ID: 1190450654

View in Genome Browser
Species Human (GRCh38)
Location X:50577389-50577411
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190450653_1190450654 1 Left 1190450653 X:50577365-50577387 CCTCTGAAGTTGTGCAAAATAAA No data
Right 1190450654 X:50577389-50577411 AGCCAATTGCTGAAAGTAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190450654 Original CRISPR AGCCAATTGCTGAAAGTAAG AGG Intergenic
No off target data available for this crispr