAGG + Intronic
1164522536 19:28990138-28990160 CAGAGGCTGCTGAGAGCAGGTGG + Intergenic
1165256468 19:34579550-34579572 GGGTGGTAGGTGAGTGCAGTGGG + Intergenic
1165856399 19:38881242-38881264 CAGTGGGAGTTGGGAGCAGTGGG + Intronic
1166130662 19:40743901-40743923 CACTGGGCGGTGAGTGCAGGTGG - Exonic
1166714424 19:44957554-44957576 CAGGGCTAGGCAAGAGCAGGAGG - Intronic
1167225709 19:48238132-48238154 CACTGGGAGGCGAGGGCAGGTGG - Intronic
1167464913 19:49645599-49645621 CAGTGCTGGGAGAGGGCAGGAGG + Intronic
1167466678 19:49653884-49653906 GAGGGGCCGGTGAGAGCAGGTGG + Intronic
1167989202 19:53343497-53343519 CATTGGCAGGTGGGGGCAGGGGG - Intronic
1168250713 19:55140214-55140236 CTTTGGGAGGTGAAAGCAGGTGG + Intronic
1168353103 19:55687591-55687613 CAGGGGCAGGGAAGAGCAGGAGG + Intronic
1168630125 19:57949902-57949924 CAGTGCTGGCTGAGGGCAGGAGG + Intergenic
925140917 2:1549410-1549432 CAAGGGTGGGTGAGGGCAGGAGG - Intergenic
926116550 2:10217365-10217387 CCGTGGTAGGTGAGGGCTGGAGG - Intergenic
926879925 2:17533668-17533690 CACTGGGAGGTGAAAGCAGGAGG + Intergenic
928680790 2:33700273-33700295 CAGTGGGAGGAGGGTGCAGGTGG - Intergenic
928812170 2:35241332-35241354 CACTTGTAGGTGAGAACATGTGG - Intergenic
929425655 2:41841972-41841994 CAGTGGCAGTTGAGAACAGCAGG + Intergenic
929431433 2:41890699-41890721 CACTGGTAGTTGAGGGCATGTGG + Intergenic
930000304 2:46856700-46856722 CAAGGGGAGGTGAGAGAAGGAGG + Intronic
932770187 2:74496846-74496868 CAGTGTGAGGGGAGAGGAGGGGG - Intergenic
936613103 2:114020670-114020692 CAGTGGAATGTGAGTGGAGGAGG + Intergenic
937081578 2:119144100-119144122 CACTTATAGGTGAGAACAGGAGG - Intergenic
937126313 2:119476983-119477005 CAGGGGTAGGGGAGGGAAGGTGG + Intronic
937238468 2:120444884-120444906 CAGTGCTAGGTGTTGGCAGGAGG + Intergenic
937345216 2:121121163-121121185 CTGTGGAAGGGGAGGGCAGGGGG + Intergenic
937905875 2:127052519-127052541 CAGTGGTAGGAGAGAGGATGTGG - Intronic
938225463 2:129612093-129612115 CACTGGTAGTTGAGAGTGGGTGG - Intergenic
939152128 2:138485511-138485533 AAGTGGGAGCTGAGAGAAGGAGG + Intergenic
940812641 2:158262660-158262682 TAGTGGCAGGAGAGAGCAAGGGG + Intronic
940910588 2:159206346-159206368 CAGGGGTCTGTGAGACCAGGAGG - Intronic
940973691 2:159921042-159921064 CATTGGGAGTTCAGAGCAGGAGG - Intergenic
942198577 2:173547817-173547839 CAGTTATAGGTAAGAGCTGGTGG + Intergenic
942298076 2:174536519-174536541 CAGTGGTGTGTCAGAGCAGATGG - Intergenic
942659178 2:178246092-178246114 TGGAGATAGGTGAGAGCAGGTGG - Intronic
943444790 2:187971158-187971180 CATTTGTAGGTGAGAACATGTGG + Intergenic
943669321 2:190644659-190644681 CACTTGTAAGTGAGAGCATGAGG - Intergenic
943960112 2:194253852-194253874 CAGTGGTAATAGAGAGCAAGGGG + Intergenic
945119106 2:206440577-206440599 CAGTCGTAGGTGAAGGCAGGTGG - Intergenic
945152132 2:206802767-206802789 GAGTGCGAGGTGAGAGTAGGAGG + Intergenic
946274767 2:218622874-218622896 CAGTGGTAAGAGAAATCAGGTGG + Exonic
946427952 2:219609324-219609346 CAGAGGCAGCTGTGAGCAGGCGG - Intronic
946486284 2:220103615-220103637 AAGTGGAGGGTGAGAGGAGGTGG - Intergenic
947277386 2:228407943-228407965 GAGTGGTAGAAGAGAGCATGTGG - Intergenic
948693930 2:239723256-239723278 CAGTTCTAGGACAGAGCAGGAGG - Intergenic
948888536 2:240896006-240896028 CAGTGGCAGGTGAGGGCCAGTGG + Exonic
1169355502 20:4901620-4901642 CAGTGGGAGGGGAGGGCAGCCGG - Intronic
1170221427 20:13946599-13946621 CAGTGGAAGCTGGGAACAGGAGG + Intronic
1174609457 20:51787176-51787198 CTTTGGGAGGTCAGAGCAGGTGG + Intronic
1174725669 20:52859228-52859250 TGGTGGTAGGTGTGAGCAAGTGG - Intergenic
1175015898 20:55790340-55790362 CAAAGGCAGGTGAGAGCAGCCGG - Intergenic
1176099835 20:63359960-63359982 CAGGGGTGGGAGAGAGCCGGAGG - Intronic
1176415663 21:6473296-6473318 CAGAGCTGGGTGAGACCAGGCGG + Intergenic
1177408088 21:20696373-20696395 CAATGGTAGATTTGAGCAGGCGG + Intergenic
1177614892 21:23503941-23503963 TAGTGGGAGTTGGGAGCAGGTGG + Intergenic
1177834096 21:26170734-26170756 CAGCGGTAGGCGAGAGCACGCGG - Intronic
1178099247 21:29249386-29249408 CACTTGTAAGTGAGAGCATGTGG + Intronic
1179542385 21:42091924-42091946 CAGTGCCAGGTCAGTGCAGGAGG + Intronic
1179691163 21:43081628-43081650 CAGAGCTGGGTGAGACCAGGCGG + Intergenic
1179724681 21:43335511-43335533 CTGGGGTAGGAGAGGGCAGGAGG + Intergenic
1179933144 21:44585193-44585215 CTGTGGCAGGTGTCAGCAGGAGG - Intronic
1180841650 22:18961723-18961745 AAGTGGTAGGTGAGAGCGGCAGG - Intergenic
1180841662 22:18961776-18961798 ATGTGGTAGGTGAGAGCGGCAGG - Intergenic
1181059838 22:20277070-20277092 ATGTGGTAGGTGAGAGCGGCAGG + Intronic
1181284204 22:21740309-21740331 CAGCTGTAGGTGAGAGCTCGGGG - Intergenic
1181310736 22:21943502-21943524 TAGTGATGGGTGCGAGCAGGAGG - Intronic
1181412026 22:22730834-22730856 AAGAGGTAGAAGAGAGCAGGTGG - Intergenic
1181546754 22:23606650-23606672 CAGTGGTAGGGAAGAGCGGAGGG + Intergenic
1182118924 22:27774484-27774506 CAGTGGGAGCTGAAAGCAGGAGG - Intronic
1182192539 22:28477782-28477804 CAGTTGTACGAGAGGGCAGGTGG - Intronic
1183035350 22:35136916-35136938 CATTGAGAGGTGAGGGCAGGTGG - Intergenic
1183191676 22:36325603-36325625 CGGTGGCAGGTGAGGGCAGCCGG + Intronic
1183536414 22:38404216-38404238 CAGTGCTAGGGGAGGGCGGGAGG - Intergenic
1185261795 22:49870052-49870074 CACTGATAGGTGAGAACATGTGG + Intronic
1185338586 22:50281755-50281777 CAGTGGTCGGGGTGAGGAGGAGG + Intronic
1185380642 22:50506198-50506220 TAGTGGTAGGTGAGGGCTGCAGG + Exonic
949156569 3:834110-834132 CACTGATAAGTGAGAGCACGTGG - Intergenic
950100346 3:10352791-10352813 CAGGGGCAGGAGACAGCAGGGGG - Intronic
950841645 3:15973855-15973877 CAGGGATAGCTGAGAGCAAGTGG - Intergenic
950922294 3:16706868-16706890 GAGCTGTAGGTGAGAGCAGTGGG + Intergenic
951688283 3:25369047-25369069 CAGTGGTGGGAGAGAGGAGTAGG + Intronic
953882778 3:46700285-46700307 CACTGGCAGGTGACCGCAGGTGG + Intergenic
954083641 3:48227038-48227060 CAATGATAGGTGGGAGCTGGTGG + Intergenic
954722761 3:52579775-52579797 CAGTGGGAATTGAGAGCAGGAGG - Intronic
955331316 3:58049900-58049922 CAGTAGTGGGTGAGATCAGAGGG - Intronic
956981638 3:74645592-74645614 CAGGGCTGGGTGGGAGCAGGAGG - Intergenic
957096810 3:75784813-75784835 CAGTGGGAGGTTAGACCAGAGGG + Exonic
957343477 3:78931022-78931044 CAATGGGAGGTGAGAGGAGCAGG - Intronic
958004879 3:87798169-87798191 CAGTGTTAGTTTGGAGCAGGTGG - Intergenic
958433670 3:94071977-94071999 CAGTGGCAGGTGTGTGCAAGGGG + Intronic
958731313 3:97963369-97963391 CTTTGGGAGGTCAGAGCAGGAGG - Intronic
958898192 3:99853911-99853933 CAGTGAGAACTGAGAGCAGGAGG + Intronic
959284017 3:104383976-104383998 CACTTATAGGTGAGAGCAAGTGG - Intergenic
959358845 3:105366194-105366216 GAGTGGTGGGGGTGAGCAGGGGG + Intergenic
960044239 3:113180629-113180651 GAGTGGTAGGAAACAGCAGGGGG + Intergenic
961230754 3:125305566-125305588 CTTTGGGAGGTGAAAGCAGGAGG + Intronic
961454738 3:127018285-127018307 CACTGGCAGGTGCGGGCAGGTGG + Exonic
961543507 3:127616812-127616834 GAGTGGGAAGTGAGAGGAGGAGG - Intronic
962904537 3:139789857-139789879 CAGTGGAAGGTAAGAAAAGGAGG + Intergenic
963762794 3:149301238-149301260 CAGGGGTAGTGGAGAGCAAGTGG - Intergenic
964666388 3:159178780-159178802 CAGTTGTAGGAGAAAACAGGAGG + Intronic
964729837 3:159853082-159853104 CAGGGGAAGGTGACAGCAGATGG + Intronic
965725938 3:171715996-171716018 CAGTTATAAGTGAGAACAGGTGG + Intronic
965772579 3:172196427-172196449 CTTTGGTAGGTCAGGGCAGGAGG - Intronic
966881771 3:184354690-184354712 CAGTGGAGGGGGAGGGCAGGGGG + Intronic
967267091 3:187700327-187700349 CAGTGCTGGGTGAGAGCTGCAGG + Intronic
967390155 3:188947504-188947526 CGGTGGTAGGAGAGAGCCAGAGG + Intronic
967978859 3:195053118-195053140 GAGTGGGAGGTGGGAGCGGGAGG - Intergenic
968320471 3:197763531-197763553 CTTTGGGAGGTGAGAGCAAGAGG + Intronic
968403263 4:316817-316839 CAGTGGGAGGTGAGCTCAGGGGG + Intergenic
968581068 4:1395469-1395491 CAATGGCACGTGTGAGCAGGCGG - Exonic
968610002 4:1552589-1552611 CAGTGGGAGGTGAGGGGAGAGGG + Intergenic
968726008 4:2248128-2248150 CAGTGGGAGGTTGGAGCATGTGG + Exonic
968755240 4:2412327-2412349 CAGTGGGTGGTGTAAGCAGGCGG - Intronic
969441987 4:7222711-7222733 CTGTGGCAGGAGAGAGCGGGAGG + Intronic
969575591 4:8034421-8034443 CAGGTGCAGGTGAGTGCAGGTGG + Intronic
969575606 4:8034471-8034493 GGGTGGTAGGTGGGTGCAGGTGG + Intronic
969575646 4:8034586-8034608 GTGTGGTAGGTGGGTGCAGGTGG + Intronic
970229077 4:13890673-13890695 AAGTGGGAGGTGTGAGCATGAGG - Intergenic
970254735 4:14155567-14155589 CAGTGGGCGTTGAGAGGAGGTGG + Intergenic
970704729 4:18786420-18786442 CACTTGTAAGTGAGAGCATGTGG - Intergenic
970761645 4:19496556-19496578 TAGTGGTGGGGGAGAGTAGGAGG + Intergenic
971522739 4:27574869-27574891 CACTGATAGGTGAGAACATGCGG + Intergenic
971628367 4:28954849-28954871 CAGTTGTAAGTGAGAACATGTGG + Intergenic
973747074 4:53974175-53974197 CAGTTATAAGTGAGAACAGGAGG + Intronic
974897797 4:67960076-67960098 CATTTATAGGTGAGAGCATGTGG - Intronic
978184801 4:105844455-105844477 CAGTGGAAGGTGAAATCAGTAGG - Intronic
980415427 4:132482755-132482777 CTGTGGTTGGAGAGAGCAGATGG + Intergenic
980513003 4:133818303-133818325 CAGTTATAAGTGAGAGCATGTGG - Intergenic
980791976 4:137632161-137632183 CAGTGGCAGCACAGAGCAGGGGG - Intergenic
982968319 4:161945172-161945194 CAGTGGAAGAAGAGAGCAGGAGG - Intronic
983258820 4:165432860-165432882 CAGTGCTTGGTGAGGGCTGGAGG - Intronic
986418952 5:7557596-7557618 CAGTTATAAGTGAGAGCATGAGG + Intronic
986480433 5:8181206-8181228 CAGTGGTTGGAGAGAGCACAAGG + Intergenic
987289417 5:16494541-16494563 CAGGAGTAAGAGAGAGCAGGGGG - Intronic
988871055 5:35390491-35390513 CACTTATAGGTGAGAGCATGTGG - Intergenic
989182408 5:38591748-38591770 CATTGCTAGGTGGGAGAAGGGGG + Intronic
989797227 5:45490573-45490595 AAGTGGTAGGTGTGAACTGGAGG - Intronic
990049582 5:51481030-51481052 CAGTGTAAGCTGAGAGCAGGTGG - Intergenic
993135563 5:83957275-83957297 CAGAGGAAGATGATAGCAGGGGG - Intronic
996787493 5:127256023-127256045 CAGTGGTTGGTTTGAGCTGGGGG - Intergenic
997381388 5:133440784-133440806 AAGTGGTGGGTGAGGGCTGGGGG - Intronic
997564556 5:134876966-134876988 CAGTGGTGAGTTAGAGCAGCAGG + Intronic
999175583 5:149629554-149629576 CAGTGACAGGAGAGGGCAGGAGG + Intronic
999720575 5:154396372-154396394 AGGTGATAGGTGGGAGCAGGTGG + Intronic
1000607785 5:163343039-163343061 CCTTGGGAGGTGAAAGCAGGAGG + Intergenic
1002991689 6:2245030-2245052 GAGGGGCAGGTGAGAGCGGGCGG + Intronic
1003102631 6:3188632-3188654 CAATGGTAGGTGCCAGAAGGAGG + Intergenic
1003261196 6:4517565-4517587 CTGTGGCCGGTCAGAGCAGGAGG + Intergenic
1003972267 6:11310975-11310997 CAGTGGCAGGTGACAGGTGGAGG - Intronic
1003975165 6:11336078-11336100 CTGAGGGAGGTGAGGGCAGGAGG - Intronic
1004420499 6:15465203-15465225 CAGTGCTATGGGAGATCAGGTGG + Intronic
1004923091 6:20395202-20395224 CGGAGGTAGGTGAGAGCAGGGGG + Intergenic
1005000255 6:21233106-21233128 CCATGGTAGGTGAGAGCAGCAGG - Intergenic
1005436964 6:25822961-25822983 CAGTGGTGGGGGAGGGCAGGAGG - Intronic
1006190037 6:32202020-32202042 GAGGGGTGGGTGAGAGGAGGAGG - Intronic
1007152639 6:39709483-39709505 CAGTAGGAGGTGAGTGCTGGTGG - Intronic
1007227413 6:40324858-40324880 CTTTGGAAGGTGAGTGCAGGTGG + Intergenic
1008125476 6:47663623-47663645 CAGTGTAAGGGGAGAGCAGGAGG + Intronic
1009847022 6:69146606-69146628 CAGTGGTAGCTGGGAACAGGTGG - Intronic
1011399833 6:86948550-86948572 CAGTGGGAGGTGAGAGGAAGTGG - Intronic
1012103725 6:95125689-95125711 GTGTGGGAGGTGAAAGCAGGTGG + Intergenic
1012338610 6:98090747-98090769 CACTGGTGAGTGAGAGCATGTGG + Intergenic
1012462388 6:99478038-99478060 AAGTGGTAGGTAGGAGGAGGGGG + Intronic
1013313093 6:108915801-108915823 CAGTTGGAGGTGAGTGCATGGGG + Intronic
1013470724 6:110461409-110461431 CAGGGGTAGGGGCCAGCAGGGGG - Intronic
1013654274 6:112228920-112228942 CAGTGGTAGGAAAGACCAGCTGG + Intronic
1014023042 6:116613195-116613217 CACTTATAGGTGAGAGCATGTGG - Intergenic
1014311714 6:119812007-119812029 CAGAAGCAAGTGAGAGCAGGAGG - Intergenic
1015797983 6:137032237-137032259 CAGTGGCAGGAGACAGCTGGTGG + Intronic
1016305365 6:142678504-142678526 CAGTGTTAGGTGAGGGCACCTGG + Intergenic
1018431915 6:163729515-163729537 CAGAGGAAGGTGAGAGTAGGTGG + Intergenic
1018710776 6:166496958-166496980 GAGTGGTGGGTGAGGGCAGCGGG - Intronic
1019567497 7:1691688-1691710 CAGTGGCCGGTGAGAGCCGAGGG + Intronic
1019575765 7:1736989-1737011 CAGGGGTAGCTGGGGGCAGGTGG - Intronic
1019729537 7:2622636-2622658 CAGTAGGAGTTGAGAGGAGGAGG - Intergenic
1019729541 7:2622661-2622683 CAGGGGGAGGTGGGGGCAGGAGG - Intergenic
1019729552 7:2622686-2622708 CAGGGGGAGGTGGGGGCAGGAGG - Intergenic
1019920766 7:4161848-4161870 CAGTGGCAGGTAAGAGCGCGGGG + Exonic
1020661539 7:10989872-10989894 CAGTGGGAGGTTGAAGCAGGAGG - Intronic
1022019238 7:26382384-26382406 GAGTGGAGGGTGGGAGCAGGTGG + Intergenic
1022249603 7:28594090-28594112 CACTGGGAGGTGGGGGCAGGGGG - Intronic
1022488361 7:30797816-30797838 CAGTAGTAGAAGAGAGCTGGTGG + Intronic
1022531758 7:31071278-31071300 CAGTGAAGTGTGAGAGCAGGAGG - Intronic
1026308976 7:69167401-69167423 CAGTGGGAGGTGAGTGCTTGTGG - Intergenic
1026434452 7:70383183-70383205 CAGTAGAAGATGAGAGGAGGAGG + Intronic
1026739953 7:72972858-72972880 GAGTGGTTGGTGACAGCAGCCGG + Intergenic
1026797219 7:73374011-73374033 GAGTGGTTGGTGACAGCAGCCGG + Intergenic
1027103780 7:75392212-75392234 GAGTGGTTGGTGACAGCAGCCGG - Intergenic
1028881961 7:95890429-95890451 CGGTGGAGGGTGAGAGGAGGAGG + Intronic
1029610092 7:101622201-101622223 CTGTGGGAGGTGAGAGGTGGGGG + Intronic
1030414700 7:109227996-109228018 CAGTGGGAGGTGAGAAGAAGAGG + Intergenic
1030524581 7:110637664-110637686 CAGTGGATGGTAAGAGCAGTAGG + Intergenic
1030940844 7:115647775-115647797 CAGTGGTTGCTGAGAGCCAGGGG + Intergenic
1031456786 7:121990761-121990783 CTTTGGGAGGTGAGGGCAGGCGG - Intronic
1031920515 7:127596880-127596902 CAGTGGTAGCTGGGAGAGGGAGG - Intronic
1032222574 7:130005891-130005913 CAGTGGAAGGGGAAAGCAGCTGG - Intergenic
1032404350 7:131644889-131644911 GGGTGGGAGGAGAGAGCAGGTGG - Intergenic
1035083498 7:156236747-156236769 CAGATGTTGGAGAGAGCAGGTGG + Intergenic
1035674906 8:1449671-1449693 CAGCAGAAGGTGGGAGCAGGGGG + Intergenic
1036079195 8:5534980-5535002 CAGTGTTAGGTGAGAGCTTTGGG + Intergenic
1036697978 8:10991227-10991249 CCGCAGTAGGTGAGAGTAGGGGG + Intronic
1036822239 8:11950352-11950374 CAGTGGCAGGTGAGCCCTGGAGG - Intergenic
1037469502 8:19193614-19193636 CAGCAGGAGGTGAGAGCAGCAGG + Intergenic
1037953424 8:23034481-23034503 CATTGGGAGGTCAGGGCAGGAGG + Intronic
1038009662 8:23464975-23464997 CACTGGTAGGTGAGAGAAAAGGG + Intergenic
1038259600 8:25981296-25981318 CAGTGCTAGGTGAGGGAAGATGG - Intronic
1038518955 8:28212736-28212758 CTGTGGGAGGTCAAAGCAGGAGG + Intergenic
1039447181 8:37642201-37642223 CAGGGGCAGGTGAAAGCAGGAGG + Intergenic
1040406230 8:47105960-47105982 CTTTGGGAGGTCAGAGCAGGAGG - Intergenic
1040545734 8:48396836-48396858 CCGGTGGAGGTGAGAGCAGGGGG - Intergenic
1040598069 8:48859435-48859457 CACTGGGAGGTGGGAGCAGCAGG - Intergenic
1041955935 8:63558415-63558437 CAGTGGGAGCTGGGAACAGGTGG + Intergenic
1043079469 8:75747898-75747920 CATTTGTAAGTGAGAGCATGTGG - Intergenic
1043329953 8:79103526-79103548 CAGTTGTAAGTGAGAACATGTGG - Intergenic
1044080016 8:87872326-87872348 CAGTGGGAGAGGAGAGGAGGGGG - Exonic
1044619309 8:94173260-94173282 CAGTGGGAGGTGGGATCATGGGG + Intronic
1045299888 8:100901903-100901925 TAGAGGTAGCTCAGAGCAGGTGG - Intergenic
1046105099 8:109655647-109655669 AAGTGGTAGAAGAAAGCAGGAGG - Intronic
1047338112 8:123955276-123955298 CAGTGGGTGGGGAGAGAAGGAGG + Intronic
1047937599 8:129797734-129797756 CAGTGGGAAGAGAGAGAAGGGGG + Intergenic
1048739941 8:137545333-137545355 CAGTAGGAGGTGAGAGTAGAGGG + Intergenic
1049172729 8:141171957-141171979 CTGTGGTAGGTGTGAACAGTGGG + Intronic
1049561708 8:143315420-143315442 CAGTGATAGGTGAGATCACGTGG - Intronic
1053034957 9:34817486-34817508 CTTTGGGAGGTGAAAGCAGGAGG - Intergenic
1053231465 9:36413553-36413575 CAGTGGTTGCTGGGAGCAGGGGG + Intronic
1056406057 9:86276324-86276346 CAGCAGGAGGTGAGAGCAGCAGG - Intronic
1057882575 9:98803621-98803643 TATTGGAAGGAGAGAGCAGGGGG + Intergenic
1059501338 9:114756700-114756722 AAAGGGTAGGTGAGAGCAGGTGG + Intergenic
1060106983 9:120878675-120878697 GTGAGGCAGGTGAGAGCAGGGGG - Intronic
1060375645 9:123113542-123113564 CATTGGAAGAGGAGAGCAGGTGG - Intronic
1061178997 9:129013111-129013133 CAGTGGGAGGGGACACCAGGCGG + Intronic
1062495458 9:136829480-136829502 CAGTGGTAAGAGGGAGCTGGCGG + Exonic
1062579165 9:137221975-137221997 CTGGGGCAGGTGAGCGCAGGGGG - Intergenic
1062614649 9:137390882-137390904 CAGTGGACGCTGAGGGCAGGGGG + Intronic
1185929804 X:4189760-4189782 GAGAGGTAGGAGAGAGCAAGAGG + Intergenic
1186223822 X:7376248-7376270 CAGTGGGAGCTGGGAACAGGCGG - Intergenic
1186446901 X:9637855-9637877 CAATGGTAGGTGAGAGGAGCTGG - Intronic
1186997377 X:15138364-15138386 CACTGGTAGGGGAGAGGAGAAGG + Intergenic
1188843745 X:35047712-35047734 CAGTGGCAGCTGAGAGAATGAGG - Intergenic
1190276365 X:48902122-48902144 GAGGGGCAGGTGAGACCAGGCGG + Intronic
1190330402 X:49231830-49231852 CTGTGGAAGGTGAAAGCAGTGGG - Exonic
1190437040 X:50435814-50435836 CAGTGGTAGGTGAGAGCAGGAGG + Intronic
1190691806 X:52918831-52918853 CAGGGGTCGGGGAGAGCATGAGG - Intergenic
1190694177 X:52936961-52936983 CAGGGGTCGGGGAGAGCATGAGG + Intronic
1191136993 X:57075603-57075625 CAGTGGTTGGGGATAGGAGGAGG - Intergenic
1191739273 X:64419250-64419272 GAGTGGAAGGTGAGAGGAGGGGG - Intergenic
1191858206 X:65644593-65644615 CAGTGGCAGCTCAGGGCAGGGGG + Intronic
1192691748 X:73372572-73372594 CAGTGGTTGGTGGGAGTGGGGGG + Intergenic
1193056727 X:77160082-77160104 CAGTGATGGGAGAGAGCAGATGG - Intergenic
1194116559 X:89906214-89906236 CACTTGTAAGTGAGAGCATGTGG - Intergenic
1195447674 X:104972396-104972418 TAGTGGTGGGGGAGTGCAGGTGG + Intronic
1196515658 X:116606968-116606990 CTGTGGGAGGTGAGATTAGGGGG + Intergenic
1196586578 X:117436109-117436131 CAGGGGTAGAGGAGAGAAGGGGG - Intergenic
1197169949 X:123421708-123421730 CAGTGGGAGCTGAGGGAAGGTGG - Intronic
1197408697 X:126088740-126088762 CACTTGTAAGTGAGAGCGGGCGG - Intergenic
1198794134 X:140377861-140377883 CAGTTGTAAGTGAGAACATGTGG - Intergenic
1199500510 X:148501260-148501282 CAGAGGTGGCTGAGAGCAAGTGG - Intronic
1199775671 X:151009253-151009275 CGGTGGCAGGAGACAGCAGGAGG - Intergenic
1200469358 Y:3563397-3563419 CACTTGTAAGTGAGAGCATGTGG - Intergenic
1200758976 Y:7018718-7018740 CAATGGTAGGTGAGAAGAGCTGG - Intronic
1200812020 Y:7495574-7495596 CTTTGGAAGGTGAAAGCAGGAGG + Intergenic
1201243497 Y:11980843-11980865 CTTTGGTAGGTCAGGGCAGGAGG - Intergenic