ID: 1190456781

View in Genome Browser
Species Human (GRCh38)
Location X:50634998-50635020
Sequence GTAGATGCTCAGAGCCCTGT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 148}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190456779_1190456781 5 Left 1190456779 X:50634970-50634992 CCAACAGCTTTGGTTGAGGCCTG 0: 1
1: 0
2: 1
3: 14
4: 144
Right 1190456781 X:50634998-50635020 GTAGATGCTCAGAGCCCTGTTGG 0: 1
1: 0
2: 0
3: 19
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190456781 Original CRISPR GTAGATGCTCAGAGCCCTGT TGG Exonic
902203045 1:14848153-14848175 GGAGAGGCTCAGAGACGTGTGGG - Intronic
902331715 1:15734166-15734188 GCAGAGGGTCCGAGCCCTGTGGG + Exonic
902504126 1:16928399-16928421 GCACATCCTCAGACCCCTGTGGG - Intronic
904682572 1:32239813-32239835 GTACATTCACAGAGCCCTGCAGG + Intergenic
904805831 1:33131384-33131406 TTAGACCCTCAGAGCCCTGCAGG - Intergenic
904827373 1:33282157-33282179 GGACATGCACAGAGCCCTGTGGG - Intronic
904992690 1:34606292-34606314 ATAGATGTTAAGAGCCCAGTTGG + Intergenic
907328773 1:53658002-53658024 GCTGGTGCTCAAAGCCCTGTGGG + Intronic
910951715 1:92655112-92655134 GAAGATGCTCAGAGAACTCTAGG + Intronic
912350130 1:109004683-109004705 GTTGATGCACAGAGGCCTATCGG - Exonic
913225131 1:116692395-116692417 GAAGAAGCTCAGAGTCCAGTGGG - Intergenic
915420012 1:155772913-155772935 ATAGATGAGCAGAGCCCTCTAGG - Intronic
916014472 1:160736860-160736882 ATGGAGCCTCAGAGCCCTGTGGG + Intergenic
916803593 1:168237301-168237323 GTATGTGCTCAGAGGCTTGTTGG + Intronic
918080977 1:181207431-181207453 CTACAACCTCAGAGCCCTGTAGG + Intergenic
918171837 1:182004739-182004761 GTACGAGCTCAGAGCCCAGTAGG + Intergenic
920376897 1:205513669-205513691 GAAGATTCTCAGAGCCTTGTAGG - Intronic
920802484 1:209202460-209202482 GTACATCTTGAGAGCCCTGTGGG - Intergenic
922491045 1:226017090-226017112 GAAAGGGCTCAGAGCCCTGTGGG + Intergenic
924868897 1:248018547-248018569 GTAGAGGCTCAGAAACTTGTAGG + Intronic
1062792039 10:313642-313664 GCAGATGCTCAGGTCCCTGCTGG - Intronic
1063070037 10:2652175-2652197 GTAAATGCTCAGGGGCCTGTTGG - Intergenic
1063570734 10:7212424-7212446 GGAGAGGAACAGAGCCCTGTGGG + Intronic
1065838565 10:29681039-29681061 GGAGAAGCTCAGAGCACTGCAGG + Intronic
1066237563 10:33501319-33501341 GGAGAGGATCAGAACCCTGTGGG + Intergenic
1069632488 10:69905458-69905480 GCAGAAGCTAAGAGCCCTGTGGG + Intronic
1070161073 10:73867111-73867133 GTACATGCACAGAGCCTTGGGGG - Intronic
1070313355 10:75289318-75289340 GGACATGCCCAGAGGCCTGTGGG - Intergenic
1070538559 10:77399090-77399112 GTGGCTGCTCAGAGCCAAGTCGG - Intronic
1070778408 10:79123654-79123676 GCTGTTGCTCAGAGCTCTGTGGG + Intronic
1070933452 10:80276474-80276496 GGAGATGCGCAGGGCCCTGAAGG - Exonic
1072573517 10:96678866-96678888 GTAGAGACACAGACCCCTGTAGG + Intronic
1075914965 10:126158835-126158857 GTAGATGCACAGAGCACGGTGGG + Intronic
1075993060 10:126854209-126854231 GTTGATCTTCAGAGCCCTCTTGG - Intergenic
1079135526 11:17774245-17774267 CTAGAGGCCCAGAGCCCTGTTGG - Intronic
1079456665 11:20642512-20642534 TCAGCTGCTCAGAGCCCTTTTGG + Intronic
1079518556 11:21297713-21297735 GTTGATTCTCTCAGCCCTGTGGG - Intronic
1080479265 11:32629153-32629175 GTAGATCCTCAGTAACCTGTGGG + Intronic
1082707423 11:56509603-56509625 GTAGATGCTGAAAAACCTGTTGG + Intergenic
1083979248 11:66152363-66152385 GTAGAGCCTCAGAGACTTGTAGG + Intronic
1087738898 11:101865522-101865544 ATAGAGCCTCAGAGTCCTGTGGG + Intronic
1088589440 11:111390722-111390744 CAAGATGCTCAGAGTCCTGTTGG - Intronic
1089237373 11:117042221-117042243 GTAGCTGTTGAGAGCACTGTGGG - Intronic
1092953584 12:13529677-13529699 GTAGATGCTCAGATACTTGTTGG + Intergenic
1094854268 12:34395966-34395988 GGAGATGCTCAGGGTCCTTTGGG - Intergenic
1097728743 12:63104278-63104300 GCAGATGCACAGAGCCATGTGGG - Intergenic
1104345590 12:127993803-127993825 GTAGAGGCAGGGAGCCCTGTGGG - Intergenic
1104814451 12:131637746-131637768 GTTCAGGCTCAGGGCCCTGTGGG + Intergenic
1106173774 13:27310722-27310744 CCAGAAGCTCAGAGGCCTGTCGG - Intergenic
1107081468 13:36379307-36379329 CTAGATGCAAAGAGCCTTGTAGG - Intergenic
1107792128 13:44013276-44013298 GACCAGGCTCAGAGCCCTGTGGG - Intergenic
1109375324 13:61485502-61485524 GCAGGTGCTCAGAGCAATGTAGG + Intergenic
1111081267 13:83310909-83310931 GTAGAAACTCAGTGCCTTGTGGG - Intergenic
1112307628 13:98289644-98289666 ACAGATGCTCAGAGCCCTGCAGG + Intronic
1112464745 13:99633872-99633894 ATAGAGCCTCAGAGACCTGTGGG + Intronic
1112813464 13:103246282-103246304 GTAGAGACTCACAGCTCTGTAGG - Intergenic
1112940416 13:104854809-104854831 GGTGAGGCTCAGAGCCCTGCTGG + Intergenic
1115083994 14:29491947-29491969 GTAGATGATTAGTGCCCCGTGGG + Intergenic
1116865978 14:50032009-50032031 CTAGCTGCCCAGAGCCCTTTAGG + Intergenic
1118742689 14:68751855-68751877 GAGGATGTTCAGAGCTCTGTCGG + Intergenic
1120147821 14:80998988-80999010 GTTGATGCTAAGACCCCAGTTGG - Intronic
1120399685 14:84014271-84014293 GTAGATGTTCAGGGAGCTGTTGG - Intergenic
1122588038 14:102824784-102824806 GTTAATGGTAAGAGCCCTGTAGG + Intronic
1122955442 14:105068184-105068206 GCAGATGCCCAGATCCCTGTCGG + Intergenic
1131873654 15:96783418-96783440 GCACATGCTCGGAACCCTGTGGG - Exonic
1134137852 16:11691441-11691463 GTAGATGTTGAGAGTCTTGTTGG + Exonic
1137908746 16:52354051-52354073 GTGTAAGCTCAGATCCCTGTTGG + Intergenic
1138039242 16:53644317-53644339 ATAGAGCCTCAGAGACCTGTGGG + Intronic
1139482793 16:67239962-67239984 GAGGAAGCTCACAGCCCTGTGGG + Intronic
1141623053 16:85247370-85247392 GGAGATCCTCAGAGCTCAGTGGG + Intergenic
1142788584 17:2245018-2245040 CTAGATCCTCAGAGAGCTGTGGG - Intronic
1144103609 17:11965943-11965965 GAAGAGTCTCAGAGACCTGTGGG + Intronic
1144739503 17:17573645-17573667 GCAGATGCTCAGGTCCCTGATGG - Intronic
1154393011 18:13958688-13958710 ATAGAGCCTCAGAGACCTGTGGG + Intergenic
1156480898 18:37435800-37435822 AGAGAGGGTCAGAGCCCTGTAGG + Intronic
1157257318 18:46150809-46150831 GTGCATTCTCACAGCCCTGTGGG - Intergenic
1160779686 19:872287-872309 GACGCTGCTCAGAGCCCTGCAGG + Intronic
1160796442 19:947870-947892 GCAGATGCTGAGAGCCCCGCCGG - Intronic
1161017616 19:1991072-1991094 AAAGATGCTCAGGTCCCTGTCGG + Intronic
1161209911 19:3061242-3061264 GTAGGTGCGAGGAGCCCTGTAGG + Exonic
1162740338 19:12770356-12770378 GCAGATGCTCAGACCTCTCTAGG - Intronic
1164833574 19:31341373-31341395 GTAGGTGCACAGAGGCCTGATGG + Intronic
1164940815 19:32251275-32251297 GTGGAGGCTCAGTGCCCTGGAGG + Intergenic
1165455757 19:35909591-35909613 GCAGATGCCCAGTGGCCTGTGGG + Intergenic
1166881571 19:45933597-45933619 CTAAATGCCCAGAGCCCTGGGGG + Intergenic
1167666046 19:50823313-50823335 GGGGATGATCAGAGTCCTGTGGG + Intronic
926787304 2:16530861-16530883 GTTGATAGTCAGTGCCCTGTCGG - Intergenic
931721079 2:65068235-65068257 GTTGATGCTGAGAGCCCTGGTGG - Intronic
933578770 2:84101185-84101207 GGACTTGCTCAGAGCCATGTCGG + Intergenic
935223783 2:101036381-101036403 GCAGGAGCTCAGAGCCCAGTGGG + Intronic
935377926 2:102419672-102419694 GTAGATTCTCCCAGCGCTGTTGG + Exonic
937153607 2:119702877-119702899 TTGGATGCTCAAAGCCCTGTGGG + Intergenic
937462148 2:122098817-122098839 GTAGATGCTCACACCCCCTTGGG + Intergenic
938089185 2:128419639-128419661 GTAGATCCTCAGAGCTTTGGTGG - Intergenic
938387690 2:130879024-130879046 GCAGAGGCTCAGAGGCATGTTGG + Intronic
939084340 2:137699688-137699710 ATTGGTGATCAGAGCCCTGTAGG - Intergenic
940491959 2:154373854-154373876 AAAGATACTCAGAGCTCTGTGGG + Intronic
941741230 2:169037581-169037603 GTATATGTTTGGAGCCCTGTGGG - Intergenic
943643908 2:190387639-190387661 GCCGATGCTCAAAGCCCTGCTGG - Intergenic
945288562 2:208106442-208106464 CTGCATGCTCAGACCCCTGTGGG + Intergenic
948656894 2:239481875-239481897 GCAGGAGCTCAGAGCCCTGCAGG - Intergenic
948759714 2:240183106-240183128 GTAGAAGCCCAGAGTCCTGCAGG - Intergenic
1172617728 20:36300240-36300262 GGACATGCTCAGAGACCTGGAGG - Intergenic
1172802472 20:37585972-37585994 CTAGAGCCTCAGAGACCTGTAGG + Intergenic
1176076388 20:63250247-63250269 GTAGATGCTCAGTGCCTGCTCGG - Intronic
1178702784 21:34847646-34847668 CTAGATGCTCAGAGCTTTGCAGG + Intronic
1180112403 21:45667332-45667354 GCTGAAACTCAGAGCCCTGTGGG - Intronic
1181439631 22:22929045-22929067 GTGGCTGCTCAGGGCCCTGCGGG + Intergenic
1181873575 22:25922503-25922525 GGGGAGGCTCAGAGCTCTGTTGG + Intronic
1183933511 22:41249167-41249189 GCAGATGCTGAGAGCCCAGGAGG + Intronic
1184488083 22:44793314-44793336 GTAGACGCTCAGAGACGTGGAGG + Intronic
1184662406 22:45971447-45971469 GGAGCTTCTCAGAGCCCCGTGGG + Intronic
949358524 3:3207128-3207150 TTAAATCCTCAGAGCCCTGTGGG + Intergenic
950547255 3:13645905-13645927 GGATTTGCTCAGAGCCCTGGTGG - Intergenic
950697327 3:14713313-14713335 GAAGATTCTCAGGGACCTGTGGG - Intronic
951605987 3:24435498-24435520 GGGGATGCTCAGGGCCCTGGGGG - Intronic
953551423 3:43906621-43906643 CTAGATTCTCAGAGCCCTTGTGG - Intergenic
953698862 3:45180740-45180762 AGAGATGCTCTGAGACCTGTGGG + Intergenic
958137422 3:89513823-89513845 ATAGAGGCTCAGACACCTGTGGG - Intergenic
959806592 3:110562030-110562052 GGAGATGCTAAGAGCCCAGTTGG + Intergenic
961569241 3:127786253-127786275 GCACCTGCTCAGGGCCCTGTCGG - Intronic
962405256 3:135094764-135094786 GTAGCTGCTGAGAGCCCCATGGG - Intronic
962752326 3:138442581-138442603 ACACATGCTCAGGGCCCTGTAGG - Intronic
963117623 3:141745301-141745323 GCAGTTGTTCAGAGCCCTGGTGG + Exonic
963988791 3:151629117-151629139 GAAGAGGCACAGAGCGCTGTTGG - Intergenic
965009936 3:163074256-163074278 GTAGATGAAAAGAGCCCAGTGGG + Intergenic
968791813 4:2670095-2670117 GCAGACGCTCAGAGGCCTGTGGG - Intronic
969708835 4:8831180-8831202 CTAGATGCACAGGGCCCTGGGGG - Intergenic
973537440 4:51897739-51897761 GGAAATGCTCAGAGACTTGTGGG + Intronic
980044406 4:127972009-127972031 GGAGCTCCTGAGAGCCCTGTGGG + Intronic
980955180 4:139420920-139420942 GTAGAATCTCAGAGACCTCTCGG + Intergenic
982122202 4:152154100-152154122 GTAGATGCTCACAGAACTGGAGG + Intergenic
984057139 4:174943554-174943576 GTGGATTCTCAGAGACCTGATGG - Intronic
984423223 4:179551290-179551312 GTATATGCTAAGAGCAGTGTTGG - Intergenic
984615306 4:181890126-181890148 GTATATGCTCTCAGCCATGTTGG - Intergenic
985507385 5:291323-291345 GCAGATGCTCAGAGCCATGCAGG - Intronic
985740587 5:1613812-1613834 GCAGATGCTCAGAGCCATGCAGG + Intergenic
988389417 5:30608105-30608127 GTATGTGCTCAGATGCCTGTAGG + Intergenic
994352232 5:98759378-98759400 GTGGAAGCTGAGAGGCCTGTGGG - Intergenic
995342903 5:111079931-111079953 AAAGAAGCTCAGAGACCTGTAGG + Intergenic
996304506 5:122031563-122031585 ACAGATTCTCAGAGACCTGTGGG + Intronic
997462088 5:134059589-134059611 GCTGATGCTCAGAGGCCTGTGGG - Intergenic
997462144 5:134059965-134059987 AGAGATGCTCAGAGTCCTGGGGG - Intergenic
998752568 5:145339520-145339542 GCAGCTGCTCAGATACCTGTGGG - Intergenic
999104945 5:149062895-149062917 GTAGAGGCTCAGGGACCTGCTGG - Intronic
1008689192 6:53958615-53958637 CTAGATGCTCATAGTTCTGTAGG + Intronic
1010560537 6:77343482-77343504 GCAGACGCCCTGAGCCCTGTGGG + Intergenic
1013967434 6:115971876-115971898 CTGGATGCTCAGAGCCCAGCTGG - Intronic
1016067692 6:139700778-139700800 GTAGCTGCCCAGAGCACTCTGGG - Intergenic
1020752354 7:12158197-12158219 GCAGATCCTAAGAGACCTGTGGG + Intergenic
1023510462 7:40947115-40947137 ATAGAGTCTCAGAGACCTGTGGG - Intergenic
1026639447 7:72111340-72111362 GGAGGGGCTCAGATCCCTGTGGG - Intronic
1027794699 7:82677755-82677777 GAAGCTGCTGAGAGCTCTGTTGG + Intergenic
1029926211 7:104321206-104321228 ATAGAGCCTCAGAGACCTGTGGG - Intergenic
1032026214 7:128444578-128444600 TTACATACTCAGAGCCCCGTGGG + Intergenic
1033841245 7:145376774-145376796 ATAGAATCTCAGAGACCTGTGGG - Intergenic
1038133387 8:24758989-24759011 GCAGAGGCTCAGAGCCCTTGGGG - Intergenic
1040534507 8:48296843-48296865 GCAGATTCTCAGAAACCTGTGGG - Intergenic
1048214839 8:132484668-132484690 GGAGATGCTCAGCCCCCAGTGGG + Intergenic
1049332185 8:142060466-142060488 GTGGCTTCTCAGAGCCCTCTCGG - Intergenic
1061625185 9:131837279-131837301 CTGGATGATCTGAGCCCTGTTGG + Intergenic
1188612512 X:32117732-32117754 TTAGATTCTAAGTGCCCTGTAGG - Intronic
1189733111 X:44042429-44042451 AGAGATACTCAGACCCCTGTGGG + Intergenic
1189754749 X:44259589-44259611 GAAAATGCGCAGAGCACTGTGGG - Intronic
1190456781 X:50634998-50635020 GTAGATGCTCAGAGCCCTGTTGG + Exonic
1199881815 X:151979530-151979552 GTGTATGGTCAGAGCCCAGTGGG + Intergenic
1200052836 X:153444006-153444028 GTACATGCTAAGGGCCCTGACGG - Intergenic
1200315612 X:155129652-155129674 ACAGATCCTCAGAGACCTGTGGG + Intronic