ID: 1190457114

View in Genome Browser
Species Human (GRCh38)
Location X:50637250-50637272
Sequence CTGCTGCCACAGTTCAACTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 130}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190457114_1190457115 -6 Left 1190457114 X:50637250-50637272 CCAGAGTTGAACTGTGGCAGCAG 0: 1
1: 0
2: 1
3: 11
4: 130
Right 1190457115 X:50637267-50637289 CAGCAGCCCATGAGACCCTCAGG 0: 1
1: 0
2: 3
3: 26
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190457114 Original CRISPR CTGCTGCCACAGTTCAACTC TGG (reversed) Intronic
900780268 1:4613473-4613495 CTTCTGCCACAGTTCCACCCTGG + Intergenic
902703498 1:18189110-18189132 CTGCTGCCACTGCCCATCTCTGG - Intronic
903190406 1:21652768-21652790 CTGCTGACACAGCTCCACTTGGG - Intronic
908216356 1:61957717-61957739 CTGCTGCAATTATTCAACTCTGG - Intronic
910038150 1:82813636-82813658 CTGTTGCCACATTTAAACACTGG - Intergenic
911344816 1:96683426-96683448 CTACTGCCAGAGATAAACTCTGG + Intergenic
914193489 1:145431241-145431263 CGGCTGCCACGGTTCCACGCTGG + Intergenic
914474818 1:148014131-148014153 CGGCTGCCACGGTTCCACGCTGG + Intergenic
914830233 1:151165687-151165709 CTGCGGCGACAGTTCACCTGGGG - Exonic
915724970 1:158010990-158011012 CTGCCCCCACAGCTCAGCTCTGG - Intronic
916092057 1:161314968-161314990 CTGCTGCCCCAGAGCAACCCGGG + Intronic
920942534 1:210497596-210497618 CTGCAGCCACAGGTCTTCTCTGG + Intronic
922455893 1:225773340-225773362 CACCTTCCACAATTCAACTCTGG + Intergenic
922609876 1:226918569-226918591 CTGCTGCCTCAGAACAACTCAGG - Intronic
922800144 1:228361398-228361420 CAGCTGCCGCAGGTCCACTCAGG - Intronic
923833288 1:237581596-237581618 CTGCTGCAATATTTCAACTGAGG - Intronic
924110684 1:240696542-240696564 TTGCTGGCACTGTTCCACTCAGG - Intergenic
1063428064 10:5965100-5965122 CTCCTTCCCCAGTTCATCTCTGG - Intronic
1064437303 10:15322463-15322485 CTGCTGCTACAGTTCAGGTGAGG - Intronic
1064508972 10:16068117-16068139 CTTCAGACCCAGTTCAACTCTGG + Intergenic
1067746541 10:48940611-48940633 CCTCTGCCACAGTTCTATTCAGG - Intronic
1068263745 10:54620099-54620121 CTGCTGCAACGATTTAACTCTGG - Intronic
1068736406 10:60418109-60418131 CTGCTGCAATAGTCCATCTCAGG - Intronic
1072264120 10:93711206-93711228 CTGAAACCACAGTTTAACTCTGG + Intergenic
1073471938 10:103727868-103727890 CTGCTGCCAAAGCTCAGCTCTGG + Intronic
1074982605 10:118631853-118631875 CTCCTGCTACAGGTTAACTCGGG + Intergenic
1075840049 10:125493910-125493932 CTCCTGCAACAGTGCAACTTGGG - Intergenic
1076744929 10:132508098-132508120 CTGCGGCCACAGCAGAACTCCGG + Intergenic
1078143460 11:8707808-8707830 CTGATGACACAGTACACCTCTGG + Exonic
1080026564 11:27621357-27621379 CTGCTGCCGCTTTTCAAATCAGG + Intergenic
1080763673 11:35276483-35276505 CTGCTGACACACTTCAGCCCTGG + Intronic
1081383728 11:42446503-42446525 CTGCTGTCACTGTGCATCTCAGG - Intergenic
1081761460 11:45579262-45579284 CTGCTACCATAGTTCTAATCAGG + Intergenic
1084680126 11:70662143-70662165 CTGCTGCCTCATTTCTCCTCTGG - Intronic
1085310284 11:75512413-75512435 CTGCTGCATGTGTTCAACTCTGG - Intronic
1085356561 11:75843511-75843533 CTGCTGACACAGTCCAAGCCTGG - Intronic
1091413805 12:262799-262821 CTGCTGCCAGAGGTCCAGTCAGG + Exonic
1091662805 12:2397190-2397212 TTGCTTCCACACTTAAACTCTGG + Intronic
1096103684 12:48984340-48984362 CTGCTGCTTCATCTCAACTCTGG - Intergenic
1096530118 12:52237021-52237043 CAGCTGCCAAGGTTCAAGTCTGG + Intronic
1100476485 12:94940134-94940156 CTGGAGCCACAGTTACACTCAGG + Intronic
1104518354 12:129449170-129449192 CTGCTCTCACATTTGAACTCTGG - Intronic
1105291258 13:19055215-19055237 CTACTGCCACAGCTCAAACCAGG + Intergenic
1107409998 13:40149778-40149800 TTGCTAGCACAGTGCAACTCAGG + Intergenic
1110006020 13:70271040-70271062 CTGCTGCCAAAGATGAACACAGG + Intergenic
1112262697 13:97891840-97891862 CAGCTGCTACAGTTCCACACAGG + Intergenic
1112919635 13:104595762-104595784 CTGCTGCCACTTTGCAAATCAGG - Intergenic
1113596432 13:111537344-111537366 CTGCTGCCACAGGTCATGGCTGG - Intergenic
1117041314 14:51771958-51771980 GTGCTGCCACAGCTGAAGTCAGG + Intergenic
1118850075 14:69576338-69576360 CTCCTGCCACTGTTCCTCTCTGG - Intergenic
1119201657 14:72757200-72757222 GAACTGCCACAGTTCAGCTCTGG - Intronic
1121372598 14:93374162-93374184 CTGCTTCCACAGTTCCACTTAGG - Intronic
1121710879 14:96038647-96038669 CAGGTGCCACAGTTCAAGTAAGG - Intergenic
1123116389 14:105896059-105896081 CTGCAGCCTCAGTGCTACTCAGG + Intergenic
1127427443 15:58870028-58870050 CTGCTGCTTCAGTTGAACCCAGG - Intronic
1130899570 15:88196974-88196996 CTGCTGCCATGTTTCAAGTCAGG - Intronic
1131173126 15:90192271-90192293 GAGCTCCCACAGTTCTACTCTGG - Intronic
1133312352 16:4857474-4857496 GTGCTACCAAAGTTAAACTCAGG - Intronic
1135257862 16:20955623-20955645 CTGTTGCAACTATTCAACTCTGG - Intronic
1135941496 16:26826071-26826093 CTGCAGCCACAGGTAAACTGGGG - Intergenic
1140188930 16:72797848-72797870 CTACAGCCAGAGTTCCACTCTGG - Exonic
1140806577 16:78537695-78537717 CAGCTGCCACAGTTCATGTAGGG + Intronic
1141503580 16:84460875-84460897 CTCCTGCCACAGCTCACATCTGG + Intronic
1141574431 16:84954970-84954992 CTGCTGACACAGCTCCATTCTGG + Intergenic
1142111287 16:88332999-88333021 CTGGTGCCAGAGTGCACCTCTGG - Intergenic
1143252446 17:5533429-5533451 CTGCAGTCCCAGTTCTACTCAGG + Intronic
1145248249 17:21283857-21283879 CTGCTGCCCCTGTTCTACACAGG - Intergenic
1148463025 17:47848888-47848910 CAGCTTCCCCAGTTTAACTCAGG + Intronic
1150145771 17:62767889-62767911 CTACTGCCCCACTGCAACTCAGG + Intronic
1151969873 17:77452059-77452081 CTGCTGCTACAGCGCAGCTCTGG + Intronic
1152277977 17:79369210-79369232 CCGGTGCCACAGGTCAACCCCGG - Intronic
1152686399 17:81695780-81695802 CTGCAGCCACAGTTCCACAATGG + Exonic
1158433353 18:57413207-57413229 CTGCGGACACAATTCAACTGAGG + Intergenic
1158787578 18:60734095-60734117 CTGTTGCAACTGTTCAACTCTGG - Intergenic
1161676218 19:5651550-5651572 TTGCTGCCTCAGTTCACCACTGG + Intronic
1164859826 19:31554127-31554149 CTGCTGCCAAAGCCCATCTCTGG - Intergenic
1165675869 19:37722538-37722560 CTTCTGCCACCGTTCAATTTAGG - Intergenic
1166864768 19:45829159-45829181 CTGGTGACACAGTTCAACTCGGG - Exonic
1167851251 19:52204073-52204095 CTGGTGCCTCCGTTCCACTCAGG - Intronic
928396677 2:30947976-30947998 CAGCTGCCACAGTTCCTCTGGGG + Intronic
928618429 2:33063692-33063714 CTGCTGCCATAGCTCAATTTTGG + Intronic
929674027 2:43906569-43906591 ATGCTCCCAGAGTTCATCTCCGG + Intronic
935144394 2:100385139-100385161 CTGCTGCCAGGATTCAACTAGGG - Intergenic
936160056 2:110078069-110078091 CTGCTTCTCCAGTTCAGCTCTGG + Intergenic
936184608 2:110293284-110293306 CTGCTTCTCCAGTTCAGCTCTGG - Intergenic
936927074 2:117748191-117748213 GTGCTTCGACAGTTCAACTATGG - Intergenic
938367676 2:130747686-130747708 CTCCAGCCACTGTTCAACACAGG - Intergenic
941847395 2:170147164-170147186 GGGCTGCCACAATTCAACTCGGG - Intergenic
942387003 2:175453035-175453057 TTGCTGGGAGAGTTCAACTCAGG + Intergenic
945038827 2:205727555-205727577 CTGCTTCCACAGTCCAAGGCAGG + Intronic
1173346320 20:42203819-42203841 CTGCTGCCAGGGTTCAAACCAGG - Intronic
1175598688 20:60255571-60255593 CTGCTGCCACTGTGCACCACGGG - Intergenic
1176046580 20:63096099-63096121 CTGCTGCCCCAGCTTCACTCAGG - Intergenic
1181581897 22:23833221-23833243 CTGATGCCACAGTGCCAGTCAGG - Intronic
951092003 3:18585259-18585281 CTGCTGCTACTGCTAAACTCAGG + Intergenic
953364072 3:42326714-42326736 CTGCAGCAACAGTTCTACACAGG - Intergenic
954417799 3:50402531-50402553 CTGAAGCCACAGTTCAAATGTGG - Intronic
959825673 3:110793128-110793150 CTACTCCCAAAGTTCAATTCTGG + Intergenic
965929421 3:174024178-174024200 CTGCTGCAGCAGTTTAACTATGG - Intronic
969177512 4:5410103-5410125 TGGCTGCCACTGTTCAACACAGG - Intronic
972158880 4:36198600-36198622 CTGCTGCCTCAGCCCCACTCTGG - Intronic
974800147 4:66806817-66806839 CTGATGCAACAGTTCATCTGTGG - Intergenic
977118954 4:93072511-93072533 CTGCAGCCATAGTTCCACTCAGG - Intronic
977548108 4:98409652-98409674 CTGTTGCTTCAGTTGAACTCAGG - Intronic
977795176 4:101156228-101156250 GTGCTTCCACATCTCAACTCAGG + Intronic
981231961 4:142367095-142367117 CTCCTGCCACAGTTCCTGTCTGG - Intronic
987829245 5:23074672-23074694 CTACGGCTACAGTTGAACTCAGG + Intergenic
988869448 5:35372865-35372887 CTATTGCCACAGTTCAGCTTGGG - Intergenic
991017082 5:61943921-61943943 CAGCTGCCACAATTCTATTCAGG - Intergenic
992803548 5:80315079-80315101 CTGAGGCCACAGATCAACTGAGG - Intergenic
994383030 5:99094318-99094340 CTTCTGACACAGTTCTACTATGG - Intergenic
994740763 5:103615634-103615656 CTGCTGCAATAGTTCACCACAGG + Intergenic
996413646 5:123186144-123186166 CAGCTGCCACAGTTCATCTGTGG + Intronic
997621846 5:135304336-135304358 TTGCTGCCTCAGACCAACTCTGG - Intronic
998471585 5:142387921-142387943 CTCCTGCCTCAGTTGAACCCGGG - Intergenic
1000594879 5:163203276-163203298 CTGCTGCCACACTTCTTCTATGG - Intergenic
1002076828 5:176713251-176713273 CTGCTCTCAAATTTCAACTCTGG + Intergenic
1002694113 5:181072694-181072716 CGGCTGCCACAGTCCACATCAGG + Intergenic
1003859302 6:10307585-10307607 CTGCTCCCAGAGGTCAACCCAGG - Intergenic
1004083631 6:12421959-12421981 CTGGTCCCACAGATCAACTCTGG + Intergenic
1005733417 6:28721161-28721183 CTGCTTCCTCAGTTCAAAACTGG - Intergenic
1006559570 6:34898393-34898415 GTGCTGCCACAGTCCCACTAGGG - Intronic
1015617805 6:135096788-135096810 CTGCTGCCATAATTCTATTCAGG - Intronic
1016078243 6:139823822-139823844 TTGCTGCCACTGTTCAGCTTTGG + Intergenic
1017052919 6:150409968-150409990 CTGCTGCCCCAGCACAAATCAGG + Intergenic
1017243590 6:152197347-152197369 CTGCTTCCTCAGGTCAAATCGGG + Intronic
1029871296 7:103695746-103695768 CTGCTGTCATTGTTCAACACTGG - Intronic
1032775685 7:135110246-135110268 CTGCTGCCACAGCACATCTCAGG - Intronic
1035003108 7:155632170-155632192 CTGCTGCCACAGTACCACATAGG + Intronic
1036627592 8:10484332-10484354 TTACTGCTACTGTTCAACTCTGG - Intergenic
1043162543 8:76863646-76863668 CTGCTGCAACAGTGCACCTGGGG - Exonic
1043254366 8:78115238-78115260 ATGTTGCCAAAGTTCAACCCTGG + Intergenic
1044512678 8:93100899-93100921 CAGCAGCAACAGCTCAACTCTGG + Intergenic
1044839157 8:96323265-96323287 CTGCTGCCACTGCTCCTCTCTGG + Intronic
1045576944 8:103433074-103433096 CCGCTGCAACTATTCAACTCAGG - Intronic
1053330070 9:37197215-37197237 CAGCTGCTACAGATAAACTCTGG + Intronic
1055634380 9:78260873-78260895 CTGGTTCCACAGGTCAACTGTGG - Intronic
1057181308 9:93032213-93032235 ATGATGCCACAGTTCCACTCGGG - Intronic
1058862958 9:109135275-109135297 CTGCTGAGACATTTCCACTCTGG - Exonic
1059816312 9:117919689-117919711 CTCCTGCCACAGTCCCAATCAGG - Intergenic
1190457114 X:50637250-50637272 CTGCTGCCACAGTTCAACTCTGG - Intronic
1196302831 X:114066068-114066090 CTGTTGCCACAGATAAACACTGG + Intergenic
1199330326 X:146551144-146551166 CTGCTGCCACATGTAACCTCAGG - Intergenic