ID: 1190456085

View in Genome Browser
Species Human (GRCh38)
Location X:50629010-50629032
Sequence GGAAATCCTGGCCCCCACTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190456085_1190456089 3 Left 1190456085 X:50629010-50629032 CCACAGTGGGGGCCAGGATTTCC No data
Right 1190456089 X:50629036-50629058 CCATGCCCTGTCTAGCCCTGTGG No data
1190456085_1190456094 26 Left 1190456085 X:50629010-50629032 CCACAGTGGGGGCCAGGATTTCC No data
Right 1190456094 X:50629059-50629081 ACGTGCTCAGTAAATAGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190456085 Original CRISPR GGAAATCCTGGCCCCCACTG TGG (reversed) Intronic