ID: 1190439906

View in Genome Browser
Species Human (GRCh38)
Location X:50467151-50467173
Sequence GGTGGCAGCAAGTGTAAGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 360
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 331}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190439906_1190439913 5 Left 1190439906 X:50467151-50467173 CCTTACTTACACTTGCTGCCACC 0: 1
1: 0
2: 1
3: 27
4: 331
Right 1190439913 X:50467179-50467201 GGAGACCATGGCTCATTTCCTGG 0: 1
1: 0
2: 0
3: 10
4: 183
1190439906_1190439914 6 Left 1190439906 X:50467151-50467173 CCTTACTTACACTTGCTGCCACC 0: 1
1: 0
2: 1
3: 27
4: 331
Right 1190439914 X:50467180-50467202 GAGACCATGGCTCATTTCCTGGG 0: 1
1: 0
2: 0
3: 15
4: 160
1190439906_1190439917 27 Left 1190439906 X:50467151-50467173 CCTTACTTACACTTGCTGCCACC 0: 1
1: 0
2: 1
3: 27
4: 331
Right 1190439917 X:50467201-50467223 GGAATTGAAACATTTTAGAAAGG 0: 1
1: 0
2: 2
3: 41
4: 520
1190439906_1190439910 -7 Left 1190439906 X:50467151-50467173 CCTTACTTACACTTGCTGCCACC 0: 1
1: 0
2: 1
3: 27
4: 331
Right 1190439910 X:50467167-50467189 TGCCACCAGGTGGGAGACCATGG 0: 1
1: 0
2: 2
3: 20
4: 298

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190439906 Original CRISPR GGTGGCAGCAAGTGTAAGTA AGG (reversed) Intronic
900371521 1:2334238-2334260 GGGGGCAGCAGGTGTAAGAACGG + Intronic
902102418 1:14002456-14002478 GGTGGCAGCAAGAGAAAATGAGG - Intergenic
903767366 1:25743421-25743443 GGTGGCTGCAGGTGCAAATAGGG + Intronic
905306072 1:37019164-37019186 GATGGATGCATGTGTAAGTAGGG - Intronic
907555754 1:55343085-55343107 GGTGGCAGCAAGAGAAAATGAGG - Intergenic
907556096 1:55345329-55345351 GGTGGCAGCAAGAGAAAATGAGG - Intergenic
907707925 1:56848613-56848635 GGTGGCAGCAAGAGAAAATGAGG + Intergenic
907941018 1:59087440-59087462 GGTGGCAGCAAGAGAAAATGAGG + Intergenic
909177842 1:72382415-72382437 GGTGGCAGCAAGAGAAAATGAGG - Intergenic
910747489 1:90589499-90589521 GGTGGCAGCAAGAGAAAATGAGG + Intergenic
910774391 1:90860993-90861015 GGTGGCAGCAAGAGAAAATGAGG + Intergenic
912476933 1:109944342-109944364 GGTGGAAGCAAGATTAAGAAGGG + Intergenic
912764304 1:112395375-112395397 GGTGGCAGCAAGTCTTAGGCAGG - Intergenic
913085536 1:115433284-115433306 GGTGGCAGCAAGAGAAAATGAGG - Intergenic
913339940 1:117748587-117748609 GGTGGGAGAAAGAGCAAGTAGGG - Intergenic
915840027 1:159205972-159205994 GGTGACAGGCAGTGTCAGTAGGG - Exonic
916029989 1:160867844-160867866 GGTGGCAGCAAGAGAAAATGAGG - Intergenic
916890331 1:169106914-169106936 GGTGGCAGTTGGTGTAAGTACGG + Exonic
916899661 1:169207184-169207206 GGTGGAAGCAAGAGGAAGAAGGG + Intronic
917118958 1:171629098-171629120 GGTGGCAGCAAGAGAAAATGAGG + Intergenic
917702731 1:177597410-177597432 GGTGGCAGGAAGGGGAAGTAAGG + Intergenic
918429533 1:184444442-184444464 GGTGGCAGCAAGAGAAAATGAGG - Intronic
919308902 1:195879515-195879537 GGTGGCAGCAAGAGAAAATGAGG + Intergenic
919409832 1:197228877-197228899 GGTGGCAGCAAGAGAAAATGAGG + Intergenic
920058729 1:203213202-203213224 GGTGGCAGCATATGTCAGTGTGG + Intronic
921000772 1:211040471-211040493 GGTGGCAGCAAGAGAAAATGAGG - Intronic
921424224 1:214983900-214983922 GGTGGCAGCAAGAATAAATGAGG - Intergenic
922300190 1:224292569-224292591 GGTATGAGTAAGTGTAAGTAAGG - Intronic
923198145 1:231687372-231687394 GGTGGCAGCAAGAGAAAATGAGG + Intronic
1063250490 10:4268594-4268616 GGTGGCAGCAAGAGAAAATGAGG + Intergenic
1063754405 10:8990574-8990596 GGTGGCTTCAAATGTAAGTAGGG - Intergenic
1064907132 10:20358810-20358832 GGTGGCAGCAAGAGAAAATGAGG - Intergenic
1066660007 10:37729157-37729179 GGTGGCAGCAACAGCAAGTCTGG + Intergenic
1067337818 10:45378968-45378990 GGTGCCTGCAGGTGTAGGTAGGG + Intronic
1067819785 10:49518569-49518591 GGTGGCATCAAGTGGAGGTGGGG - Intronic
1068127869 10:52864286-52864308 GATTGCAGCAAGTGAAAATAAGG - Intergenic
1068519318 10:58061916-58061938 GGTGGCAGCAAGAGAAAATGAGG + Intergenic
1069216551 10:65828455-65828477 GGTGGCAGCAAGAGAAAGTGTGG - Intergenic
1069723552 10:70563964-70563986 GTTGGCAGGAAGTGGCAGTAAGG + Intronic
1069861199 10:71472712-71472734 GGTGGCAGCAAGTGGTGGGAGGG + Intronic
1070940786 10:80344732-80344754 GGTGGCAGCAAGAGAAAATGAGG - Exonic
1071992456 10:91113247-91113269 GGAGGCAGTAAGTGTAACTGTGG + Intergenic
1072264773 10:93716669-93716691 GGTGGGAGCAGGAGGAAGTAGGG + Intergenic
1073455638 10:103635322-103635344 GGTGGCAGCAAGAGATAGTGGGG + Intronic
1073773350 10:106759726-106759748 GGGGGCAGCAAGAGAAAGAAAGG - Intronic
1074680676 10:115903996-115904018 GGAGGAAGCATGAGTAAGTAAGG + Intronic
1074918749 10:117985126-117985148 GGTGGCAGCAAGAGAAAATGAGG - Intergenic
1075112634 10:119599720-119599742 GGTGGCAGCAAGAGAAAATGAGG - Intergenic
1075243778 10:120801877-120801899 AGTGGCAGCCAGTGGATGTATGG - Intergenic
1077525807 11:3063913-3063935 GGTGGCAGCAAGAGAAAATAAGG - Intergenic
1078496855 11:11825895-11825917 GGTGGCAGCAAGAGAAAATGAGG + Intergenic
1079237426 11:18700357-18700379 GGTGGCATCAAGGGCAAGGAGGG - Intronic
1081437413 11:43041976-43041998 GGTGGCAGCAAGAGAAAATGAGG + Intergenic
1085890381 11:80572592-80572614 AGTGGCAGCAAGAGAAAATAAGG + Intergenic
1086056441 11:82653072-82653094 GGTGGCAGCAAGAGAAAATGAGG - Intergenic
1086056721 11:82654988-82655010 GGTGGCAGCAAGAGAAAATGAGG - Intergenic
1086721544 11:90127676-90127698 GGTGGCAGCAAGAGAAAATGAGG + Intergenic
1087689394 11:101302219-101302241 GGTGGCAGCAAGAGAAAATGAGG - Intergenic
1088998892 11:115032170-115032192 GTTGGCAGCAAGAGAAAGTGAGG + Intergenic
1089196987 11:116699649-116699671 GATGGCAGCAAGTGCTGGTATGG - Intergenic
1089284644 11:117397654-117397676 GGTGGCAGCAAGAGAAAATGAGG + Intronic
1089602683 11:119625070-119625092 GGTGGGAGCCAGTGTATGTGTGG + Intronic
1091065837 11:132510630-132510652 GGTGGCAGCAAGAGAAAATGAGG - Intronic
1091202291 11:133791033-133791055 GGTGGCAGAATGTGTAAACAAGG + Intergenic
1091518146 12:1207952-1207974 GGTGGGTGCCAGAGTAAGTATGG - Intronic
1092023198 12:5219405-5219427 GGAGGCAGCAAGTGTATGCAGGG - Intergenic
1092620864 12:10266115-10266137 TGTGGAAGCAAGGGTTAGTATGG - Intergenic
1092970759 12:13692583-13692605 GGTGCCAGCATGAGCAAGTATGG + Intronic
1093768738 12:22996005-22996027 GATGGCAGCCATTGTAAGAAGGG + Intergenic
1094241121 12:28225898-28225920 GCTGGCAGCAGGTTTAAGGATGG + Intronic
1098050393 12:66446793-66446815 GCTGGCAGAGAGTGGAAGTAGGG - Intronic
1098198592 12:68029583-68029605 GGTGGCAGCAAGAGAAAATGAGG + Intergenic
1099104916 12:78485773-78485795 GGTGGCAGCAAGAGAAAATGAGG + Intergenic
1102596369 12:113995801-113995823 GGTGGCAGAAACTGTTAGCAGGG + Intergenic
1104304807 12:127600076-127600098 GGTGGCAGCAAGAGAAAATGAGG - Intergenic
1105402082 13:20104974-20104996 GGTGGCAGAAACTGAAAGGAAGG + Intergenic
1107667980 13:42712562-42712584 GGTGGCAGCAAGAGAAAATGAGG + Intergenic
1108800706 13:54092026-54092048 GGTGGCAGCAAGGACAGGTATGG + Intergenic
1109029475 13:57174706-57174728 GGATGCAACAAGTGTCAGTAAGG + Intergenic
1109824023 13:67693394-67693416 GGTGGCAGCAAGAGAAAATGAGG + Intergenic
1109969502 13:69748385-69748407 GGTGGCAGCAAGAGAAAATTAGG + Intronic
1110083517 13:71346802-71346824 GGTGGCAGCAAGAGAAAATGAGG + Intergenic
1110449567 13:75626339-75626361 GGTGGCAGCAAGAGAAAATGAGG + Intronic
1110488895 13:76079434-76079456 GGTGGCAGCAAGAGAAAATCAGG - Intergenic
1110649537 13:77926898-77926920 GGTGGCAGCAAGAGAAAATGAGG + Intergenic
1110730421 13:78874045-78874067 GGTGGCAGCAGGTGTTGTTATGG + Intergenic
1111072351 13:83185393-83185415 GGTTTCAGCAAGCGTAAGTTTGG + Intergenic
1111907330 13:94270844-94270866 AGTGGCAGAAAGAGAAAGTATGG + Intronic
1113065814 13:106373670-106373692 GGTGGCAGGATGGGTAAGGAAGG - Intergenic
1115484206 14:33894025-33894047 GGTGGCAGCAAGAGAAAATGAGG - Intergenic
1115931695 14:38504008-38504030 GGTGGCAGCAAGAGAAAATGAGG + Intergenic
1116019391 14:39442102-39442124 GATGGCAGCAAGTTTCAGTGGGG - Intergenic
1116127173 14:40802044-40802066 GGTGGCAGCAAGAGAAAATGAGG + Intergenic
1117240621 14:53829039-53829061 GAAGGCAGCAAGTGGAATTAGGG + Intergenic
1117937682 14:60925600-60925622 GATGGAAGGAAGTGTAAGGAAGG - Intronic
1118276703 14:64392029-64392051 GGTGGCTGCAATTTTAAATATGG + Intronic
1118410807 14:65475784-65475806 GGGGGCAAAAAGTGTAAGGATGG + Intronic
1118537426 14:66783279-66783301 GGTGGCAGCAGGGCTGAGTAGGG + Intronic
1119216191 14:72871032-72871054 GGTGGCAGCAAGAGAAAATGAGG + Intronic
1120457387 14:84749480-84749502 GGTGGCTGCAATTTTAAATATGG - Intergenic
1123795413 15:23765847-23765869 GGTGGCAGCAAGAGAAAATGAGG - Intergenic
1123795759 15:23768098-23768120 GGTGGCAGCAAGAGAAAATGAGG - Intergenic
1126658348 15:51005327-51005349 GATGGCAGCAAGTGTGAATCTGG + Exonic
1127207831 15:56738851-56738873 GGTGGCAACAAGTTGAAGGAAGG + Intronic
1129024596 15:72558664-72558686 GGTGGCAGCAAGTGTCACTCTGG - Intronic
1129032639 15:72629806-72629828 TGTGGCAGCAGGTGTATGTCTGG - Intergenic
1129062928 15:72874737-72874759 GGGGGCAGGAAGTGTAGGCAGGG - Intergenic
1129734403 15:77951718-77951740 TGTGGCAGCAGGTGTATGTCTGG + Intergenic
1129841186 15:78744273-78744295 TGTGGCAGCAGGTGTATGTCTGG - Intergenic
1130821378 15:87499830-87499852 GCAGGCAGCCAGTGTAAGTTAGG + Intergenic
1131533273 15:93212824-93212846 AGTGACAGCAAGTGGAAGGAGGG + Intergenic
1131788541 15:95938954-95938976 GGTAGGTGCAAGGGTAAGTATGG + Intergenic
1132065277 15:98725822-98725844 GGTGGCAGCAAGAGAAAATGTGG + Intronic
1134051401 16:11140299-11140321 GGTGGCAGGAAGAGTCAGTGTGG + Intronic
1139812912 16:69637552-69637574 GGTGGCAGCAAGAGAAAATGAGG + Intronic
1144296501 17:13880082-13880104 GGTGACAGCAAGTGTCTGTGGGG + Intergenic
1145740574 17:27270735-27270757 GGTGGCAGCAAGAGAAAATAAGG - Intergenic
1146620557 17:34393878-34393900 GGTGGCAGAAAGTGGAAATAGGG + Intergenic
1148046454 17:44747928-44747950 GCTGGCAGCAAGGGGAAGCAGGG - Intronic
1148388410 17:47253221-47253243 GGTGCAAGCAAGTGTTTGTAGGG + Intergenic
1148917471 17:50994266-50994288 GGTGGCAGCAAGAGAAAATGAGG - Intronic
1149853980 17:60062921-60062943 GGTGGCAGCAAGAGAAAATGAGG - Intronic
1151232112 17:72692498-72692520 GGTGGCAGCAAGAGAAAATGAGG + Intronic
1153427002 18:4975906-4975928 GGTGGCAGCAAGAGAAAATGAGG + Intergenic
1153449574 18:5212065-5212087 GGTGGCAGCAAGAGAAAATGAGG + Intergenic
1153538918 18:6134112-6134134 GGTGGGAGCAAGAGAAAGTGAGG + Intronic
1153539214 18:6136029-6136051 GGTGGCAGCAAGGGAAAATGAGG + Intronic
1157369567 18:47098371-47098393 GGTGGCAGCAAGAGAAAATGAGG + Intronic
1158038102 18:53059076-53059098 GGTGGCAGCAAGGAGAAGTGTGG + Intronic
1158468602 18:57713925-57713947 GGTGGTAGCAAGTGCAAGGCAGG - Intronic
1158833414 18:61304387-61304409 GGTGGCAGCAAGAGAACGTGAGG - Intergenic
1158905433 18:62006809-62006831 GGTGGCAGCAAGAGAAAATGAGG + Intergenic
1159139136 18:64371151-64371173 GGTGGCAGCAACTCTGAGTTAGG + Intergenic
1159205059 18:65238857-65238879 GATGGCAGCAACTGTCAGCAAGG - Intergenic
1159410050 18:68061103-68061125 GGTGGCAGCAAGAGGAAATGAGG + Intergenic
1159962557 18:74566988-74567010 GGTGGCAGCAAGAGAAAATGCGG + Intronic
1159996757 18:74971963-74971985 GGTGGCAGCAAGAGAAAATGAGG + Intronic
1160601787 18:80019314-80019336 GGTGGCAGCAAGAGAAAATGAGG + Intronic
1161034918 19:2079237-2079259 GGTAGCAGCAAGTCTAGGTCCGG - Intronic
1162246336 19:9404948-9404970 GGTGGTAGCTAGTGGAAGTAAGG - Intergenic
1164401906 19:27908760-27908782 TGTGGGAGCTAGAGTAAGTATGG + Intergenic
925276784 2:2655715-2655737 GGTGGCAGTCAGTGTAAGTGTGG + Intergenic
925443396 2:3907561-3907583 GGTGGCAGCAAGAGAAAATGAGG + Intergenic
925687888 2:6492092-6492114 GATGGCAGCCAGTGGAATTAAGG + Intergenic
926686606 2:15703157-15703179 GGTGGCAGCAAGAGAAAATGAGG + Intronic
926888317 2:17617715-17617737 GGAGGCAGCAAGTGGAAGTAAGG + Intronic
926947578 2:18204451-18204473 GGTGGCAGCAAGAGAAAATGAGG - Intronic
927372247 2:22369641-22369663 GGCGGCAGCAAGTGAATGAAAGG + Intergenic
928679984 2:33692109-33692131 GGTGGCAGCAAGAGAAAATGAGG + Intergenic
928680266 2:33694058-33694080 GGTGGCAGCAAGAGAAAATGAGG + Intergenic
929134399 2:38609318-38609340 GGTGGCAGCAAGAGAAAATGAGG + Intergenic
929528691 2:42731466-42731488 GGTGGCAGCAAGAGAAAATGAGG + Intronic
931294248 2:60906060-60906082 GGTGGCAGCAAGAGAAAATGAGG + Intronic
932428135 2:71656697-71656719 GGTGGCAGCAAGAGAAAATGAGG + Intronic
932497565 2:72153951-72153973 GGTGGGAGCAAGTGGCACTAAGG - Intergenic
932976305 2:76603407-76603429 GGTGGCAGCAAGAGAAAATGAGG + Intergenic
933797028 2:85927819-85927841 GGTTGTAGCAAGTGTGAGGATGG + Intergenic
935131406 2:100264049-100264071 GGTGCCAGCAAGAGCAAGGAGGG - Intergenic
936792490 2:116165775-116165797 GGTGGCAGCAAGAGAAAATGGGG - Intergenic
937519143 2:122690118-122690140 CCTGTCATCAAGTGTAAGTATGG - Intergenic
940441187 2:153718638-153718660 GGAGGCAGCAGGTGTCAGGACGG + Intergenic
940602098 2:155875381-155875403 GGTGGCAGCAAGGCTAGGAAGGG + Intergenic
941025321 2:160450092-160450114 GATGGCAGCAAGTGCTGGTATGG - Intronic
941452159 2:165672631-165672653 GGAGTCAGCAAGAGTAAGTGAGG + Intronic
943115046 2:183658379-183658401 GGTGGCAGCAAGAGAAAATGAGG - Intergenic
944546682 2:200805723-200805745 AGTGGGAGCAAGTGTGAGTGAGG - Intergenic
945140754 2:206683902-206683924 GATGGCAGCAAATTTAAGTATGG - Intronic
945961436 2:216139376-216139398 GGTGGCAGCAAGAGAAAATGAGG + Intronic
947739329 2:232477996-232478018 GGTGTCAGCAGGTGTCAGCATGG - Intergenic
948296762 2:236866447-236866469 GGTGGCAGCAAGAGAAAATGAGG + Intergenic
948785871 2:240352653-240352675 GGTGGCAGCAAGAGAAAATGAGG + Intergenic
1169536419 20:6547017-6547039 GGTGGCAGCAAGAGAAAATGAGG - Intergenic
1170106762 20:12759779-12759801 GGTGGCAGCAAGAGAAAATGAGG + Intergenic
1172509870 20:35493162-35493184 CGTGGCATCAAGTGGAAGTAGGG + Intronic
1173393596 20:42657131-42657153 GGTGGCAGGAAGTAGAAGTGTGG - Intronic
1173443448 20:43097160-43097182 GGAGCCAGGAAGTGGAAGTATGG + Intronic
1174314952 20:49691973-49691995 GGTGGCAGCAAGGATAAATCAGG - Intronic
1176875552 21:14123476-14123498 GGTGGGAGCAAGAGGAAGGATGG - Intronic
1177392770 21:20498256-20498278 GGTGGCAGCAAGAGAAAATGAGG + Intergenic
1177392913 21:20499419-20499441 GGTGGCAGCAAGAGAAAATGAGG + Intergenic
1180869733 22:19139310-19139332 GGTAGCAGCAGGTGTCAGAAGGG + Intronic
1183187254 22:36299312-36299334 GGTGACAGCTAGTGTCAGCAGGG + Intronic
1184178859 22:42805873-42805895 GGTGGCAGCAAGTGAGACAAGGG - Intronic
953361770 3:42303399-42303421 GGTGGCAGGAAGTGGAAGAGGGG + Intergenic
954372440 3:50175947-50175969 GGTGGCAGCAGGTGGCAGGATGG - Intronic
955223663 3:57043748-57043770 GGTGACAGAAAGTATAAGGAGGG + Intronic
955530140 3:59864354-59864376 GGTGGCAGCAAGAGAAAATCAGG - Intronic
955671312 3:61406091-61406113 GGTGGCAGCAAGAGAAAATGAGG - Intergenic
956412537 3:68993813-68993835 GGTGGCAGCAAGGGAAAATGAGG + Intronic
956503409 3:69911164-69911186 GGTGGCAGCAAGAGAAAATGAGG - Intronic
957145188 3:76414021-76414043 GGTGGCAGCAAGAGAAAATGAGG + Intronic
957273116 3:78056535-78056557 GGTGGCAGCAAGAGAAAATGAGG - Intergenic
959171899 3:102854231-102854253 GGTGGCAGCAAGAGAAAATAAGG + Intergenic
959342679 3:105150195-105150217 GGTGGCAGCAAGAGAAAATGAGG + Intergenic
959975106 3:112450098-112450120 GGTGGCAGCAAGAGAAAATGAGG + Intergenic
960009491 3:112817935-112817957 GGTGGCAGCAAGAGAAAATGAGG + Intronic
960072516 3:113447060-113447082 GGTGGCAGCAAGAGAAAATGAGG - Intronic
960665455 3:120104485-120104507 GGTGGCAGCAAGAGAAAATGAGG - Intergenic
961253748 3:125528011-125528033 GGTGGCAGCAAGAGAAAATGAGG - Intergenic
962440323 3:135407324-135407346 GGTGGCAGCAAGAGAAAATGAGG + Intergenic
963211810 3:142700932-142700954 GGTGGCAGCAAGAGAAAATGAGG - Intronic
963347971 3:144118713-144118735 GGTGGCAGCAAGAGAAAATGAGG - Intergenic
964076548 3:152699872-152699894 GGTGGCAGCAAGAGAAAATTAGG + Intergenic
964212816 3:154246822-154246844 GGTGGCAGTAAGTGGAAGAGAGG + Intronic
964220169 3:154334316-154334338 GGTAGGAGCAAGGGTAAGCATGG - Intergenic
964316669 3:155452200-155452222 GGTGGCAGCAAGAGAAAATGAGG + Intronic
964394687 3:156233301-156233323 GGGGGCTGCAAGTGTAAATAGGG + Intronic
964520545 3:157562546-157562568 GGTGGCAGCAAGAGAAAATGAGG + Intronic
964910633 3:161776263-161776285 GGTGGCAGCAAGAGAAAATGAGG - Intergenic
965499882 3:169444495-169444517 GGTGGCAGCAAGAGAAAATGAGG - Intronic
966343126 3:178947476-178947498 GGTGGCAGCAAGAGAAAATGAGG - Intergenic
966446718 3:180008673-180008695 GGTGGCAGCAAGAGAAAATGAGG + Intronic
967065918 3:185915196-185915218 GGTCCCAGCAAGTGGAAATAAGG - Intergenic
967457357 3:189703536-189703558 GGTGGCTGCCAGTTTGAGTAGGG + Intronic
969072721 4:4552385-4552407 GGTGGCAGCAAGAGAAAATGAGG - Intergenic
970150445 4:13083465-13083487 GGTGGCAGCATGTGAAGGTGAGG + Intergenic
970217903 4:13778804-13778826 GGTGGCAGCAAGAGAAAATGAGG + Intergenic
970218189 4:13780754-13780776 GGTGGCAGCAAGAGAAAATGAGG + Intergenic
970741925 4:19249693-19249715 GGTGGCAGCAAGAGCAAATGAGG - Intergenic
970868025 4:20781551-20781573 GGTGGCAGCAAGAGAAAATGAGG + Intronic
972002542 4:34057641-34057663 GGTGGCAGCAAGAGAAAATGAGG + Intergenic
972857247 4:43121484-43121506 GGTGGCAGCAAGAGAAAATGAGG + Intergenic
973187937 4:47353048-47353070 GATGGCAGCAAGAGAAAATAAGG + Intronic
973264240 4:48195179-48195201 GGTGGGAGGAAGTGTGACTAGGG + Intronic
976764270 4:88582761-88582783 GGTGGCAGCAAGTTACAGGAAGG - Intronic
976811929 4:89107883-89107905 GGTGGCAGCAAGAGAAAATGGGG - Intronic
977026208 4:91821938-91821960 GGTGGCAGCAAGAGAAAATGAGG + Intergenic
977463527 4:97356084-97356106 GGTGGCAGCAAGAGAAAATGAGG + Intronic
977463793 4:97358032-97358054 GGTGGCAGCAAGAGAAAATAAGG + Intronic
977670257 4:99686452-99686474 GGTGGCTGCAAGAGAAAATAAGG - Intergenic
977749871 4:100596447-100596469 GGTGGCAGCAAGTGGAAATCTGG - Intronic
977769062 4:100835571-100835593 GGTGGCAGCAAGAGAAACTGAGG - Intronic
977942660 4:102875974-102875996 GGTGGCTGCAATTTTAGGTAAGG - Intronic
978284340 4:107057933-107057955 GGTGGCAGCAAGAGAAAATGAGG + Intronic
980202653 4:129676299-129676321 GGTGGCAGCAAGAGAAAATTAGG - Intergenic
980292321 4:130859432-130859454 GGTGGCAGCAAGAGAAAATGAGG - Intergenic
981861357 4:149360672-149360694 GGTGGCAGCAAGAGAAAATGAGG - Intergenic
982151188 4:152459321-152459343 GGTGGAAGCTAGTGTAAAAATGG - Intronic
982607993 4:157538326-157538348 GGTGGCAGCAAGAGAAAATAAGG + Intergenic
982608245 4:157540255-157540277 GGTGGCAGCAAGAGAAAATGAGG + Intergenic
982912014 4:161154485-161154507 GGTAACAGCAATTGGAAGTAAGG + Intergenic
983068248 4:163236738-163236760 GGTGGCAGCAAGAGAAAATGAGG + Intergenic
983322271 4:166210774-166210796 GGTGGCAGCAAGATAAAGTGAGG + Intergenic
983419736 4:167501798-167501820 GGTGGCAGCAAGAGAAAATGAGG + Intergenic
984017224 4:174441081-174441103 GGTGGCAGCAAGAGAAAATGAGG + Intergenic
984900489 4:184581822-184581844 GGTGGCAGCAAGAGAAAGTGAGG + Intergenic
985184147 4:187297457-187297479 GGTGGCAGCAAGAGAAAATGAGG + Intergenic
985807623 5:2058845-2058867 GGTGGCAGCAAGAGAAAATGAGG + Intergenic
985809037 5:2069660-2069682 GGTGGCAGCAAGAGAAAATGAGG - Intergenic
986113787 5:4749693-4749715 GGTGGCAGCAAGAGAAAATGAGG + Intergenic
987985315 5:25138463-25138485 TGTGTCAGTTAGTGTAAGTAAGG + Intergenic
988843367 5:35104653-35104675 GGTGGCAGCAAGGGTGGGGAAGG + Intronic
989396338 5:40961020-40961042 GGTGAAAGCAAGTTTAAGTAAGG - Intronic
989767340 5:45103198-45103220 GGTGGCAGCAAGAGAAAATGAGG - Intergenic
990075564 5:51842800-51842822 GGTGGCAGCAAGAGAAAATGAGG + Intergenic
992184591 5:74231872-74231894 GGTGGCAGCAGGAGTGACTAAGG + Intergenic
993304447 5:86257591-86257613 GGTGGCAGCAAGAGAAAATGAGG + Intergenic
994895403 5:105696892-105696914 GGTGGCAGCAAGAGAAACTGAGG + Intergenic
996458405 5:123711785-123711807 GGTGTCTGCAAATGTAATTAAGG - Intergenic
996617548 5:125458905-125458927 GGTGGCAGCAAGAGAAAATCGGG - Intergenic
997996794 5:138593022-138593044 GATGGCAGCAAGTGTTACCATGG + Intergenic
998561705 5:143178485-143178507 GATGTTAGCAAGTGTAGGTAGGG - Intronic
999107890 5:149090029-149090051 GGTGGCAGCAAGAGAAAATGAGG - Intergenic
999192729 5:149760571-149760593 GGTGGCAGCAAGTGTAGAGAAGG + Intronic
1000648290 5:163784841-163784863 GGTGGCAGCAAGAGAAAATGAGG + Intergenic
1000648575 5:163786773-163786795 GGTGGCAGCAAGAGAAAATGAGG + Intergenic
1000751239 5:165098589-165098611 GGTGGCAGCAAGAGAAAATGAGG + Intergenic
1001735959 5:174001693-174001715 GGTGGTAGCAAAGGTAAATATGG - Intronic
1002618140 5:180468087-180468109 TGTGGCAGTAAGTGGAAGGACGG - Intergenic
1003397589 6:5766310-5766332 GATGGCTGCAAGGGTAAGAAAGG - Intronic
1004192002 6:13472042-13472064 GGTGGCAGCAAGAGAAAATGAGG + Intronic
1004566956 6:16807160-16807182 AGTGGCAGCAAGAGTAGGCAAGG - Intergenic
1008756273 6:54798230-54798252 GGTGGCAGCAAGAGAAAATGAGG - Intergenic
1009645334 6:66394629-66394651 GGTGGCAGCAAGAGAAAATGAGG + Intergenic
1009816821 6:68747951-68747973 GGTGGCAGCAAGAGAAAATGAGG + Intronic
1009980306 6:70719716-70719738 GGTGGCAGCAAGAGAAAATGAGG + Intronic
1012239362 6:96854549-96854571 GATGGCAGCAAGTGGAAATTTGG + Intergenic
1012826493 6:104152636-104152658 GGTGGCAGCAAGAGAAAATGAGG + Intergenic
1013080917 6:106811861-106811883 GGTGGCAGCAAGAGAAAATGAGG + Intergenic
1015523049 6:134150658-134150680 GGTGGCAGCAAGAGAAAGTGAGG - Intergenic
1015595030 6:134858606-134858628 GGTGGCAGCAAGGAGAAGTGCGG + Intergenic
1015815548 6:137207649-137207671 GGTGGCAGCAAGAGAAAATGAGG - Intronic
1016419871 6:143872691-143872713 GGTGGCAGCAAGAGAAAATGAGG + Intronic
1016420155 6:143874597-143874619 GGTGGCAGCAAGAGAAAATGAGG + Intronic
1016782924 6:147979715-147979737 GGTGGCAGCAAGAGAAAATGAGG - Intergenic
1022861234 7:34369194-34369216 GATGGCAGCAACTGTGAGAAGGG - Intergenic
1022909271 7:34884195-34884217 GGTGGCAGCAAGAGAAAATGAGG + Intergenic
1024639754 7:51318985-51319007 AGAGGCAGCAAGAGGAAGTATGG + Intergenic
1024675206 7:51631937-51631959 GGTGACAGCAACTGTAAGTGAGG - Intergenic
1024978904 7:55140376-55140398 GGTAGCCGCAAGTGTTAGTTGGG - Intronic
1026619392 7:71936918-71936940 GGTGGCAGCAAGAGAAAATGAGG - Intronic
1027556354 7:79669355-79669377 GGTGGCAGCAAGAGACAGAATGG - Intergenic
1028011083 7:85645316-85645338 GGTGGCAGCAAGAGAAAATGTGG - Intergenic
1028011236 7:85647868-85647890 GGTGGCAGCAAGAGAAAATGAGG + Intergenic
1029035008 7:97510134-97510156 GGTGGCAGCAAGAGAAAATGAGG + Intergenic
1029129243 7:98317683-98317705 GGTCCCAGCCAGTGTAAGGATGG - Intronic
1029404769 7:100367953-100367975 GTTGGAAGCAAGTTTAAGAAGGG + Intronic
1030784153 7:113640020-113640042 GGTGGCAGCAAGAGAAAATGAGG + Intergenic
1031826915 7:126576850-126576872 GGGGGCTGTAAGTGTAAGTCTGG - Intronic
1033456556 7:141508672-141508694 GGTGGCAGCAAGAGTAAATGAGG + Intergenic
1035353648 7:158264549-158264571 GGTGGCAGCAGGTGACAGTGGGG + Intronic
1036713643 8:11100014-11100036 GGGTGCAGCCAGTTTAAGTAGGG + Intronic
1037524893 8:19715118-19715140 GGTGGCAGCAAAAGTAAATGAGG + Intronic
1040052540 8:43031171-43031193 GGTTGCAGTGAGTGTAAGTCAGG + Intronic
1041448322 8:57978399-57978421 GGTGGCAGCAAGAGAAAATGAGG - Intergenic
1041774091 8:61505173-61505195 GGTGGCGGCAAGAGAAAATAAGG - Intronic
1041991148 8:63993210-63993232 GGTGGCAGAAATTTTTAGTAGGG + Intergenic
1042602392 8:70511611-70511633 GGTGGCAGCAAGAGAAAATGAGG - Intergenic
1042728476 8:71904138-71904160 GGTGGCAGCAAGAGAAAATGAGG + Intronic
1043510656 8:80947013-80947035 GGTGGCAGCAAGAGAAAATGAGG - Intergenic
1043788573 8:84433636-84433658 GGTGGCAGCAAGGGAAAATGAGG - Intronic
1044198238 8:89403565-89403587 GGTGGCAGCAAGAGAAAATGAGG - Intergenic
1044279589 8:90340050-90340072 GGTGGCAGCAAGAGAAAATGAGG - Intergenic
1044442217 8:92236330-92236352 GGCGGCAGCAAGAGAAAATAAGG + Intergenic
1044796484 8:95904214-95904236 TTTGGCAGGAAGTGTAAGTGAGG - Intergenic
1046129134 8:109945743-109945765 GGTGGCAGCAAGAGAAAATGAGG - Intergenic
1046855619 8:119028476-119028498 GGTAGCAGCAAGAGAAAATAAGG + Intronic
1047195687 8:122719213-122719235 GGTGGCAGCAAGAGAAAATGAGG - Intergenic
1048655709 8:136533709-136533731 GGTGGCAGCAAGAGAAAATGAGG + Intergenic
1048675282 8:136770963-136770985 GGTGGCAGCAAGAGAAAATGAGG + Intergenic
1051450527 9:17192980-17193002 GGTGGCAGCAAGAGAAAATGAGG + Intronic
1052019510 9:23509187-23509209 GGTGGCAGCAAGAGAAAATGAGG - Intergenic
1052351005 9:27458212-27458234 AGTGGCACCAAGGGTATGTATGG - Intronic
1053603966 9:39638167-39638189 GGTGTAAGCAAGTGTGAGAATGG + Intergenic
1054249574 9:62704247-62704269 GGTGTAAGCAAGTGTGAGAATGG - Intergenic
1054563685 9:66738779-66738801 GGTGTAAGCAAGTGTGAGAATGG - Intergenic
1055506403 9:76954036-76954058 GGTGGGTGCAACTGTAAGTCAGG + Intergenic
1055534758 9:77228832-77228854 GGTGGCAGCAAGAGAAAATGAGG + Intronic
1055680017 9:78705060-78705082 GGTGGCAGCAAGAGAAAATGAGG - Intergenic
1055701204 9:78947734-78947756 GGTGGCAGCAAGAGAAAATGAGG - Intergenic
1055888742 9:81099172-81099194 GGTGGCAGCAAGAGAAAATGAGG - Intergenic
1056129057 9:83566192-83566214 GGTGGCAGCAAGAGAAAATGAGG + Intergenic
1056924240 9:90819508-90819530 GGTGGCAGCAAGAGAAAATGAGG + Intronic
1059753474 9:117271224-117271246 GGTGGCAGCAAGAGAAAATGAGG + Intronic
1060308319 9:122435979-122436001 GGTGGCAGCAAGAGAAAATGGGG - Intergenic
1062617120 9:137402875-137402897 GGTGGCAGCAAGAGAAAATGAGG + Intronic
1185893512 X:3839812-3839834 GGTGGCAGCAAGAGAAAATGAGG - Intronic
1185898629 X:3878236-3878258 GGTGGCAGCAAGAGAAAATGAGG - Intergenic
1185903744 X:3916665-3916687 GGTGGCAGCAAGAGAAAATGAGG - Intergenic
1185968393 X:4633569-4633591 GGTGGCAGCAAGGGAAAATGAGG + Intergenic
1186335374 X:8581294-8581316 GGTGGCAGCAAGAGAAAATGAGG - Intronic
1187555048 X:20343601-20343623 GGTGGCAGCAAGAGAAAATGAGG - Intergenic
1187555334 X:20345567-20345589 GGTGGCAGCAAGAGAAAATAAGG - Intergenic
1187645094 X:21338922-21338944 CGTGGCAGCAAGAGAAAATAAGG - Intergenic
1188896071 X:35669922-35669944 GGTGGCAGCAAGAGAAAATGAGG + Intergenic
1189025112 X:37386544-37386566 TGTGTGAGCAAATGTAAGTATGG - Intronic
1189132784 X:38517714-38517736 GGTGGCAGCAAGAGAAACTGAGG + Intronic
1190375447 X:49784477-49784499 GGAGACATCATGTGTAAGTATGG + Intergenic
1190439906 X:50467151-50467173 GGTGGCAGCAAGTGTAAGTAAGG - Intronic
1192162335 X:68797769-68797791 GGTGGCAGCAAGAGAAAATGAGG - Intergenic
1194473835 X:94334625-94334647 GGTGGCAGCAAGAGAAAATGTGG - Intergenic
1194474116 X:94336558-94336580 GGTGGCGGCAAGAGAAAATAAGG - Intergenic
1195227893 X:102817341-102817363 GGTGGCAGCAAGAGAAAATAAGG + Intergenic
1195228189 X:102819268-102819290 GGTGGCAGCAAGAGAAAATGAGG + Intergenic
1199030800 X:142996909-142996931 GGTGACAGCAGGTGTTAATATGG + Intergenic
1199112002 X:143946314-143946336 GGTGGCAGAAAGAGAAAGTGAGG - Intergenic
1199180405 X:144847847-144847869 GGTGGCAGCAAGAGAAAATGAGG + Intergenic
1199330727 X:146555008-146555030 GGAGGCAGCAAGAGTAAATGAGG - Intergenic
1199917880 X:152363944-152363966 GATGGCAGCAAGTGAATGAAAGG + Intronic
1201469620 Y:14318832-14318854 GGTGGCAGCAAGAGAAAATGAGG - Intergenic