ID: 1190437044

View in Genome Browser
Species Human (GRCh38)
Location X:50435841-50435863
Sequence TGTCAGGTAAGGTCACCTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 1, 3: 42, 4: 161}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190437036_1190437044 16 Left 1190437036 X:50435802-50435824 CCTCTGTACCACCAGTGGTAGGT 0: 1
1: 0
2: 0
3: 9
4: 88
Right 1190437044 X:50435841-50435863 TGTCAGGTAAGGTCACCTCAGGG 0: 1
1: 0
2: 1
3: 42
4: 161
1190437037_1190437044 8 Left 1190437037 X:50435810-50435832 CCACCAGTGGTAGGTGAGAGCAG 0: 1
1: 0
2: 2
3: 14
4: 160
Right 1190437044 X:50435841-50435863 TGTCAGGTAAGGTCACCTCAGGG 0: 1
1: 0
2: 1
3: 42
4: 161
1190437039_1190437044 5 Left 1190437039 X:50435813-50435835 CCAGTGGTAGGTGAGAGCAGGAG 0: 1
1: 0
2: 2
3: 23
4: 239
Right 1190437044 X:50435841-50435863 TGTCAGGTAAGGTCACCTCAGGG 0: 1
1: 0
2: 1
3: 42
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190437044 Original CRISPR TGTCAGGTAAGGTCACCTCA GGG Intronic
900202371 1:1415355-1415377 TGTCAGGTCAGGTAGCCTCGGGG + Intergenic
902402249 1:16164650-16164672 AGTCAGGTAAGGGCACTTCCTGG - Intergenic
902650552 1:17834566-17834588 TGTCAGGTAAGGACTCCTTTAGG + Intergenic
903192516 1:21664618-21664640 TGCCAGGCAAGGACTCCTCAAGG + Intronic
905061036 1:35139231-35139253 TGTCAGGTCAGGTAGCCTCAGGG + Intergenic
906042075 1:42795322-42795344 TGCCAGGTCTGCTCACCTCATGG - Intergenic
906201987 1:43966388-43966410 GGTCAGGTGAGGACAGCTCAAGG - Intronic
906499204 1:46328704-46328726 TGTCAGGTCAGATAGCCTCAGGG + Intergenic
907630122 1:56072640-56072662 TGTCAGAGAAGCTAACCTCAGGG - Intergenic
908626444 1:66049305-66049327 TGTCAGGTCAGTTACCCTCATGG + Intronic
910852848 1:91665582-91665604 TGTCAGGTCAGGTAGCCTCAGGG + Intergenic
911628263 1:100152039-100152061 TGACAGGGAAGGTCAGTTCATGG + Intronic
912816145 1:112830272-112830294 TGTCAGGTCAGGTAGCCCCAGGG - Intergenic
913971262 1:143420056-143420078 TGCAAGGTAAGGTCCCCTCCAGG - Intergenic
914046848 1:144100689-144100711 TATCATGTAATGACACCTCATGG - Intergenic
914065639 1:144245669-144245691 TGCAAGGTAAGGTCCCCTCCAGG - Intergenic
914113512 1:144720685-144720707 TGCAAGGTAAGGTCCCCTCCAGG + Intergenic
914131261 1:144859997-144860019 TATCATGTAATGACACCTCATGG + Intergenic
915069745 1:153256407-153256429 TATCAGGCAAGGTTAACTCAGGG + Intergenic
916698368 1:167264185-167264207 TGTCAGGAAAGGTCTCTTTAAGG + Intronic
917115939 1:171603655-171603677 TTTCAGGTCAGGTAGCCTCATGG - Intergenic
917444586 1:175096286-175096308 TGACAGGTTAGGTCATCTCAAGG + Intronic
918960659 1:191272664-191272686 TCTCAGGTACGGTCACCCCATGG + Intergenic
920381277 1:205535952-205535974 TCTCAAGTACGTTCACCTCAGGG - Intergenic
920450291 1:206055742-206055764 TGTCAGGTCAGGTAGCCCCAGGG - Intronic
921074756 1:211691446-211691468 TGTCAGGTCAGGTAGCCCCAGGG - Intergenic
921571290 1:216781970-216781992 TGTCAGCTGAGGTGACCGCAAGG - Intronic
921927265 1:220721806-220721828 TGTCAGGTCAGGTAGCCCCAGGG - Intergenic
922316093 1:224443516-224443538 AGACAGGAAAGGTCAGCTCAGGG + Intronic
924858961 1:247901453-247901475 TGTCAGGTCAGGTGGCCTCAGGG + Intergenic
924864350 1:247961279-247961301 TGTCAGGTCAAGTAACCTCAAGG + Intronic
1065062087 10:21912856-21912878 TGTCAGGGAGGGTGACCTCCAGG + Intronic
1065802300 10:29363580-29363602 TGTCAGGTCAGGTAGCCTCAGGG + Intergenic
1065931127 10:30480070-30480092 TGTCAGGTCAGGTAGCCCCAGGG - Intergenic
1068671686 10:59729599-59729621 TGTCAGGTCAGGTAGCCTCAGGG + Intronic
1068675680 10:59767076-59767098 TGTCAGGTCAGGTAGCCCCAGGG + Intergenic
1069049659 10:63779031-63779053 TTTGAGGTGAGGTCAACTCATGG + Intergenic
1072334920 10:94389465-94389487 TGTCAGGTCAGGTAGCCCCAGGG - Intergenic
1072689067 10:97558602-97558624 TGTCAAGTCAGGTAGCCTCAGGG + Intronic
1077310495 11:1886861-1886883 TGCAAGGTAAGGTCCCCTCCAGG + Exonic
1078157362 11:8810500-8810522 TTTCAGGTAAGGGCAGCTCCGGG - Intronic
1080718603 11:34827500-34827522 TGTCAGGTATAGTCAGCTCTAGG - Intergenic
1083082103 11:60104500-60104522 TGTCAGGTCAGGTAGCCTCAGGG + Intergenic
1083090002 11:60190046-60190068 TGTCAGGTCAGGTAGCCCCAGGG - Intergenic
1083721137 11:64604090-64604112 TGTCAGGATATTTCACCTCAGGG - Intergenic
1084931912 11:72562507-72562529 TGTCAGGTGAGCTCTCCTCAAGG + Intergenic
1085998861 11:81954822-81954844 TGTCAGGTCAGGTAGCCCCAGGG - Intergenic
1086973343 11:93106642-93106664 TGTCAGGTCAGGTAGCCCCAGGG + Intergenic
1087426655 11:97996085-97996107 TAACTGTTAAGGTCACCTCAGGG - Intergenic
1087894935 11:103576656-103576678 TGTCAGGTCAGGTAGCCCCAGGG - Intergenic
1089601823 11:119620724-119620746 TTTCAGGTTAGTTCCCCTCATGG - Intergenic
1091814400 12:3425494-3425516 TGTCAGGTCAGGTAGCCCCAGGG + Intronic
1093594371 12:20943771-20943793 TTTCAGGAAAGGTCCCCTTACGG - Intergenic
1096207837 12:49738360-49738382 TGTCAGGTCAGGTAGCCCCAGGG - Intronic
1098248505 12:68544827-68544849 TGTCAGGTCAGGTAGCCCCAGGG - Intergenic
1105695716 13:22886695-22886717 TGTCAGGTCAGGTAGCCCCAGGG - Intergenic
1110132379 13:72023280-72023302 TGGGAGGTAAGGTCACCCCCAGG - Intergenic
1112424464 13:99285106-99285128 TGTTAGGTAAGGTAACATTATGG - Intronic
1117501307 14:56354766-56354788 AGTCAGCTGAGGTCACTTCATGG + Intergenic
1119111974 14:71983309-71983331 AGTCAGGTAAGGTTTCCTCCAGG - Intronic
1120857782 14:89227704-89227726 TGTGATGTAAGGTAATCTCAGGG - Intronic
1121080161 14:91101425-91101447 TGTGAGGTTAGGCCACCTCTTGG + Intronic
1127068330 15:55263302-55263324 TTTTGGGTAAGGTCACCTCAAGG - Intronic
1130352609 15:83105724-83105746 TGACAGGTGAGGACACCTCTTGG + Intergenic
1131834690 15:96378563-96378585 AGTCAGGTAAGGGCACATCTGGG - Intergenic
1132598376 16:763271-763293 GGGCAGGTAAGGTCCCCTCTGGG + Exonic
1134749233 16:16612747-16612769 TTTCTGGAAAGGTCACCACAAGG - Intergenic
1134996235 16:18740896-18740918 TTTCTGGAAAGGTCACCACAAGG + Intergenic
1136409290 16:30066879-30066901 TTTCAGGCAAGGTGACCCCATGG + Exonic
1137270505 16:46899748-46899770 TCTCAGGAGAGGTCCCCTCATGG + Intronic
1137458337 16:48635405-48635427 TGTCATGGAAGGCCACCTAAGGG - Intergenic
1137679442 16:50326904-50326926 TGTCACGTATGGGCACCTGAGGG + Intronic
1139579943 16:67866922-67866944 TCTCAGGTCAGATCACTTCAAGG - Intronic
1203144133 16_KI270728v1_random:1788704-1788726 TATCATGTAATGACACCTCATGG - Intergenic
1146898587 17:36564986-36565008 TGTTATGTAAGATCACCTAAAGG + Intronic
1147810194 17:43163326-43163348 TGTCAGGTCAGGTAGCCTCAGGG + Intergenic
1148126114 17:45237834-45237856 GGTCAGGTAAGGGCACCACCTGG + Intronic
1148935065 17:51158503-51158525 GATAAGGGAAGGTCACCTCAGGG + Intronic
1150365717 17:64582506-64582528 TGTCAGGTATGGTCACTTCATGG - Intronic
1153339255 18:3957341-3957363 TGTCAGTTAAGGTGTCCACAGGG - Intronic
1154014027 18:10600509-10600531 TGTCAGGTCAGGTAGCCCCAGGG + Intergenic
1156092593 18:33489369-33489391 TGTCAGTGAAGGTAATCTCAGGG - Intergenic
1158141739 18:54262969-54262991 TGTTAGCAATGGTCACCTCAAGG + Intergenic
1160208541 18:76857509-76857531 TGTCAGATAATGTAACCTGAAGG - Intronic
1160497076 18:79382054-79382076 TCTGAGGAAAGGTCTCCTCAAGG - Intergenic
1160701579 19:510051-510073 TGACTGGTCAGGTGACCTCAGGG - Intronic
1161595142 19:5147402-5147424 CGTCAGGGGAGCTCACCTCAAGG + Intronic
1162192730 19:8959850-8959872 TGTCATGGAAGGTGACATCAGGG + Exonic
1162282012 19:9706405-9706427 TGTCAGGTCAGGTAGCCCCAGGG - Intergenic
1163866970 19:19781620-19781642 TGTCAGGTCAGGTAGCCCCAGGG + Intergenic
1163934423 19:20429241-20429263 TGTCAGGTCAGGTAGCCTCAGGG + Intergenic
1164130547 19:22357610-22357632 TGTCAGGTCAGGTAGCCCCAGGG + Intergenic
1164157754 19:22606844-22606866 TCTCAGGGGAGATCACCTCAAGG + Intergenic
1165170484 19:33888499-33888521 TGTCAGGGAGGGTCAACTCCAGG + Intergenic
1166012148 19:39950418-39950440 TGTTACCTAAGGTCACCTCAAGG + Intergenic
1167935364 19:52901955-52901977 TGTCAGGTCAGGTAGCCTCAGGG + Intergenic
1167942504 19:52958956-52958978 TGTCAGGTCAGGTAACCCCAGGG - Intronic
1202686403 1_KI270712v1_random:54107-54129 TATCATGTAATGACACCTCATGG - Intergenic
926491335 2:13529092-13529114 TGTCAGGTCAGGTAGCCTCAGGG + Intergenic
929688268 2:44053336-44053358 TCCCAGGTAAAGTCACCTGATGG + Intergenic
930327775 2:49942077-49942099 TGACAGATAAAGTCACATCATGG - Intronic
931618936 2:64190461-64190483 CTTCAGGAAAGGTCCCCTCAAGG + Intergenic
932391545 2:71395030-71395052 TATCATGTAAGGTCACCCCGAGG - Intronic
934175957 2:89580989-89581011 TGCAAGGTAAGGTCCCCTCCAGG - Intergenic
934245315 2:90300701-90300723 TATCATGTAATGACACCTCATGG + Intergenic
934263429 2:91496324-91496346 TATCATGTAATGACACCTCATGG - Intergenic
934286268 2:91655351-91655373 TGCAAGGTAAGGTCCCCTCCAGG - Intergenic
940872087 2:158868645-158868667 TGTCAGGTCAGGTAGCCCCAGGG - Intergenic
940939362 2:159540444-159540466 TGTCTCATAAGATCACCTCAGGG + Intronic
942939833 2:181603820-181603842 TGGCAGGTAAGTACTCCTCATGG - Exonic
944985291 2:205169308-205169330 AGACAGTTCAGGTCACCTCAGGG - Intronic
1169486315 20:6036435-6036457 TGTCAGGTGATGTCATTTCAAGG + Intronic
1170400989 20:15983031-15983053 TGTCAGGTCAGGTAGCCTCAGGG + Intronic
1171106041 20:22433535-22433557 AGTCAGTTATGGTCACCTCTGGG + Intergenic
1174402106 20:50281742-50281764 TCTCAGCTAAGGTCACCAGAAGG - Intergenic
1175513771 20:59554701-59554723 TGTCAGGTCAGGTAGCCTCAGGG + Intergenic
1176018372 20:62950145-62950167 TGTCAGGCAAGGTCTCCGCCTGG + Intergenic
1177808918 21:25903706-25903728 TGTCATGTAAGGGAATCTCAAGG - Intronic
1178625652 21:34216101-34216123 TAGCAGTCAAGGTCACCTCAGGG - Intergenic
1179670770 21:42945898-42945920 TGTCAGGTCAGGTAGCCTCAGGG + Intergenic
1180759184 22:18186380-18186402 TGTCATGTACGGTGTCCTCATGG + Intergenic
949259220 3:2085373-2085395 TGTCAGTAAAGGTCAAATCATGG + Intergenic
951248438 3:20367106-20367128 TGTCAAGTCAGGTAGCCTCAGGG + Intergenic
951851564 3:27147011-27147033 TTTCAGGAAAGGTGATCTCACGG + Intronic
954795631 3:53160237-53160259 TCTCAGCTCAGGCCACCTCAGGG + Intronic
956996117 3:74828212-74828234 TGTCAGGTCAGGTAGCTTCAGGG - Intergenic
957999798 3:87736698-87736720 TGTCAGGTCAGGTAGCCTCAGGG + Intergenic
962096632 3:132299208-132299230 TGTCAGGTCAGGTAGCCCCAGGG + Intergenic
962097488 3:132307270-132307292 TGTCAGGTAAGGTAGCCCCAGGG - Intergenic
963967999 3:151395157-151395179 GCTCAGAGAAGGTCACCTCAAGG - Intronic
968632601 4:1659750-1659772 TGTCTGGTAAGGCCACCTCCTGG + Intronic
969108818 4:4828663-4828685 GGGCAGGGAAGGTCACCCCAGGG + Intergenic
971027413 4:22602277-22602299 TGTCAGGTCAGGTAGCCTCAGGG - Intergenic
972217164 4:36910235-36910257 TGTCAGGTCAGGTAGCCTCAGGG - Intergenic
974949727 4:68573331-68573353 TGTCAGGTCAGGTAGCCTCAGGG + Intronic
974988070 4:69054176-69054198 AGTCAGGTCAGGTAACCTCAGGG - Intronic
975205763 4:71642839-71642861 TGTCAGGTCAGGTAGCCCCAGGG - Intergenic
976037999 4:80847510-80847532 TGGCATGTAGGGTCACCACAAGG - Intronic
976990224 4:91356261-91356283 TGTCAGGTCAGGTAGCCTCAGGG + Intronic
977574994 4:98665852-98665874 TGGCAGGTAAGGCCACCCCCAGG + Intergenic
977972496 4:103228311-103228333 TGTCAGGTCAGGTAGCCCCAGGG - Intergenic
980471107 4:133252935-133252957 TGTCAGAAAAGGTGACCCCAGGG + Intergenic
982550049 4:156786516-156786538 TGTTAGGTAAATTCAACTCAAGG + Intronic
983898083 4:173103112-173103134 TGTCAGGTCAGGTAGCCTCAGGG - Intergenic
984226057 4:177036172-177036194 TGTCTTGTATGGCCACCTCAGGG - Intergenic
985094485 4:186400096-186400118 TCTCAGGGTAGGTGACCTCACGG - Intergenic
986814247 5:11390887-11390909 TGGCACCTAAGGTCACCACAGGG + Intronic
989557701 5:42816628-42816650 TGTCAGGCCAGGTAGCCTCAGGG - Intronic
992989583 5:82270409-82270431 TGTCAGGTCAGGTAGCCTCAGGG + Intronic
994109668 5:95987087-95987109 GGTCAGGAAAGCTCAGCTCAGGG - Intergenic
994269606 5:97761299-97761321 TGTCAGATGAGTTAACCTCAAGG + Intergenic
998114812 5:139528376-139528398 TGTCAGGTCAGGTAGCCTCAGGG - Intronic
1000191759 5:158917900-158917922 TGACAGGAAAGATGACCTCATGG - Intronic
1000604782 5:163316190-163316212 TGTCAGGTCAGGTAGCCTCAGGG + Intergenic
1001788174 5:174431834-174431856 TTGCAGGTAAGGCCACTTCACGG - Intergenic
1004917432 6:20345071-20345093 GGTCAGGAAAGGTCTCCCCAAGG - Intergenic
1005462056 6:26078612-26078634 TGTCAGGTCAGGTAGCCCCAGGG - Intergenic
1006032062 6:31183582-31183604 TGTCAGGTCAGGTAGCCTCAGGG + Intergenic
1007065751 6:38988806-38988828 TGTCAGCTGAGGTCTTCTCAAGG - Intronic
1008123589 6:47645041-47645063 TGTCAGGTCAGGTAGCCCCAGGG - Intergenic
1010317873 6:74471467-74471489 TGTCAGGTCAGGTAGCCTCAGGG - Intergenic
1011140848 6:84154443-84154465 TGTTAATTAAGGTCACATCAAGG - Intronic
1013559183 6:111287308-111287330 TGTCAGGTCAGGTAGCCTCAGGG + Intergenic
1014157929 6:118133783-118133805 CGGCAGGTATGGTCACCTCTTGG - Intronic
1015765357 6:136710560-136710582 TGTTTGAAAAGGTCACCTCAGGG + Intronic
1017593455 6:156002618-156002640 AGTCAGATAAGGACACCACAGGG - Intergenic
1019182050 6:170193568-170193590 TGCCAGGGAAGGTCAGGTCAGGG + Intergenic
1021244267 7:18242450-18242472 TATCAGGTTAGATCATCTCAAGG - Intronic
1021831270 7:24613641-24613663 TGTCAACTATGGTCACCTTATGG + Intronic
1028190343 7:87842560-87842582 TTTCAGGTAAGGTAAAATCAAGG + Intronic
1028262629 7:88684519-88684541 TGTCAGGTGATCTGACCTCATGG + Intergenic
1032170666 7:129582106-129582128 TGTCAGGTCAGGTAGCCCCAGGG - Intergenic
1032782416 7:135174665-135174687 TGTCAGGTCAGGTAGCCTCAGGG - Intergenic
1032979455 7:137265015-137265037 TGTCAGGTCAGGTGGCCCCAGGG + Intronic
1033053914 7:138031979-138032001 TCTCAGGTATGGTCACATCTGGG + Intronic
1034089540 7:148351283-148351305 GGTCAGGTAAGGCCTCCTCAAGG + Intronic
1034831043 7:154307583-154307605 CCCCAGGTAAGGTCTCCTCAAGG - Intronic
1035588460 8:794962-794984 TATCAGGTAAGGTCACCTGGAGG - Intergenic
1037955081 8:23049976-23049998 TGTCAGGTGAGGTTTCCCCAGGG + Intronic
1038089778 8:24240179-24240201 TGTCAGGTCAGGTAGCCCCAGGG - Intergenic
1039278274 8:35955550-35955572 TGTCAGGTCAGGTAGCCCCAGGG - Intergenic
1040836150 8:51733197-51733219 TCTCAAGTAAGGTCACTACAGGG - Intronic
1040993296 8:53375206-53375228 TGTCAGGTCAGGTAGCCCCAGGG + Intergenic
1041227250 8:55712906-55712928 TGTCAGGTCAGGTAGCCCCAGGG - Intronic
1041515581 8:58695717-58695739 AGTCAGGTCAGGTAGCCTCAGGG - Intergenic
1041578146 8:59423384-59423406 TGTGAGGGAAGGTCACCACATGG - Intergenic
1045515505 8:102856113-102856135 AATCAGTTAAGGTCACATCAAGG + Intronic
1045607897 8:103798784-103798806 TGCCAGGTAAGGTAACATCCAGG - Intronic
1046273098 8:111921789-111921811 TGTCAGAGGAGGCCACCTCAGGG - Intergenic
1048562349 8:135554546-135554568 TTTCAGGTATTGTGACCTCAGGG - Intronic
1057761180 9:97875594-97875616 TGGCAGGCAGGGTCACATCATGG + Intergenic
1058886333 9:109323983-109324005 TGTCAGGCACTGTCACCTCATGG + Intergenic
1059108812 9:111535210-111535232 TGTCAGGTAATATCCCCGCAGGG + Intronic
1059254233 9:112914096-112914118 TCTCAGGTAAAGTCACTGCAGGG - Intergenic
1060087843 9:120717272-120717294 TGTCAGGCCATGTCACCTGATGG - Intergenic
1062375430 9:136259817-136259839 TGTCTGGGAAGGGCTCCTCATGG - Intergenic
1189145368 X:38649932-38649954 TCTCAGGTCAGGTGACCTCCCGG - Intronic
1190270387 X:48858664-48858686 TGTCAGGTCAGGTAGCCCCAGGG - Intergenic
1190437044 X:50435841-50435863 TGTCAGGTAAGGTCACCTCAGGG + Intronic
1190771341 X:53517314-53517336 TGTCAGGTCAGGTAGCCCCAGGG - Intergenic
1192915351 X:75645808-75645830 TGTCAGGTCAGGTAGCCCCAGGG + Intergenic
1196422896 X:115540858-115540880 TGTCAGGTCAGGTAGCCTCAGGG + Intergenic
1196459965 X:115919563-115919585 TGTCAGGTCGGGTAGCCTCAGGG + Intergenic
1197955501 X:131942895-131942917 TGGCAGGTAAGGTGACGTTAAGG + Intergenic
1201372973 Y:13285570-13285592 TGTCAGGTCAGGTAGCCTCAGGG - Intronic