ID: 1190437503

View in Genome Browser
Species Human (GRCh38)
Location X:50440357-50440379
Sequence TTGTTGGTTTCGTGGAAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 333
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 318}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190437503_1190437509 28 Left 1190437503 X:50440357-50440379 CCATTTTTCCACGAAACCAACAA 0: 1
1: 0
2: 0
3: 14
4: 318
Right 1190437509 X:50440408-50440430 AGTAACATCTATGACTTTACTGG 0: 1
1: 0
2: 0
3: 10
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190437503 Original CRISPR TTGTTGGTTTCGTGGAAAAA TGG (reversed) Intronic
901337905 1:8467301-8467323 TTGTAAGTTTCCTGGAAATAAGG - Intronic
901342069 1:8503933-8503955 TTGTTGGTGTCATTAAAAAATGG + Intronic
901413649 1:9102451-9102473 TTTTTGGTTTCCTGTGAAAATGG - Exonic
901467876 1:9434416-9434438 TTGATGGTTTCATGCAACAAAGG + Intergenic
901841276 1:11955467-11955489 TTGCTGATTTTGTGGATAAATGG + Intronic
901984388 1:13062823-13062845 TTGTTTATTTTGAGGAAAAAAGG - Intronic
901997422 1:13163947-13163969 TTGTTTATTTTGAGGAAAAAAGG + Intergenic
904031231 1:27534734-27534756 TTGCTGGTTTTGTGCAGAAAGGG + Exonic
905418511 1:37822127-37822149 TTCTTGGTTTTGTGGAGAACTGG + Exonic
907113110 1:51945176-51945198 TTGTTGGTTTGTTTGAAACAGGG + Intronic
908634794 1:66151178-66151200 TTGGGTGTTTCGTGGAACAAAGG + Intronic
909937418 1:81569261-81569283 TTAATTGTCTCGTGGAAAAATGG - Intronic
910424548 1:87107003-87107025 TTGCTGCTTTTGTGGTAAAATGG - Exonic
911305848 1:96231257-96231279 TTGTTTGTTTGTTTGAAAAATGG + Intergenic
913906125 1:124590964-124590986 TTGAGGGTTTCGTTGGAAAAGGG + Intergenic
914255542 1:145959304-145959326 AAGTTGGTTTCTTGGAAAGAAGG + Intergenic
914999262 1:152573252-152573274 TTGTTTGTTTTGTGGACAATAGG - Intronic
917855335 1:179094869-179094891 CTGTTGGTTTCTTTGAAACAGGG - Intronic
920067419 1:203278694-203278716 CTGTTTGTTTCCTGGAAACATGG + Intergenic
920284835 1:204871925-204871947 TTGTTGGTTGGGAGGGAAAAAGG + Intronic
921135717 1:212257318-212257340 TAGTTGGTTTAGTGGTAATAGGG + Intergenic
921743684 1:218713918-218713940 TTGATGGTGTAATGGAAAAAAGG + Intergenic
924591366 1:245407511-245407533 TTGCTGGATTCGGGGAAGAAAGG - Intronic
1063654264 10:7971743-7971765 CTGCTGGTGTCCTGGAAAAATGG + Intronic
1063776152 10:9267571-9267593 TTGTTGGATACGTGGATAGATGG - Intergenic
1064775717 10:18774233-18774255 TTATTAATTTCTTGGAAAAAAGG + Intergenic
1064786128 10:18897553-18897575 TTGTTGATTAGGTGGAAAAATGG - Intergenic
1065438380 10:25724661-25724683 TTGTTGGTGTCAGGGAAAAGAGG - Intergenic
1067133907 10:43591589-43591611 TTGTTGGTTTACTGGAATGAGGG + Intergenic
1069223815 10:65916053-65916075 TTATTTGTTTAGTGGTAAAATGG + Exonic
1069418907 10:68228225-68228247 TTGTTGATTTGTTGAAAAAAAGG + Intergenic
1070199647 10:74191308-74191330 TTGTTGGTTTTATGGAAGAGAGG + Intronic
1070432544 10:76355689-76355711 TTTTTTGTGTGGTGGAAAAATGG + Intronic
1070583520 10:77743028-77743050 TTGTGGGCTTCTTGGAATAATGG - Intergenic
1072753883 10:98004158-98004180 TTGTTGGTATCATGGAAGAATGG - Intronic
1073041000 10:100605430-100605452 TTGTTTGTTTCCTTGAAACAGGG - Intergenic
1077909264 11:6559673-6559695 TTGTTGCTTTTGTGGAAGAAAGG - Intronic
1078266553 11:9759371-9759393 TTTTTGGTATGGTAGAAAAATGG + Intergenic
1078689359 11:13563433-13563455 TTGTTGGTTTACTGGAATGAGGG - Intergenic
1078939926 11:15991204-15991226 CTGTGGGTATCGTGGCAAAAAGG - Intronic
1079994103 11:27277071-27277093 TTATTTGTTTTGGGGAAAAAAGG - Intergenic
1081497598 11:43631154-43631176 CTGTTGGTTTCTTGGACACATGG + Intronic
1083693078 11:64423376-64423398 TTGTTTGTTTCTTTGAAACAAGG - Intergenic
1085985226 11:81778948-81778970 ATGTGGGCTTCCTGGAAAAACGG + Intergenic
1086267490 11:85018832-85018854 TTGTTTATTTTGAGGAAAAAAGG + Intronic
1086463218 11:87026393-87026415 TTGTTTATTTTGAGGAAAAAAGG - Intergenic
1086766624 11:90703709-90703731 TGGTTGGTTTCCTGAAGAAATGG + Intergenic
1087522767 11:99263575-99263597 TTCTTGCTTTGGGGGAAAAAGGG + Intronic
1088658018 11:112019599-112019621 TTGTTGCTTGGATGGAAAAAGGG + Intronic
1092453058 12:8621079-8621101 TTGTTTATTTCTTTGAAAAATGG + Intergenic
1092611505 12:10178066-10178088 TTGTATGTTTCGTAGAGAAAGGG + Intronic
1092715578 12:11386218-11386240 TTGTTGCTGTGGTGGAATAAAGG + Intronic
1092794913 12:12100711-12100733 TAGTTGTTTTAGTGGAAACAGGG - Intronic
1092846484 12:12589662-12589684 TGGTGGGTTTCGTGGAAGGAAGG + Intergenic
1093016475 12:14160012-14160034 TTGTTTGTTTTTTGGAAACAGGG - Intergenic
1093393841 12:18656121-18656143 TTGCTGTTTTTGTGGAAGAATGG - Intergenic
1097154115 12:57000357-57000379 TTTTTGGTTTACTGGCAAAAAGG + Exonic
1097159587 12:57036941-57036963 CTCTTGGTTTCGGGGAAACATGG - Exonic
1105447551 13:20470734-20470756 TTGTAGTTTTAGTGGAAACAGGG - Intronic
1107110349 13:36690967-36690989 TTGTTGTTGTTGTGGAAAACTGG - Intronic
1109095272 13:58106483-58106505 TTGTTGGTTTACTGGAATGAGGG - Intergenic
1109555716 13:63972957-63972979 TTGTGGTTTTAGTGGAGAAAGGG + Intergenic
1110208272 13:72943782-72943804 TTGTTTGTTTAGGGGAAAAGGGG + Intronic
1111009016 13:82287404-82287426 TTGTTTGTTTAGTAGAAAATGGG - Intergenic
1111173456 13:84560955-84560977 TTGTTGGTTTACTGGAATGAGGG + Intergenic
1112249064 13:97762197-97762219 TTGTTGTTGTTGTTGAAAAATGG - Intergenic
1113063900 13:106355074-106355096 GTGTTAGTTTTGTGGAAAGAAGG - Intergenic
1114282864 14:21210582-21210604 TTGTTTATTTTGAGGAAAAAAGG + Exonic
1115877881 14:37881056-37881078 TTGTTGCTCTGGGGGAAAAAGGG - Intronic
1117710400 14:58522605-58522627 TTGTTTATTTTGAGGAAAAAAGG - Intronic
1119582712 14:75801332-75801354 TTGTTGGCTGCGTGGGAAATGGG - Intronic
1120096535 14:80395098-80395120 GTGTTGGCTTATTGGAAAAATGG + Intergenic
1120179070 14:81324833-81324855 TTGTTGGTTTGGAGGAAGCATGG + Intronic
1120491036 14:85179102-85179124 TTCTTTGTTTCGGGGAACAATGG + Intergenic
1122286854 14:100657482-100657504 TCATTTCTTTCGTGGAAAAATGG + Intergenic
1123693764 15:22861908-22861930 TTGTTTGTTTGGTAGAAACAAGG + Intronic
1124259261 15:28173624-28173646 TTGTTTGTTTGGTGGAGAGAGGG - Intronic
1124316988 15:28678628-28678650 TTGTTTGTTTGGTGGAGACATGG - Intergenic
1124560954 15:30772743-30772765 TTGATGGATTCATGGAAGAATGG - Intronic
1124566461 15:30818871-30818893 TTGTTTGTTTGGTGGAGACATGG + Intergenic
1124669577 15:31626308-31626330 TTGATGGATTCATGGAAGAATGG + Intronic
1126117020 15:45217387-45217409 TTGTAGTTTTCGTGGAGAAGGGG + Intergenic
1126152058 15:45532337-45532359 TTGTTGAATGCGTGGAACAAGGG + Intergenic
1127257418 15:57303956-57303978 TGGTTGATTCCCTGGAAAAAGGG + Intergenic
1132024516 15:98393434-98393456 ATGTTGGTTTGGTAGAAAAGTGG - Intergenic
1133865965 16:9643604-9643626 TTGTTGGTTTTGTAGAGACAGGG + Intergenic
1138719872 16:59067543-59067565 TGGTTGGTTTCCTGGGAAAAAGG + Intergenic
1141211752 16:81987398-81987420 TTGTTGTTTTCATGTAACAAGGG - Intergenic
1143313467 17:6013209-6013231 TTTTTGCTTTCGAGGAAAAGGGG - Intronic
1144522654 17:15964211-15964233 TTGTTGTTTTTGTGTAAGAATGG + Intronic
1145219984 17:21080421-21080443 TTGTTGGTTTACTGGAATGAGGG - Intergenic
1146526492 17:33571355-33571377 CTGTTGTTTTGGTGGAAAACAGG - Intronic
1148604219 17:48916644-48916666 TTGTTGGTATAGGGAAAAAAAGG + Intronic
1148702701 17:49599516-49599538 TTGTTTGTTTTTTAGAAAAAGGG + Exonic
1149139715 17:53417262-53417284 TTGTTGGTTTATTGGAAGGAGGG - Intergenic
1149184808 17:53984956-53984978 TTGTTGGTTTACTGGAATAAGGG - Intergenic
1150573172 17:66405934-66405956 TGGTTGGTGTGGAGGAAAAATGG + Intronic
1153157587 18:2167027-2167049 TTGTTGGTTTGCTGGGAAGAGGG + Intergenic
1154240525 18:12649505-12649527 TTGTTGGCTAAGTAGAAAAAAGG - Intronic
1154539694 18:15516981-15517003 TTGTGGATTTCGTTGAAAACGGG + Intergenic
1154548352 18:15643157-15643179 TTGTGGATTTCGTTGAAAACGGG + Intergenic
1154550684 18:15677202-15677224 TTGTGGATTTCGTTGGAAAAGGG + Intergenic
1154587868 18:16196206-16196228 TTGAGGATTTCGTGGAAAACGGG + Intergenic
1154630042 18:16774594-16774616 TTGAGGGTTTCGTGGGAAACGGG + Intergenic
1154638604 18:16891803-16891825 TTGAGGATTTCGTGGAAAACGGG + Intergenic
1154645888 18:16992072-16992094 TTGAGGGTTTCGTGGGAAACGGG + Intergenic
1154700565 18:17740835-17740857 TTGAGGGTTTCGTTGGAAAAGGG + Intergenic
1154725340 18:18080548-18080570 TTGAGGATTTCGTGGAAAACGGG + Intergenic
1154756692 18:18510575-18510597 TTGAGGGTTTCGTGGGAAACGGG + Intergenic
1154767191 18:18654378-18654400 TTGAGGGTTTCGTGGGAAACGGG + Intergenic
1154768707 18:18675067-18675089 TTGTGGATTTCGTGGGAAACGGG + Intergenic
1154768988 18:18678805-18678827 TTGAGGATTTCGTGGGAAAAGGG + Intergenic
1154776163 18:18777367-18777389 TTGAGGGTTTCGTGGGAAACGGG + Intergenic
1154785299 18:18902880-18902902 TTGAGGATTTCGTGGGAAAAGGG + Intergenic
1154799672 18:19100607-19100629 TTGAGGATTTCGTGGAAAACGGG + Intergenic
1154802962 18:19145892-19145914 TTGAGGGTTTCGTGGGAAACGGG + Intergenic
1154837574 18:19622986-19623008 TTGAGGATTTCGTGGGAAAAGGG + Intergenic
1154843193 18:19700142-19700164 TTGAGGATTTCGTGGGAAAAGGG + Intergenic
1155265066 18:24084309-24084331 TTGTATTTTTCGTGGAAACAGGG - Intronic
1157725336 18:49959570-49959592 TTCTTTGTTTCCTGGAAGAAAGG - Intronic
1161445265 19:4315067-4315089 TTGTTGATTGCTTGGAAAGATGG + Intronic
1164041632 19:21497769-21497791 TTGTTGGTTTACTGGAATGAGGG - Intronic
1164905333 19:31962893-31962915 TTGCTGGTTCCGGGGAACAAAGG - Intergenic
1165148008 19:33744269-33744291 TTATTGGTCTAGTGGAGAAAAGG + Intronic
1166562056 19:43739425-43739447 TTGGTGGTTTCAGGTAAAAACGG + Intronic
1166698771 19:44869755-44869777 TTGTTTGTTTCTTGGAGAGAGGG + Intronic
1166950859 19:46427207-46427229 TTGTTGGTTGCATGGATACATGG + Intergenic
1167811362 19:51834255-51834277 TTATTTGTTTTGTGGAAACAAGG + Intergenic
925684165 2:6454191-6454213 TTGTTGCTTTTCTGGAGAAATGG - Intergenic
925702695 2:6654902-6654924 TTGTTGGTTGAGTGAAGAAATGG - Intergenic
926586468 2:14691302-14691324 TTGCTGGTTTTGTGGCTAAAGGG - Intergenic
927248302 2:20976001-20976023 TGGTTGGTTTGATGGAAAGATGG - Intergenic
929744888 2:44646660-44646682 TTCATGGTTTTGGGGAAAAAGGG - Intronic
933834530 2:86234613-86234635 TTGTTGGTTTCCTGGTGACATGG - Intronic
934146387 2:89098799-89098821 TGGTTGGTTTACTGAAAAAAAGG - Intergenic
934707730 2:96496551-96496573 TTGTTGTTTTTATGGAACAATGG + Intergenic
935113366 2:100112271-100112293 TAGTTGGTTTCTTGGAAGAAGGG + Intronic
935463299 2:103364626-103364648 TGGTTGGATTTGAGGAAAAAAGG - Intergenic
935672997 2:105571600-105571622 TTGCTGGCTTCCTGGAAAACTGG - Intergenic
936597241 2:113860006-113860028 TTGTACGTTTCGTAGAGAAAGGG - Intergenic
937593445 2:123643815-123643837 GTGTTGGTGTGATGGAAAAAAGG - Intergenic
938535802 2:132244218-132244240 TTGATGTTTTCGTTGGAAAAGGG + Intronic
940764282 2:157772973-157772995 TTCTTGTTTTCATGGAAAGAGGG - Intronic
941058288 2:160813953-160813975 TTGTTGGTTACGTAGAGCAAGGG + Intergenic
941058608 2:160818254-160818276 TAGTTTGTTCCTTGGAAAAAGGG - Intergenic
943369484 2:187000727-187000749 TTGTTGTTTCAGTGGAAAACAGG + Intergenic
943601371 2:189924839-189924861 TTGTTTATTTTGAGGAAAAAAGG - Intronic
944940763 2:204623454-204623476 TTGTTGATTGCAAGGAAAAAGGG - Intronic
946491857 2:220156341-220156363 TTGTTGGGTTGGAGGAAAAAAGG - Intergenic
1170321304 20:15101268-15101290 TTTTTGTTTTCTTGGAAATAAGG + Intronic
1170322047 20:15110889-15110911 TGGTTGTTTTCTTAGAAAAATGG - Intronic
1171577958 20:26357384-26357406 TTGATGGTTTCGTTGGAAACGGG + Intergenic
1171940775 20:31327268-31327290 TTGTTTGTTTCTGTGAAAAATGG - Intergenic
1172429822 20:34880373-34880395 TTGTTTGTTTTGTAGAAACAGGG - Intronic
1173989572 20:47291106-47291128 TTCATGGTGTGGTGGAAAAAAGG - Intronic
1174619954 20:51866378-51866400 TTGTTTGTTTTCTGGAAACAGGG - Intergenic
1177475415 21:21614448-21614470 TTGGTGGTTTCCAGGAACAAAGG - Intergenic
1177587500 21:23117588-23117610 TTGTTGGTTTCGAGTCCAAATGG + Intergenic
1178107249 21:29333935-29333957 TTATTTATTTGGTGGAAAAATGG + Intronic
1178267033 21:31152994-31153016 TTGTTGGTAAAGAGGAAAAATGG - Intronic
1178713047 21:34936891-34936913 ATGGTGGTTTAGTGGGAAAAGGG + Intronic
1179004353 21:37497468-37497490 TTTTTGGTTACATGGAAAATGGG - Intronic
1182192957 22:28482740-28482762 TTGGTGGTTTCCAGGAACAAAGG - Intronic
1184638744 22:45857281-45857303 TTTTTGGTTACTTGGTAAAAGGG + Intergenic
951414174 3:22402812-22402834 TTATTAGGTTGGTGGAAAAATGG + Intergenic
952035286 3:29193794-29193816 TTGTTGTTTTTGTGGAGATAAGG + Intergenic
952162324 3:30706307-30706329 TTGTCGGTTTACTGGAATAAAGG + Intergenic
953835003 3:46334793-46334815 TTGTTGGTTTACTGGAATGAGGG + Intergenic
954150517 3:48654925-48654947 TTGGTGGTTTGGGGGAAAGATGG + Intronic
955567060 3:60258749-60258771 ATGTTGGTTTGATGGAAAAGTGG + Intronic
956136122 3:66100808-66100830 TTGTATGTTTAGTGGAAACAAGG + Intergenic
956736266 3:72240782-72240804 TTGGTGTTTTCCTGGAGAAAGGG - Intergenic
960015738 3:112885600-112885622 TTGTTGGTTTACAGGAAAGAGGG + Intergenic
961024618 3:123543287-123543309 TTATTGGTTTCTTTAAAAAAAGG - Intronic
961234708 3:125356249-125356271 TTGTCTGTTTGGTGGAAAATAGG - Intronic
964413090 3:156419653-156419675 TTGTAGGTATCATGGAGAAAAGG - Intronic
964775117 3:160267078-160267100 TTGTGGGTTTCATGGTAGAAAGG - Intronic
964926158 3:161960750-161960772 TTCTTGGTTGCGTAGAAAATTGG + Intergenic
966511328 3:180766506-180766528 TTGTTGGTTTACTGGAATGAGGG + Intronic
968716911 4:2167037-2167059 TTGATGGTTTAGTGGGGAAAAGG - Intronic
970129825 4:12855316-12855338 TTTTTGGTTTTTTGGAAAAAGGG - Intergenic
971442870 4:26709044-26709066 TTGTTGTTGTTGTTGAAAAAGGG + Intronic
972050398 4:34725335-34725357 CTCTTGGTTTAGTGGGAAAAAGG - Intergenic
973429726 4:50128929-50128951 TTGTTGATTTCGTTGGAAACGGG + Intergenic
973432128 4:50168726-50168748 TTGTGGGTTTCGTTGGAAACGGG + Intergenic
973461099 4:50647540-50647562 TTGTGGGTTTCGTTGGAAACGGG + Intergenic
973488567 4:51101152-51101174 TTGTGGATTTCGTTGGAAAAGGG + Intergenic
973494824 4:51204231-51204253 TTGTGGATTTCGTTGGAAAAGGG + Intergenic
973495711 4:51219026-51219048 TTGTTGATTTCGTTGGAAACGGG + Intergenic
973513862 4:51517672-51517694 TTGTGGGTTTCGTTGGAAACGGG + Intergenic
973516407 4:51559697-51559719 TTGTGGATTTCGTTGAAAACGGG + Intergenic
974501906 4:62716000-62716022 TTGTTGATTTTGAGGAAGAAAGG + Intergenic
975064460 4:70043088-70043110 CTGTTGTTTTCGTAGATAAATGG - Intergenic
975333200 4:73143296-73143318 TTGTTGTTTTCGTAGAAATGGGG + Intronic
977738711 4:100449908-100449930 TTCTTGATTTCAGGGAAAAAAGG - Intronic
979867376 4:125773717-125773739 TTGTTAGGTTTGTGGAATAATGG + Intergenic
980312647 4:131153575-131153597 TTGTTGTTATTGTTGAAAAAGGG - Intergenic
980774916 4:137425269-137425291 ATGTTGGTTTAGGGGATAAAGGG - Intergenic
983464917 4:168075077-168075099 TTGTAGCTTTTGTGGAAACATGG + Intergenic
983754589 4:171319505-171319527 TGTTTGGTTTCCTGGAAAGAGGG - Intergenic
984419182 4:179497595-179497617 TTGTATGTTTAGTGGAAACAGGG - Intergenic
984464409 4:180079186-180079208 TTGTTTGTTTCTTGAAAAGAAGG - Intergenic
986039289 5:3972078-3972100 TTTTTTTTTTCGTTGAAAAATGG - Intergenic
986258510 5:6122347-6122369 TTCTTGGTTCCATGGAAAAGAGG + Intergenic
986263635 5:6173254-6173276 TTGTTGGTGATGTGGAGAAAAGG + Intergenic
986500110 5:8389878-8389900 TTGTTTGTTTCTTTGAAAACAGG + Intergenic
986723172 5:10575079-10575101 TTGTTTGTTTCTTGGAAACAGGG - Intronic
988097413 5:26634867-26634889 TTGCTGGTTAAGTGGAAAACTGG - Intergenic
989874105 5:46654740-46654762 TTGTTGCCTACGTGGGAAAAAGG + Intergenic
989874915 5:46670088-46670110 TTGTTGCCTACGTGGGAAAAAGG + Intergenic
989877996 5:46727752-46727774 TTGTTGCCTACGTGGGAAAAAGG + Intergenic
989952487 5:50316139-50316161 TTGTTGCTTTCCTGGAAAGGAGG + Intergenic
990001440 5:50898022-50898044 TTGTTGGTTTCCTGGGAATGGGG - Intergenic
990592169 5:57277174-57277196 TTTTTGGTTTTGTAGAAACAAGG - Intergenic
993930991 5:93938776-93938798 TTGTTAATTTCCAGGAAAAAAGG + Intronic
995804247 5:116033794-116033816 AAGTTTGTTTCGTGAAAAAAAGG + Intronic
997943849 5:138182122-138182144 TTGTTGATTTGGTGGAAAGATGG + Intronic
998201696 5:140129943-140129965 TTGTTGTTTTCTTGCTAAAAAGG + Intergenic
999283666 5:150381291-150381313 TTGTTGGTTTGGTGTATCAAAGG - Intronic
1000609865 5:163362037-163362059 TTGTTTGTTTTGTGGATACAGGG - Intergenic
1000727175 5:164785698-164785720 ATGTTGGGTTCATGGAGAAATGG + Intergenic
1001210375 5:169805571-169805593 TTCCTGGTTTGGTGGAAAGATGG + Intronic
1003271762 6:4613774-4613796 TTCTTGGTTTCCTTGACAAATGG + Intergenic
1003353990 6:5347748-5347770 TTGTTGGTGACGTTGTAAAATGG - Intronic
1005486374 6:26304214-26304236 TTGTTGGTTTGTTGCAAAGAGGG - Intergenic
1006721822 6:36159485-36159507 TTTTTAGTTTCGTAGAAACAGGG + Intergenic
1007231808 6:40353519-40353541 GTGTTGGTTGCCTGGAGAAATGG + Intergenic
1007545507 6:42690688-42690710 TTGTTGGTAACGTGTAAAAAGGG - Intronic
1007914453 6:45547990-45548012 TTTTTGGTTCAGTGGGAAAAGGG - Exonic
1008436014 6:51477540-51477562 TTGTTGTTGTTGTGGAAGAAGGG - Intergenic
1008665487 6:53711853-53711875 TGGTTGGTTTCTTGAGAAAAGGG + Intergenic
1008720339 6:54342251-54342273 TAGTTGGCTTCTTGGAAAGATGG + Intronic
1008936018 6:56993702-56993724 TTGTTTGTTTTGTAGAAACAGGG + Intronic
1012635661 6:101536986-101537008 GTGTTGGTTTCTTGTAGAAATGG + Intronic
1013041411 6:106437607-106437629 TTGTTTGTTTCGTAGAAACAGGG + Intergenic
1013357508 6:109359592-109359614 ATGTTGGTTTCATGCAAAAGTGG + Intergenic
1013773162 6:113650028-113650050 TGGTTGGTCTGGAGGAAAAAGGG - Intergenic
1013847247 6:114467916-114467938 TTGTTTGTTTTGTAGAAATAGGG - Intergenic
1015934886 6:138398808-138398830 TTGTTGGTTTTGTAGAGACAGGG - Intergenic
1018005942 6:159621957-159621979 TTGTTTGTTTTTTGGTAAAAAGG + Intergenic
1020214389 7:6178483-6178505 TTTTTGATTTCCTGGTAAAAAGG + Intronic
1021104247 7:16618280-16618302 TTGTTTGTTTTGTTGAAACAGGG - Intronic
1021785213 7:24144371-24144393 TTGCTGGCTTCGAGGAAACAAGG + Intergenic
1022328647 7:29356557-29356579 TTGTTGTTGTTGTGTAAAAATGG + Intronic
1024653311 7:51427243-51427265 TTTTTTGTTTGGTGCAAAAAGGG + Intergenic
1026060362 7:67020205-67020227 TTTTTGTTTTTGTGGAAACAGGG - Intronic
1026447931 7:70501713-70501735 TTGTTTGTGTTGTGGAGAAAGGG - Intronic
1028154672 7:87416243-87416265 TAATTGGTTTAGTGGAAACATGG + Intronic
1028191161 7:87854028-87854050 TTCATGGTTTTGTGTAAAAAAGG - Intronic
1028425364 7:90681227-90681249 TTGTTGGTCTATTGGAAAACAGG + Intronic
1028769719 7:94604093-94604115 TTGTTGGTTTGGGGGAATTATGG + Intronic
1028907672 7:96173162-96173184 TTCATGTTTTCATGGAAAAATGG + Intronic
1033096640 7:138438022-138438044 TTGTAGTTTTAGTGGAGAAAAGG + Intergenic
1033390006 7:140918149-140918171 ATGTTAGTTTCCTTGAAAAAAGG - Intronic
1034568412 7:151934346-151934368 TTGTTTGTTATGAGGAAAAATGG - Intergenic
1035631247 8:1108055-1108077 TTGTTGCTTTTTTGAAAAAATGG + Intergenic
1036534814 8:9637626-9637648 TTGTTGCTCTCCTGGAGAAAAGG - Intronic
1036580159 8:10066437-10066459 TTGTTGGTTTTTTATAAAAATGG + Intronic
1036945902 8:13094713-13094735 TTGTTGGCATTGGGGAAAAATGG - Intronic
1037148462 8:15604269-15604291 TTTTTAGTTTAGTGGAAAAGAGG + Intronic
1038177300 8:25192682-25192704 TTGTTGTTTTCGTAGACACAGGG + Intronic
1038836690 8:31132862-31132884 TTAATGGTTTCCTGGACAAAAGG - Intronic
1040318693 8:46278157-46278179 TTGTTGGTTTACTGGAATGAGGG + Intergenic
1040319350 8:46284668-46284690 TTGTTGGTTTATTGGAACGAGGG + Intergenic
1040529645 8:48256154-48256176 TTGTGGGTTTAGGGGAATAAGGG + Intergenic
1040866929 8:52056858-52056880 TCCTTGCTTTCTTGGAAAAAGGG - Intergenic
1041234014 8:55780609-55780631 TTGTGGGTTTACTGGAAAACAGG - Intronic
1042289080 8:67148751-67148773 TTGTTTGTTTTATGGAAAACAGG + Intronic
1045235024 8:100344067-100344089 TTTTTGTTTTAGTGGGAAAAGGG + Intronic
1046895272 8:119464615-119464637 TTGTTGTTTTGGAGGAAAGAAGG - Intergenic
1047985219 8:130226208-130226230 TTTTTGGATTGGTGGCAAAAAGG - Intronic
1048714285 8:137250558-137250580 TTGTTTGTTTTGTAGAGAAATGG + Intergenic
1052692533 9:31833648-31833670 TTATTGCTTTCTTGAAAAAAAGG - Intergenic
1053955038 9:43454797-43454819 TTGATGGTTTCGTTGGAAACGGG + Intergenic
1053956600 9:43481849-43481871 TTGTAGGTTTCGTTGGAAACGGG + Intergenic
1053960435 9:43548712-43548734 TTGTAGGTTTCGTTGGAAACGGG + Intergenic
1053963755 9:43606563-43606585 TTGATGGTTTCGTTGGAAACGGG + Intergenic
1053985512 9:43982500-43982522 TTGAAGGTTTCGTTGGAAAACGG + Intergenic
1053989249 9:44047332-44047354 TTGATGGTTTCGTTGGAAACGGG + Intergenic
1053996159 9:44166951-44166973 TTGATGGTTTCGTTGGAAACGGG + Intergenic
1053999390 9:44223801-44223823 TTGAAGGTTTCGTTGGAAAAGGG + Intergenic
1054010038 9:44410145-44410167 TTGAAGGTTTCGTTGGAAAACGG + Intergenic
1054010447 9:44417118-44417140 TTGAAGGTTTCGTGGGAAACGGG + Intergenic
1054011807 9:44440419-44440441 TTGATGGTTTCGTTGGAAACGGG + Intergenic
1054019309 9:44570238-44570260 TTGTAGGTTTCGTTGGAAACGGG + Intergenic
1054020642 9:44592856-44592878 TTGATGGTTTCGTTGGAAACGGG + Intergenic
1054026740 9:44697292-44697314 TTGAAGGTTTCGTTGAAAACGGG + Intergenic
1054036769 9:44869346-44869368 TTGAAGGTTTCGTTGAAAACGGG + Intergenic
1054041247 9:44945705-44945727 TTGATGGTTTCGTTGGAAACGGG + Intergenic
1054044515 9:45001492-45001514 TTGATGGTTTCGTTGGAAACGGG + Intergenic
1054063963 9:45331933-45331955 TTGAAGGTTTCGTTGGAAAAGGG + Intergenic
1054068421 9:45408471-45408493 TTGAGGGTTTCGTTGGAAAAGGG + Intergenic
1054068441 9:45408809-45408831 TTGATGGTTTCGTTGGAAACGGG + Intergenic
1054068815 9:45415267-45415289 TTGAAGGTTTCGTTGGAAAAGGG + Intergenic
1054070408 9:45442825-45442847 TTGAAGGTTTCGTTGGAAAAGGG + Intergenic
1054072410 9:45477530-45477552 TTGATGGTTTCGTTGGAAACGGG + Intergenic
1055799131 9:80013410-80013432 TTGTTGGTTTTATGGAGGAAAGG + Intergenic
1056449136 9:86698348-86698370 TTGTTTCTTTCGTTGGAAAATGG + Intergenic
1056471571 9:86909681-86909703 TTGTTGCTTTTATGGAGAAATGG - Intergenic
1058213269 9:102200020-102200042 TTGTTGGTGTTGTGAGAAAATGG - Intergenic
1058347399 9:103980328-103980350 TTGTTGGTATCGTCTTAAAATGG - Intergenic
1060498940 9:124138307-124138329 TGGTTGGCTTCGGGGAAAAGGGG + Intergenic
1060579620 9:124733017-124733039 TTGTTGGTTTCATGGAAGGATGG + Intronic
1061464318 9:130765888-130765910 GTGGTGGCTTGGTGGAAAAACGG + Intronic
1062247825 9:135578571-135578593 TGGTTGGTTGGGTGGATAAATGG - Intergenic
1062247894 9:135578917-135578939 TGGTTGGTTGGGTGGATAAATGG - Intergenic
1203419654 Un_KI270381v1:140-162 TTGATGGTTTCGTTGGAAACGGG - Intergenic
1203595008 Un_KI270747v1:121300-121322 TTGATGGTTTCGTTGGAAACGGG + Intergenic
1203596555 Un_KI270747v1:147649-147671 TTGATGGTTTCGTTGGAAACGGG + Intergenic
1203596776 Un_KI270747v1:151386-151408 TTGATGGTTTCGTTGGAAACGGG + Intergenic
1203596855 Un_KI270747v1:152744-152766 TTGATGGTTTCGTTGGAAACGGG + Intergenic
1203598040 Un_KI270747v1:172461-172483 TTGATGGTTTCGTTGGAAACGGG + Intergenic
1203598119 Un_KI270747v1:173819-173841 TTGATGGTTTCGTTGGAAACGGG + Intergenic
1203599470 Un_KI270747v1:196777-196799 TTGATGGTTTCGTTGGAAACGGG + Intergenic
1203599513 Un_KI270747v1:197454-197476 TTGATGGTTTCGTTGGAAACGGG + Intergenic
1203599558 Un_KI270747v1:198131-198153 TTGATGGTTTCGTTGGAAACGGG + Intergenic
1187349946 X:18504110-18504132 TTGTTTGTTTGGTGGAGACAGGG + Intronic
1189507569 X:41627446-41627468 TTTTTGGTTACATGGATAAATGG + Intronic
1189615786 X:42781727-42781749 TTGTTGGTTTAATTAAAAAAGGG + Intergenic
1189646182 X:43135113-43135135 TTGATTATTTCATGGAAAAATGG - Intergenic
1190437503 X:50440357-50440379 TTGTTGGTTTCGTGGAAAAATGG - Intronic
1191227153 X:58055244-58055266 TTGTTGGTTTACTGGAGTAAGGG + Intergenic
1191310878 X:59063859-59063881 TTGAAGGTTTCGTTGGAAAAGGG + Intergenic
1191409422 X:60382116-60382138 TTGAAGGTTTCGTTGGAAAATGG + Intergenic
1191528062 X:61970104-61970126 TTGAAGGTTTCGTTGGAAAATGG + Intergenic
1193205592 X:78744205-78744227 TTTTTGCTTCAGTGGAAAAAAGG - Intergenic
1194146600 X:90273444-90273466 TTTATGGTTTCGAGAAAAAAGGG + Intergenic
1195759676 X:108232879-108232901 TTGTTTGTTTGGTGGACAATTGG - Intronic
1196148727 X:112348434-112348456 TTTTTTATTTTGTGGAAAAAAGG - Intergenic
1197027574 X:121773398-121773420 TTTTTGGTTTCATGGATGAATGG + Intergenic
1198026953 X:132716250-132716272 TTCTTGTTTCCGTGGAAAACGGG + Intronic
1198314016 X:135448985-135449007 TTGTTGTTTTGGAGGAAAAAAGG - Intergenic
1201702134 Y:16895415-16895437 TTCTTGCTTTGGTGGAAAGACGG + Intergenic