ID: 1190443629

View in Genome Browser
Species Human (GRCh38)
Location X:50501057-50501079
Sequence GCATTATTTCAGTGTAAATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190443629_1190443631 26 Left 1190443629 X:50501057-50501079 CCACATTTACACTGAAATAATGC No data
Right 1190443631 X:50501106-50501128 GATTATGCAGAATTTTGTCAAGG No data
1190443629_1190443630 -5 Left 1190443629 X:50501057-50501079 CCACATTTACACTGAAATAATGC No data
Right 1190443630 X:50501075-50501097 AATGCAGTAATACTTCTGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190443629 Original CRISPR GCATTATTTCAGTGTAAATG TGG (reversed) Intergenic
No off target data available for this crispr