ID: 1190452848

View in Genome Browser
Species Human (GRCh38)
Location X:50598189-50598211
Sequence CAGGGCTCCCTCTTTCAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 112}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190452848_1190452849 -8 Left 1190452848 X:50598189-50598211 CCAACTTGAAAGAGGGAGCCCTG 0: 1
1: 0
2: 1
3: 17
4: 112
Right 1190452849 X:50598204-50598226 GAGCCCTGAGAAGAAACAAATGG 0: 1
1: 0
2: 3
3: 44
4: 366

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190452848 Original CRISPR CAGGGCTCCCTCTTTCAAGT TGG (reversed) Intronic
900814732 1:4834808-4834830 CAAGGCTCCCTCTTGGAAATGGG - Intergenic
903558031 1:24207223-24207245 CAGGACTCCCTCGTTCCGGTAGG - Intergenic
904769208 1:32871387-32871409 TAGGGCTCCGTGTTTCCAGTGGG + Intronic
907152221 1:52299672-52299694 CAGGGCTCCCTCATTCTGTTGGG + Intronic
917990437 1:180371378-180371400 CAGTGCTTCCTATCTCAAGTAGG - Intronic
919692772 1:200542354-200542376 AAGGTCTCCCTCTTTCACCTGGG - Intergenic
920054477 1:203182285-203182307 CAGGCCTCCCCCTTTCCTGTTGG - Intronic
920128084 1:203709619-203709641 GAGGGCTCCCTCATTCACATGGG - Intronic
922392013 1:225153908-225153930 CGGGGCTCCCTGTTTTAACTTGG - Intronic
922502906 1:226110136-226110158 CGGGGCTCCCTTTTTTAAGCAGG - Intergenic
923626035 1:235614789-235614811 CAGTGCTACCTCTTTCCTGTGGG + Intronic
1064119719 10:12607933-12607955 CAGGTCTCCCTCTGTCACCTAGG - Intronic
1067783420 10:49225686-49225708 CAGGCCTCCCTCTCTGAAGTGGG + Intergenic
1069619394 10:69827280-69827302 CCCGGCTCCCTCTGTCCAGTAGG + Intronic
1070403410 10:76073680-76073702 CAGGGTGCCATTTTTCAAGTTGG + Intronic
1077322377 11:1948022-1948044 CAGGGCTTCCTGCTTCAATTTGG - Intronic
1080915654 11:36656126-36656148 CAGGGCTCCCACGGCCAAGTTGG - Intronic
1202805395 11_KI270721v1_random:3335-3357 CAGGGCTTCCTGCTTCAATTTGG - Intergenic
1091624892 12:2114230-2114252 CAGGGCTCCCTCTTGCCACATGG + Intronic
1092861410 12:12723365-12723387 CTGGGCTACATCTTTCAAGTAGG + Intergenic
1101464214 12:104931055-104931077 CAGGGCTTCCTTTTTCCAGGAGG - Intronic
1103323110 12:120102938-120102960 CAGGGCGCCCTCTGTCAAATGGG + Intronic
1103923704 12:124412537-124412559 CAGAGCTGCCTCATCCAAGTTGG + Intronic
1107867204 13:44714423-44714445 CAGGGCTCCCTGTTTCACTTAGG - Intergenic
1110433059 13:75448238-75448260 GAGGTCTCTTTCTTTCAAGTTGG + Intronic
1111995919 13:95166170-95166192 CAGAGCACCATCTTTCAAGGAGG + Exonic
1112208924 13:97353906-97353928 CAGAGCTACCACTTTAAAGTAGG - Intronic
1112352719 13:98650077-98650099 CAGGGCCTCTGCTTTCAAGTGGG - Intergenic
1113576172 13:111396696-111396718 CAGGGCCCCGTCTTGCACGTGGG + Intergenic
1114615796 14:24067699-24067721 TAGGGCTCCATCTTTCATTTAGG + Intronic
1115971157 14:38946279-38946301 CAGGGCTCGCTCTGTCAACCAGG + Intergenic
1119638587 14:76296700-76296722 CAGCTCTGCCTCTTTCAAGGTGG + Intergenic
1121058239 14:90878837-90878859 GAAGGCTACCTGTTTCAAGTGGG + Intronic
1122627751 14:103092813-103092835 CTGGGTTCCCTCTGTGAAGTGGG - Intergenic
1123964861 15:25444772-25444794 CAGGGCCCCCTCTGTCTAGAAGG - Intergenic
1131366306 15:91845023-91845045 CAGGGCTCCCTCTCTGAGGCAGG + Intergenic
1131680761 15:94720502-94720524 CAGTCCTTACTCTTTCAAGTAGG - Intergenic
1132706307 16:1244897-1244919 CAGGGATCCCTCTTTGATGTGGG - Intergenic
1133022925 16:2974718-2974740 CAGGGCTGCCTCTTGGAGGTGGG + Intronic
1134757538 16:16681488-16681510 GAGGGCACACTCTTCCAAGTTGG - Intergenic
1134988530 16:18677678-18677700 GAGGGCACACTCTTCCAAGTTGG + Intergenic
1137368875 16:47886541-47886563 CAGGGCTCCCTCCTCCAGGCAGG + Intergenic
1137966672 16:52941539-52941561 CAAGGCTGCCACTTTCTAGTGGG + Intergenic
1138320398 16:56106317-56106339 CAGTGCTCCATCTTTCCAGATGG - Intergenic
1141995437 16:87634181-87634203 CAGGGCTCTCACTGTCACGTTGG + Intronic
1144779123 17:17799144-17799166 CAGAGTTCCCTCTCTCATGTTGG - Intronic
1144950629 17:18991775-18991797 CTGGGCTCCCTCCTTCACTTGGG - Intronic
1146665107 17:34695765-34695787 CAGGGCTCCCACTTTAACCTGGG + Intergenic
1151418449 17:73982047-73982069 CAGAGCTCCGTCTCACAAGTGGG - Intergenic
1152099865 17:78294720-78294742 GAGGCCTCCCTCCTTAAAGTCGG + Intergenic
1153814785 18:8783029-8783051 CAGACCTCCCTCTTTCAAAGTGG - Intronic
1154055619 18:11010649-11010671 CAGAGCCCCCCATTTCAAGTTGG - Intronic
1154178026 18:12100952-12100974 GGGGGCTGCCTCTTTGAAGTAGG + Intronic
1155097426 18:22571328-22571350 CAAGACTTCCTCTTTCAAGATGG - Intergenic
1157224649 18:45851701-45851723 CAGGGCTGCCTCTCTCTAGTCGG - Exonic
1158703303 18:59768903-59768925 CATGGCTCCCAGTTTCAAGTGGG + Intergenic
1167555206 19:50190363-50190385 CAGCGATCCCACTTCCAAGTAGG - Intronic
1168469596 19:56629574-56629596 GAGGGCTCCCTCTATGAACTGGG + Intergenic
929838778 2:45434160-45434182 CAAGGATCCTTCTGTCAAGTTGG - Intronic
931650176 2:64461173-64461195 CAGGGCTCCCTCCTTCCTTTTGG - Exonic
948789404 2:240369594-240369616 CAGGGCTGCCTGTTTGAAGTTGG + Intergenic
1172969083 20:38860526-38860548 CAGAGTTCCCTCATTCAGGTTGG + Intronic
1174362547 20:50038041-50038063 CAGGGAGCCCACTTTCCAGTGGG - Intergenic
1174529072 20:51196626-51196648 CAGGGCTATTTCATTCAAGTTGG + Intergenic
1175372444 20:58501016-58501038 CAGGGGTTCATCTTTAAAGTGGG - Intronic
1176147105 20:63570464-63570486 CAGGGCTCCCTCCGCCCAGTCGG + Intronic
1179801324 21:43812751-43812773 CAGGGCTCCCTGGCTGAAGTGGG + Intergenic
1180131490 21:45829797-45829819 CAGGCCTCCCCGCTTCAAGTGGG - Intronic
1183647436 22:39134656-39134678 CAGGGCTCCCGCTGCCGAGTGGG + Exonic
1185216967 22:49606758-49606780 CAGGGCTCTGTGTTTCAAGTGGG - Intronic
949301523 3:2589723-2589745 TAGAGCACCCACTTTCAAGTTGG + Intronic
949463773 3:4322632-4322654 CAGGTCTCCCTCTTTCACCCAGG - Intronic
950116705 3:10455450-10455472 CTGGGCTTCCTCTGTAAAGTGGG + Intronic
952307778 3:32160739-32160761 CAGGGCTCACTCTCTCAATCAGG - Intronic
953354722 3:42245900-42245922 CAGGGCTTTCTCATTCTAGTGGG - Intergenic
954619479 3:51987323-51987345 CACGGACCCCTCTTTCAGGTGGG - Exonic
955794065 3:62617521-62617543 CATGGTTCCCACTTTCAAGGGGG + Intronic
957300199 3:78381842-78381864 CAGGTCTCCATCTTTCTAATGGG + Intergenic
962058941 3:131904722-131904744 CTTGGTTCCCTCTTTCAATTCGG + Intronic
962388082 3:134949091-134949113 CAGCGCTCCACCTTTCAAGTTGG - Intronic
962885027 3:139616588-139616610 CAGGACTCTCTCTTTCTAGTGGG + Intronic
964811164 3:160666205-160666227 CAATGCTCTCTCTTTCAACTAGG + Intergenic
966745912 3:183276915-183276937 CAGGGTTCCCCCTTTCATGATGG + Exonic
968447372 4:658500-658522 CACGGCTCCCTCTGTGCAGTGGG + Intronic
982604186 4:157492965-157492987 CAGGACTTCCACTTTCCAGTAGG + Intergenic
983054434 4:163085178-163085200 CATACCTCCCTCTTTCAAGATGG + Intergenic
984862238 4:184251661-184251683 CAGGGTTCCCTCTTTCGGCTTGG - Intergenic
986732440 5:10645260-10645282 CAGGTCTCCCTCTTGCCAGGGGG - Intronic
987118962 5:14748532-14748554 CATTTTTCCCTCTTTCAAGTTGG - Intronic
990987832 5:61657173-61657195 CAGGGCCCCGTGTTTGAAGTAGG - Intronic
992406115 5:76459366-76459388 CAGTGCCCACTCTTCCAAGTTGG + Intronic
995324205 5:110872759-110872781 CAGGGCTCCCTCCTCCCAGCAGG - Intergenic
997643022 5:135462164-135462186 CAGGGTTCCCTGTTTCCAGGAGG - Intergenic
999117056 5:149173497-149173519 CAGGGCTGCATCTGTCAAGATGG + Intronic
999881464 5:155869214-155869236 CAGGGCTCCTGCCTTCAAGTAGG - Intergenic
1001642536 5:173254842-173254864 CAGGGCTTCCTGTTTCTAGATGG + Intergenic
1004302128 6:14468157-14468179 CAGGGCTCCCTCTTCTCAGAAGG - Intergenic
1005633199 6:27728339-27728361 CGGGGCTCCCTCTTTAAATCTGG + Intergenic
1006520792 6:34569992-34570014 CTGGGACCCCTCATTCAAGTTGG - Intergenic
1006952097 6:37831239-37831261 CAGTGCTCCTTCTTTCAAGTTGG - Intronic
1007070317 6:39032393-39032415 CAGGTCTCCCTCACTCAAGTGGG - Intergenic
1007828976 6:44624003-44624025 CAGTTCTCCCTCTTTCTAGTTGG + Intergenic
1013328970 6:109079001-109079023 GATGGCTCCCTCTTTGAATTTGG - Intronic
1014197929 6:118580139-118580161 CAGGGTTCCCTCTCTCAGCTTGG + Intronic
1015737547 6:136416924-136416946 GAGGTCTCCCTTTTTCAAATAGG - Intronic
1024595332 7:50929019-50929041 CAGGGCTCCCTCTGTCTTGGAGG - Intergenic
1025012416 7:55407992-55408014 CAGGTCTCCATCTTTCAAGCTGG - Intronic
1026149255 7:67774128-67774150 CAGGGCTCCTTCTTTCTACATGG + Intergenic
1027174259 7:75893310-75893332 CTGGGCTCCCTCCTTTCAGTGGG - Intergenic
1028885311 7:95925970-95925992 CAGGGCTCCTTGTTTAAATTTGG - Intronic
1029515003 7:101018516-101018538 CAGGGCTCCCTCTTCCTCCTGGG + Intronic
1031875787 7:127139403-127139425 CATGGCTCCATTTTTCAAGATGG - Intronic
1033732691 7:144195207-144195229 CAGGGCTCTTTCTTCAAAGTAGG - Intronic
1033743542 7:144293787-144293809 CAGGGCTCTTTCTTCAAAGTAGG - Intergenic
1033750360 7:144355810-144355832 CAGGGCTCTTTCTTCAAAGTAGG + Intronic
1033910077 7:146252380-146252402 CAGGCCTCTCTCTGTCCAGTAGG - Intronic
1035887246 8:3305406-3305428 AAGGGCTCCCACTTTCAATATGG - Intronic
1036515194 8:9437402-9437424 CATGTCTCCCTCTTACAAGCTGG + Intergenic
1037368629 8:18149443-18149465 CATTTCTCCCTCCTTCAAGTTGG + Intergenic
1037745732 8:21642678-21642700 CATGGCTCTCTTTTTCAAGGAGG - Intergenic
1040023467 8:42761145-42761167 CTGGGCTTCCTCTTTCAAATGGG + Intronic
1042337174 8:67640698-67640720 AAGGGCCGCCTCTTTCAAGTTGG - Intronic
1052295757 9:26894728-26894750 CAAGGTTCCCTCTTTCATCTGGG + Intergenic
1056841298 9:89999834-89999856 CAGGGCTCCTTCCTGTAAGTCGG + Intergenic
1058592766 9:106583018-106583040 CTGGGCCCCCTCTCCCAAGTCGG - Intergenic
1062289323 9:135787468-135787490 CAGGGCTGCCTCTGTCCCGTCGG + Intronic
1189318727 X:40074385-40074407 CAGGGTTCCCTCTGCCAAGGCGG - Exonic
1190452848 X:50598189-50598211 CAGGGCTCCCTCTTTCAAGTTGG - Intronic
1195257800 X:103106022-103106044 TAGGGTTCCCACTTTCATGTTGG + Intergenic
1195796524 X:108654469-108654491 CAGGGCTCCCTCTGTCATCCAGG + Intronic
1197395859 X:125926243-125926265 CAAAGCTTCTTCTTTCAAGTTGG + Intergenic