ID: 1190447789

View in Genome Browser
Species Human (GRCh38)
Location X:50546959-50546981
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190447789_1190447793 12 Left 1190447789 X:50546959-50546981 CCCCAAATGTCCAAGTTTCAACT No data
Right 1190447793 X:50546994-50547016 CATGCAAAAAAAAAAAAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190447789 Original CRISPR AGTTGAAACTTGGACATTTG GGG (reversed) Intergenic
No off target data available for this crispr