ID: 1190456809

View in Genome Browser
Species Human (GRCh38)
Location X:50635181-50635203
Sequence CCCTGCGCTGCTCTCCATTG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 139}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190456807_1190456809 -8 Left 1190456807 X:50635166-50635188 CCACAGGCTCAGATGCCCTGCGC 0: 1
1: 0
2: 0
3: 20
4: 198
Right 1190456809 X:50635181-50635203 CCCTGCGCTGCTCTCCATTGAGG 0: 1
1: 0
2: 1
3: 13
4: 139
1190456805_1190456809 10 Left 1190456805 X:50635148-50635170 CCTTCTGTGGCAAGGGGACCACA 0: 1
1: 0
2: 3
3: 25
4: 223
Right 1190456809 X:50635181-50635203 CCCTGCGCTGCTCTCCATTGAGG 0: 1
1: 0
2: 1
3: 13
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190456809 Original CRISPR CCCTGCGCTGCTCTCCATTG AGG Exonic
900859403 1:5217447-5217469 CCCTGCTCTGCTCTCCACAGAGG + Intergenic
901735700 1:11310786-11310808 CCCTCCTCAGCTATCCATTGAGG - Intergenic
901782064 1:11600769-11600791 TTCTGCGCTTCTCTCCATTGTGG - Intergenic
903570530 1:24301207-24301229 TCCTGTGCTCCTCTCCTTTGCGG + Intergenic
906344041 1:45004218-45004240 CCCTGCCCTGCCCTGCCTTGGGG + Intronic
907297403 1:53464168-53464190 TCCAGCGCTGCTCTGCACTGGGG - Intronic
907372901 1:54014467-54014489 CCCTGCTCTGCTCACCCTCGTGG - Intronic
908959959 1:69684905-69684927 CCCTGCTCTGCTCTCCCTGGTGG + Intronic
909589115 1:77325608-77325630 CCCTGTGCTGGTCTCCATTTTGG + Intronic
909606972 1:77517363-77517385 CCCTTCTCTCCTCCCCATTGTGG - Intronic
913194146 1:116441049-116441071 GCCTGTCCTGCTCCCCATTGGGG - Intergenic
913328864 1:117650929-117650951 CCTTGGTCTGCCCTCCATTGGGG + Intergenic
915146957 1:153801038-153801060 CCCTTCCCTGCTCTCCTTGGAGG + Intergenic
915216319 1:154343012-154343034 CTCTGCTCTGCTCTGCAATGCGG + Intronic
915536160 1:156537105-156537127 CCCTGCTCTGCTCCCCATGGTGG + Intronic
916845984 1:168650527-168650549 CCTTGCCCTACTCTCCTTTGTGG + Intergenic
920176905 1:204107711-204107733 CCCAGAGTTGCTCTCCATTGGGG + Intronic
1065507022 10:26439029-26439051 CCCTCCGCTGATCTCCACTCTGG + Intronic
1065645937 10:27834049-27834071 CCCTGCTCTGCTCTCCAGCTTGG + Intronic
1067684249 10:48457511-48457533 CCCTCAGCTGCTATCCTTTGAGG - Intronic
1069077013 10:64048722-64048744 CTCCGCGCTGTTCTCCATAGTGG - Intergenic
1069913138 10:71771946-71771968 CCCTGCACTGCCCTCCCTGGTGG - Intronic
1070732753 10:78842551-78842573 CCCTGCTCCACTCCCCATTGTGG - Intergenic
1071561598 10:86650177-86650199 CCCTGCTCTGCTCTCTGTTGCGG + Intergenic
1072915842 10:99536961-99536983 CGCTGCGCTGCGCCCCACTGCGG + Intergenic
1073546278 10:104352263-104352285 CCCTACGCTGCACTCCAGTGTGG - Intergenic
1076569078 10:131420486-131420508 CCCAGCGCTGCTCTCTCTGGGGG + Intergenic
1076703791 10:132290165-132290187 CCCAGCCCTGCTCTCCTTTCTGG - Intronic
1076746815 10:132518656-132518678 TCCTGCGCTGGCCTCCATAGCGG - Intergenic
1077148911 11:1059760-1059782 CCCTGGGCTGCTCTTCTCTGAGG + Intergenic
1077295560 11:1824872-1824894 CCCTGCTCTGAGCTCCTTTGGGG + Intergenic
1077325561 11:1962491-1962513 CCCTAGGATGCTCTCCATAGTGG + Intronic
1079026301 11:16950610-16950632 GCCTGATCTGCTCGCCATTGTGG + Intronic
1079182182 11:18203824-18203846 CCCTGAGCAGCTCCCCAGTGTGG + Intronic
1083753418 11:64776143-64776165 ACCTGCGGTGTTCTCCACTGGGG + Intronic
1085470322 11:76753486-76753508 CCCTGGGCTTCTCTGCATGGTGG - Intergenic
1085783442 11:79430292-79430314 CCCTGGGCTGCAGTTCATTGTGG - Intronic
1086912527 11:92489429-92489451 CCCTGCTCTTCACTCAATTGTGG + Intronic
1089634410 11:119803279-119803301 CCCTGGGCTGCTCTCTAGGGTGG - Intergenic
1089969133 11:122678353-122678375 CTCTGCCCTTCTTTCCATTGTGG + Intronic
1090958774 11:131537400-131537422 CCCTGCGCAGCTGTCTATTGTGG - Intronic
1091277984 11:134365122-134365144 CGCTGGGCTGCTTTCCATTCCGG + Intronic
1202808541 11_KI270721v1_random:17670-17692 CCCTAGGATGCTCTCCATAGTGG + Intergenic
1091523317 12:1270249-1270271 CCCACCGCTGCACTCCAGTGTGG - Intronic
1092254918 12:6921573-6921595 CTCTGCAGTGGTCTCCATTGAGG + Exonic
1092275899 12:7060781-7060803 CCCTGTGCTGCTGTCCCTGGGGG + Intronic
1096007531 12:48184609-48184631 CCCTGTGCTGGTCTCCTTGGGGG + Exonic
1102077686 12:110073162-110073184 CCCTGCCCTGCTCTCCCTGGCGG + Intronic
1102143104 12:110633134-110633156 CCCTATGCTCCTCTCCATTCAGG + Intronic
1105411329 13:20174123-20174145 CTCTGCCCTCCTCTCCAGTGTGG - Intergenic
1105627370 13:22125898-22125920 CCCTTTGCTGCTCTTCACTGTGG + Intergenic
1105673838 13:22648694-22648716 CCCTGCTCTGCTCTCTGTGGTGG + Intergenic
1106304117 13:28495122-28495144 CCCTCGGCTGCTCTTCATCGAGG - Intronic
1107447272 13:40480440-40480462 CCCTTGGCTGCTCTCCGGTGTGG - Intergenic
1109212174 13:59547540-59547562 CCCTGCAGTCCTCTCCACTGGGG + Intergenic
1113894601 13:113755543-113755565 CCCTGGGCTGCTCTCAGTGGTGG + Intergenic
1115447033 14:33502415-33502437 TCCTGTGCTGCTCTTCGTTGGGG + Intronic
1117444384 14:55789460-55789482 CCCTGGGCTCATGTCCATTGCGG - Intergenic
1119936114 14:78593876-78593898 GCCTGGGCCCCTCTCCATTGGGG - Intronic
1123063927 14:105606730-105606752 CCCTGCTCTGCTTTTCCTTGGGG + Intergenic
1123073241 14:105652373-105652395 CCCTGCTCTGCTTTTCCTTGGGG + Intergenic
1123093169 14:105751144-105751166 CCCTGCTCTGCTTTTCCTTGGGG + Intergenic
1125430556 15:39589231-39589253 CACACCGGTGCTCTCCATTGTGG - Exonic
1125489559 15:40136547-40136569 CCCTGCCCTGCTCTACCCTGTGG - Intergenic
1128591376 15:68900769-68900791 CCTTGCCCAGCTCTCCATTAAGG - Intronic
1132632589 16:927005-927027 CCCTCCAGTGCTCTCCACTGGGG - Intronic
1132893321 16:2215070-2215092 GCCTGCGCTGCTCTCCCCTCTGG - Intergenic
1132908309 16:2295631-2295653 CCCAGCGCTGCTCTCCAGCGTGG + Exonic
1132936442 16:2483665-2483687 CTCTGTGCTGCCCTCCCTTGAGG - Intronic
1137432815 16:48432351-48432373 CACTCCCCTGCACTCCATTGAGG - Intronic
1138757453 16:59505600-59505622 CCCTGCACTGTTTTCCATAGTGG - Intergenic
1140066761 16:71617813-71617835 CCCTGCCATGATCACCATTGAGG + Intergenic
1140067004 16:71620091-71620113 CCCTGCCATGATCACCATTGTGG - Intergenic
1141005078 16:80344460-80344482 CTCTGAGCTGCTCTCCAAAGTGG - Intergenic
1142245009 16:88966366-88966388 CCCCGCTCTGCTCTCCTCTGTGG - Intronic
1142296521 16:89226702-89226724 CACAGAGCTGCCCTCCATTGTGG - Exonic
1147307508 17:39573949-39573971 CACTGCTCCGCTCTCCCTTGGGG - Intergenic
1148646140 17:49220436-49220458 CCCTGTGCTGCGCTCCTTGGAGG - Intronic
1150133606 17:62682183-62682205 CCCTGCCCTGCTCTGCCCTGGGG + Intronic
1151890006 17:76946299-76946321 CCCTGCCATGCTCGGCATTGGGG - Intronic
1152237578 17:79146614-79146636 CCCTCAGCTGCTCCCCAGTGAGG - Intronic
1152685784 17:81693336-81693358 CCCTGCTCTGCTCTGGAGTGTGG + Intronic
1154162336 18:11989808-11989830 CCCTGGGCAGCGCTTCATTGGGG - Intronic
1160878610 19:1309474-1309496 ACCTGTGCTGCTCTCCCTGGAGG - Intergenic
1161783074 19:6306559-6306581 TCCTGCGCTGCCCTGCCTTGAGG - Exonic
932581636 2:72996026-72996048 CCCTGTGCTCCTCTCCATGGGGG + Intronic
935112494 2:100105402-100105424 CCCGGACCTGCTCTCCGTTGCGG + Intronic
937982989 2:127625778-127625800 CCCTGTGCTGGTCTGCACTGTGG + Intronic
945135084 2:206618284-206618306 CCCTGGCCTGGTCTCCAATGGGG - Exonic
945285158 2:208074820-208074842 CCCTGCCCTGTTCTGCACTGTGG + Intergenic
947118658 2:226796570-226796592 ACCACCGCTGCTCTCCACTGGGG + Exonic
947593788 2:231398853-231398875 CCCTGAGCTGCTCGCCATGTGGG + Exonic
948772142 2:240257100-240257122 CCATGAGCTGCTCCCCATCGGGG - Intergenic
1172019266 20:31901339-31901361 CCCTGCGATTTTCTCCAATGTGG + Intronic
1172840041 20:37897365-37897387 CCCTGTGCTGCCCTCCAGAGGGG + Intergenic
1174414658 20:50358824-50358846 CCCTGCTGTGCTCTCTTTTGGGG + Intergenic
1174845819 20:53942246-53942268 TCCTGAGCTGCAGTCCATTGAGG - Intronic
1175550446 20:59814022-59814044 CCCTGCTCTGCTCTTCTGTGAGG + Intronic
1176085274 20:63293002-63293024 CCCTGCCCTGCTGTGCAGTGGGG + Intergenic
1178410746 21:32361891-32361913 GCCTGCGATGCTCACCAGTGCGG - Exonic
1180911729 22:19455534-19455556 CCCTTAGCTGCTCTCCTTGGTGG - Intronic
1183226755 22:36555641-36555663 TCCTGCACAGCTCTCCATTAGGG + Intergenic
1183831422 22:40420277-40420299 CCCTGCTCTGCTTTCCATGACGG + Intronic
1185291909 22:50031499-50031521 GCCTGCCCTGCTCTCCCATGGGG - Intronic
954405139 3:50341283-50341305 GCCCGCTCTGCTCTCCACTGCGG + Exonic
959722329 3:109506238-109506260 CCCCACACTGCTCTCCATAGTGG - Intergenic
960862909 3:122169448-122169470 CCCTGTGTTGCTTTCCACTGTGG + Intergenic
961270432 3:125683738-125683760 CCCTGCACTGTCCTCCACTGTGG + Intergenic
961469363 3:127101608-127101630 TCCTGCCCGGCTCTCCAGTGCGG + Intergenic
963448379 3:145443639-145443661 CACTGCACTGCTCTCCAGTCTGG + Intergenic
968460066 4:720382-720404 CACTCTGCTGCTCTCCCTTGTGG - Intronic
968921149 4:3522803-3522825 CCCTGCCCTGCTCTGCTCTGGGG - Intronic
968985025 4:3870312-3870334 CCCTCCACTCCTCCCCATTGGGG + Intergenic
970117497 4:12713169-12713191 CCCTGAGATGCCCTCCAATGGGG + Intergenic
971265540 4:25093548-25093570 CCCTTCCCTGCTCTCCATTGAGG - Intergenic
971340802 4:25766902-25766924 CTCTACGCTGCTCTGCATGGTGG - Intronic
975528156 4:75373751-75373773 CCCTGCTCTGCTCTGTATTACGG - Intergenic
975763500 4:77641616-77641638 CCCTACTTTGCTATCCATTGTGG - Intergenic
976814962 4:89137835-89137857 CCGTGCTCCGCACTCCATTGCGG + Intergenic
978085060 4:104641605-104641627 CCCAGTGCAGCTGTCCATTGAGG - Intergenic
987117451 5:14736944-14736966 CCCTGCTCTGCTGTACTTTGGGG - Intronic
987708690 5:21484012-21484034 CCCTGCCCTGCTCTCCTTGAGGG + Intergenic
988750919 5:34190133-34190155 CCCTGCCCTGCTCTCCTTGAGGG - Intergenic
990026119 5:51191713-51191735 CCCTGCATTGCTCATCATTGAGG + Intergenic
991815515 5:70508173-70508195 CCCTGCCCTGCTCTCCTTGAGGG - Intergenic
997540859 5:134660843-134660865 CACTGCGCTGGCCTTCATTGTGG + Intronic
1001400507 5:171443761-171443783 CCCTTTGCTGCTCTCCTTTCTGG + Intronic
1002066414 5:176654271-176654293 CCCTGCGCTGCTGCTCAGTGAGG + Intronic
1002329652 5:178432799-178432821 CCCTCCCCTGCTCTTCCTTGAGG + Intronic
1004120444 6:12816512-12816534 CCCTGCATTGCACTGCATTGTGG + Intronic
1007119610 6:39369131-39369153 CTCTGAGCTGCTGACCATTGTGG - Intronic
1008958820 6:57245058-57245080 CCCAGCACTGCCCTACATTGAGG + Intergenic
1009324822 6:62337638-62337660 CCCTGAGCTGCTCTCCATGTTGG - Intergenic
1009806550 6:68607380-68607402 CCCTTCGCTGCTCTCCTTCAGGG - Intergenic
1015184592 6:130400319-130400341 CCCTACACTGCTTTCCATAGTGG + Intronic
1016892123 6:149016964-149016986 CCCTGCCCTGCTCACATTTGAGG - Intronic
1018703954 6:166449962-166449984 CCCTGTGGTGGTCTCCATGGTGG - Intronic
1022377277 7:29826269-29826291 CACTGAGCAGCTCTCCAATGTGG - Intronic
1025255822 7:57383383-57383405 CCCTGCTGTGCTCTCTTTTGGGG - Intergenic
1025731807 7:64114437-64114459 CCCTGAGCTGCCCTCAACTGTGG - Intronic
1026893970 7:73999620-73999642 CCCTGAGCTGCTCACCCTTCGGG + Intergenic
1031544916 7:123039455-123039477 CCCTCTTCTGCTCTCCAGTGGGG - Intergenic
1034161280 7:148995804-148995826 GCCTGTGCTGCTCTCCAGAGGGG - Intergenic
1037985463 8:23288254-23288276 CCCTGCGCTGCGCTCCTTCCCGG - Intronic
1040593996 8:48820239-48820261 CCCTGTGCTGCTCTCCACCTTGG - Intergenic
1040599752 8:48871538-48871560 CCCTTCTCTGGTCTCCAGTGTGG - Intergenic
1041314075 8:56543683-56543705 TCCTGTGCTCCCCTCCATTGGGG - Intergenic
1049185667 8:141251355-141251377 CCTTGCCCTGCTCTCCATGAAGG + Intronic
1049543054 8:143217248-143217270 CCCTGCACTGTGCTCCAGTGGGG - Intergenic
1049643611 8:143726517-143726539 CCATGCGCCGCTCGCCCTTGGGG + Exonic
1052771633 9:32695752-32695774 CCATGCGGTCCTCTCCATTTTGG - Intergenic
1190456809 X:50635181-50635203 CCCTGCGCTGCTCTCCATTGAGG + Exonic
1192363553 X:70453754-70453776 CCCTGCGCAGCTCCCCACTCAGG - Exonic
1202081279 Y:21086615-21086637 CCCAACGCTGCTCTCCAGTCTGG + Intergenic