ID: 1190458272

View in Genome Browser
Species Human (GRCh38)
Location X:50645869-50645891
Sequence CTCTCCTGGGAGCCAGCTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 308
Summary {0: 1, 1: 1, 2: 3, 3: 17, 4: 286}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190458272_1190458279 7 Left 1190458272 X:50645869-50645891 CCAGAAGCTGGCTCCCAGGAGAG 0: 1
1: 1
2: 3
3: 17
4: 286
Right 1190458279 X:50645899-50645921 AAAGGCTCTTGTGAGAGGTGAGG 0: 1
1: 0
2: 0
3: 21
4: 202
1190458272_1190458281 9 Left 1190458272 X:50645869-50645891 CCAGAAGCTGGCTCCCAGGAGAG 0: 1
1: 1
2: 3
3: 17
4: 286
Right 1190458281 X:50645901-50645923 AGGCTCTTGTGAGAGGTGAGGGG 0: 1
1: 0
2: 2
3: 35
4: 401
1190458272_1190458284 18 Left 1190458272 X:50645869-50645891 CCAGAAGCTGGCTCCCAGGAGAG 0: 1
1: 1
2: 3
3: 17
4: 286
Right 1190458284 X:50645910-50645932 TGAGAGGTGAGGGGTGGAGGTGG 0: 1
1: 2
2: 11
3: 198
4: 1838
1190458272_1190458283 15 Left 1190458272 X:50645869-50645891 CCAGAAGCTGGCTCCCAGGAGAG 0: 1
1: 1
2: 3
3: 17
4: 286
Right 1190458283 X:50645907-50645929 TTGTGAGAGGTGAGGGGTGGAGG 0: 1
1: 0
2: 8
3: 110
4: 907
1190458272_1190458280 8 Left 1190458272 X:50645869-50645891 CCAGAAGCTGGCTCCCAGGAGAG 0: 1
1: 1
2: 3
3: 17
4: 286
Right 1190458280 X:50645900-50645922 AAGGCTCTTGTGAGAGGTGAGGG 0: 1
1: 0
2: 2
3: 23
4: 280
1190458272_1190458282 12 Left 1190458272 X:50645869-50645891 CCAGAAGCTGGCTCCCAGGAGAG 0: 1
1: 1
2: 3
3: 17
4: 286
Right 1190458282 X:50645904-50645926 CTCTTGTGAGAGGTGAGGGGTGG 0: 1
1: 0
2: 3
3: 40
4: 341
1190458272_1190458278 2 Left 1190458272 X:50645869-50645891 CCAGAAGCTGGCTCCCAGGAGAG 0: 1
1: 1
2: 3
3: 17
4: 286
Right 1190458278 X:50645894-50645916 CTTATAAAGGCTCTTGTGAGAGG 0: 1
1: 0
2: 2
3: 10
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190458272 Original CRISPR CTCTCCTGGGAGCCAGCTTC TGG (reversed) Intronic
900075769 1:816048-816070 TTCTCTTGAGAGCCAGCTTTTGG - Intergenic
900179826 1:1306193-1306215 CTCTCATGGGAGCCTGTTACAGG - Intronic
900198897 1:1393548-1393570 CACTCCTGGGATCTAGCTTGAGG - Intronic
901033173 1:6320280-6320302 CTATCCTGGGGGCCTGGTTCAGG + Intronic
902349936 1:15847266-15847288 CTCACCTGGCGGCCAGCTCCTGG - Intergenic
902503640 1:16926050-16926072 CTCTGCTGGGACACAGCTGCTGG + Intronic
904359431 1:29962441-29962463 CTCTCAGGGGAGCCAGCTCATGG + Intergenic
904479111 1:30783055-30783077 CTCTCCCTGGAGCCAGGTTTGGG + Intergenic
908267204 1:62391154-62391176 CTCTCCTGAGAGCCAAAGTCTGG + Intergenic
908587066 1:65581324-65581346 CCCTTCTGGGTGCCAGGTTCTGG + Intronic
908798670 1:67856353-67856375 CCCTCCCGGAAGCCAGCCTCTGG - Intergenic
909606521 1:77513817-77513839 CTCTCCTGTGAGATAGCTCCTGG - Intronic
909649230 1:77954830-77954852 CCCTCTTGGAAGCCAGATTCTGG + Intronic
910011972 1:82475513-82475535 CTCTCTTGTGATCTAGCTTCTGG - Intergenic
910132162 1:83920885-83920907 CGCTCCTGCTAGCCAGCCTCTGG - Intronic
912503290 1:110136855-110136877 CTCTCCTGACAGCCAGCCTGGGG + Intergenic
912637881 1:111315384-111315406 CTCTCGTGGGAGCCCTCCTCAGG + Exonic
912734604 1:112139245-112139267 ATCTCCTGGGAGTTAGCTACTGG - Intergenic
912758480 1:112345126-112345148 CTCTCCTAGCAGCCAGCTCCAGG + Intergenic
915119846 1:153622748-153622770 ATCTCCTGGAAGCCAGCTCTGGG + Intronic
915120200 1:153625685-153625707 ATCTCCTGGAAGCCAGCTCTGGG + Intronic
915305363 1:154974172-154974194 CTCTCCCGGGACCCCACTTCCGG - Intronic
915765199 1:158355401-158355423 ATTTCCTGGGAGCCATCTCCAGG + Exonic
915913671 1:159929063-159929085 CCCTCCCAGGAGCCAGCGTCAGG + Intronic
916211988 1:162367045-162367067 CTGTCCTGGGAGCCCACTGCAGG - Exonic
916575206 1:166060556-166060578 CTGTCCAGGGATTCAGCTTCTGG + Intronic
920177192 1:204109214-204109236 CTGTCTTGGGACCCAGCCTCTGG + Intronic
920335053 1:205239443-205239465 ATCCCCTGGGGGCCAGCTTGAGG - Intronic
922203203 1:223424297-223424319 CCTTCCTGGGACCCAGCCTCAGG - Intergenic
922271617 1:224040929-224040951 TTCTCTTGAGAGCCAGCTTTTGG - Intergenic
922581828 1:226703774-226703796 CGCTGCTGGCCGCCAGCTTCCGG + Intronic
923033409 1:230267526-230267548 CTCCCCAGGGAGCAGGCTTCAGG + Intronic
923053912 1:230410853-230410875 CTCTTCAGAGAGCCAGCTTTGGG - Intronic
923094457 1:230763612-230763634 AGCTCCTGGGAGCCACTTTCAGG + Intronic
1062950277 10:1494272-1494294 GTCTCCTGAGAGGCAGCTTTGGG + Intronic
1064845164 10:19643962-19643984 CTTTAATGAGAGCCAGCTTCTGG + Intronic
1065342579 10:24721991-24722013 CCCTCCTCGGAGCCTGCTTGTGG - Exonic
1066290858 10:34013216-34013238 CACTCTTGGGAGGCAGCTGCAGG - Intergenic
1066581952 10:36890799-36890821 CTGTCCTGAGTGACAGCTTCTGG + Intergenic
1067571260 10:47372849-47372871 CTCCCCTGGCAGCCACCATCTGG + Intronic
1067690939 10:48501884-48501906 CTCTTCTGGGAGCTAGCCTGGGG - Intronic
1071429534 10:85595879-85595901 CTTTCCTGGGTGCCAGGATCAGG + Intergenic
1072274122 10:93805772-93805794 CTGACCTGGGAGCCTGCATCTGG + Intergenic
1072608985 10:97004303-97004325 GTCTCCTGGGAAGCAGCTACTGG - Intronic
1075429337 10:122367216-122367238 CTCTCCCTGGAGCCAGCCTGAGG + Intergenic
1075546027 10:123355368-123355390 CTTACCTGGGAGTCAGATTCAGG - Intergenic
1075568437 10:123521156-123521178 CTATCCAGGGATCCAGCTTGAGG + Intergenic
1075910734 10:126123572-126123594 CTCTTCTAGGATCCAGGTTCTGG + Intronic
1076273983 10:129181214-129181236 CTCTGCATAGAGCCAGCTTCTGG + Intergenic
1076426932 10:130373624-130373646 CTCTCCTGGGAGTAATATTCAGG + Intergenic
1077108987 11:853865-853887 GTCTCCTGGGAGCCTCATTCCGG + Intronic
1077264809 11:1643229-1643251 CTCTCCTGGGTGCCAGGTCGGGG - Intergenic
1078104946 11:8352458-8352480 CTCTCCTAGGGGCCAGCATCTGG + Intergenic
1078526435 11:12104993-12105015 GTCTCCTAGGGGCCAGCATCTGG - Intronic
1079620243 11:22545145-22545167 ATCTCCTGGGTGCCAGGTACTGG - Intergenic
1081644320 11:44779092-44779114 CTGTCCTGGGAGCCTGCCCCAGG + Intronic
1083294953 11:61710258-61710280 CTCTCCTAGGAGCCACTTGCTGG - Intronic
1083366352 11:62143783-62143805 GTCTACTGGGAGCCAGGTTGGGG + Intronic
1083929728 11:65834041-65834063 CTCTCCTGGGCTTCAGCGTCCGG - Exonic
1084974541 11:72789640-72789662 CGGTCCTGGGAGCCAGCCCCTGG - Intronic
1088175124 11:107045009-107045031 CTCTCTGGGGAGAAAGCTTCAGG - Intergenic
1089398826 11:118152868-118152890 CGCTGCTGGGAGCCGGCTGCTGG + Intronic
1091491581 12:937169-937191 TCCTCCTGGGAGACAGCTTTAGG + Intronic
1091564835 12:1640655-1640677 CACACCTGGGCGGCAGCTTCTGG + Intronic
1097515031 12:60594286-60594308 CTGTCTTGGGCGCCAGCCTCTGG + Intergenic
1097791018 12:63815911-63815933 CTCTCATTGGGGCAAGCTTCAGG - Intergenic
1100656439 12:96650829-96650851 CTATCCTGGCCTCCAGCTTCAGG + Intronic
1101144939 12:101831705-101831727 ATATCTTGGGAACCAGCTTCAGG + Intergenic
1102183284 12:110928963-110928985 TTCTCTTGGGAGTCAGATTCAGG + Intergenic
1102909695 12:116703457-116703479 GTCTCCAAGTAGCCAGCTTCAGG - Intergenic
1103331257 12:120155587-120155609 CTCACCTCTCAGCCAGCTTCCGG + Exonic
1104606419 12:130192888-130192910 CTCTCCTGGGAGTGAGCAGCGGG + Intergenic
1105332559 13:19431823-19431845 CTCTTCTAGCAGCCAGCTTGTGG - Intronic
1105879126 13:24587954-24587976 CTCTTCTAGCAGCCAGCTTGTGG + Intergenic
1105920711 13:24961098-24961120 CTCTTCTAGCAGCCAGCTTGTGG - Intergenic
1113566630 13:111323239-111323261 GTGCCCTGGGAGCCAGCCTCAGG - Intronic
1117338609 14:54775436-54775458 CTCTCCTGGAACCCAGATTTGGG - Intronic
1117342479 14:54804224-54804246 CTCTGCTGGGAGGCAGCATGCGG - Intergenic
1119263217 14:73250434-73250456 CTCTCCTTGGGTCCAGCATCAGG + Intronic
1121006387 14:90493248-90493270 CTCTGCTGGAAGCAAACTTCAGG - Intergenic
1121049033 14:90808133-90808155 CTCTCTTGTGTGCCAGATTCTGG - Intronic
1122576564 14:102746724-102746746 CGGTCCAGGGAGCCTGCTTCTGG + Intergenic
1122913038 14:104843147-104843169 CTCTGCTGGGAGCGAGCACCTGG - Intergenic
1123797970 15:23793143-23793165 CTCTCCTGAGAGGCAGAATCAGG + Intergenic
1124416294 15:29475502-29475524 CCCTGGTGGGAGTCAGCTTCGGG - Intronic
1129244664 15:74272026-74272048 CTCTCCTGAGAGCAAGCTGGAGG + Intronic
1129267739 15:74403086-74403108 CTCTCCTGGGGGCCGGCTTTCGG - Intergenic
1129665553 15:77577609-77577631 CTCTCCTGGGGGCCAGCTTCCGG + Intergenic
1129874001 15:78960417-78960439 CGCTCTTGGAACCCAGCTTCCGG + Exonic
1131052769 15:89359344-89359366 CTCTCCTGGAATTAAGCTTCCGG + Intergenic
1131958670 15:97765303-97765325 CTTTCCTCAGTGCCAGCTTCAGG + Intergenic
1135485807 16:22863635-22863657 ATGTCCTGGGACCCATCTTCTGG + Intronic
1136364889 16:29805465-29805487 CTCCACTGGGCGCCATCTTCGGG + Intergenic
1140260027 16:73370250-73370272 TTCACCTGGGTGTCAGCTTCGGG + Intergenic
1141167046 16:81668015-81668037 CTCTCCTGGGAGCCTGCGGGAGG + Intronic
1141408796 16:83817956-83817978 CTCTCCTGCAAGCCAGGCTCAGG + Exonic
1141946704 16:87315671-87315693 CTCTCATGGGATGCAGCTTCTGG + Intronic
1142774723 17:2128039-2128061 CTCTCCTGTGCTCCAGCTGCAGG + Intronic
1144722921 17:17484770-17484792 CTCTGCTGGGGCCCACCTTCTGG - Intronic
1144730532 17:17523418-17523440 CTCACTAGGGAGCCACCTTCTGG - Intronic
1144872214 17:18378302-18378324 CTCTCCTGTGTCCCAGCCTCTGG - Intronic
1145263495 17:21368294-21368316 CCCTCCTGGTGGCCAGTTTCTGG + Intergenic
1145388983 17:22440530-22440552 CTGTCCTGGGAGCAGGATTCTGG + Intergenic
1145889511 17:28405130-28405152 CCCTGCTGGAAGCCAGCATCGGG - Exonic
1146275861 17:31515201-31515223 TTCTACTGGGATGCAGCTTCAGG + Intronic
1147918199 17:43900921-43900943 CTCCCCTCACAGCCAGCTTCAGG + Intronic
1148326281 17:46785220-46785242 TTGTCCTGGGATCCAGGTTCTGG + Intronic
1148461324 17:47840669-47840691 CACTCCTGGGAGCCGGCTCCAGG - Exonic
1150417304 17:64997870-64997892 CTCCCGGGCGAGCCAGCTTCAGG + Intergenic
1150794357 17:68226051-68226073 CTCCCGGGCGAGCCAGCTTCAGG - Intergenic
1151247008 17:72802890-72802912 CACGACTGGGAGCCACCTTCAGG + Intronic
1151424073 17:74018467-74018489 CTCTCCTGGAAGCCAATTTGTGG - Intergenic
1151489835 17:74426439-74426461 CTCTCCTGGGATCCCACCTCTGG - Intronic
1151906750 17:77053969-77053991 CACTCCAGGCAGCCAGCTGCTGG - Intergenic
1152069477 17:78127841-78127863 GTGTCCTGGGTGCCATCTTCGGG + Intronic
1152513408 17:80805533-80805555 CTTTCCTGAGAGGCAGCTGCAGG - Intronic
1152586152 17:81190358-81190380 TTCTCCAGGGAGTCAGCTCCCGG - Intronic
1152852899 17:82648180-82648202 CTCTCCTGGGCGCCCCTTTCCGG - Intronic
1154306238 18:13232863-13232885 CTCTCCCTGCTGCCAGCTTCGGG - Intronic
1158523282 18:58189532-58189554 ATCTGCTGGCAGCCAGCTTAAGG + Intronic
1160023878 18:75203851-75203873 CTTCCCTGGGAGCTTGCTTCTGG + Intronic
1160739114 19:677736-677758 CACTCCTGACACCCAGCTTCTGG - Intronic
1160831433 19:1106467-1106489 CTCTCTAGGGAGCCCGCTTGAGG + Intronic
1161297273 19:3526409-3526431 CTGCACTGGGAGCCAGCTCCCGG - Intronic
1163820941 19:19496273-19496295 CTCCCCTTGGACCCAGGTTCTGG + Intronic
1164648167 19:29873842-29873864 GTCTCCTGGGAGCCAGCGCGCGG + Intergenic
1167618125 19:50547347-50547369 CCATCCTGAGAGCCAGATTCAGG - Intronic
1168702931 19:58452172-58452194 CTCCCCTCGGAGCCTCCTTCGGG - Intronic
1168705422 19:58467694-58467716 CTCCCCTCGGAGCCTCCTTCGGG - Exonic
927552301 2:24010619-24010641 CTCCCCTTGGAGGCAGCCTCAGG + Intronic
927838870 2:26424211-26424233 CTCTACTGGAAGGCAGCATCTGG + Intronic
928167688 2:28982530-28982552 CAGTCCTGGGAGCCAGCCTGTGG - Intronic
928479418 2:31667039-31667061 CAGTCCTGGGAGCCAGCATCTGG + Intergenic
934112627 2:88757083-88757105 TTCTCCAGGGAGACAGCTCCTGG + Intergenic
937516508 2:122661471-122661493 CTCTCCTGGAGGCCGGCTGCAGG + Intergenic
938322630 2:130375123-130375145 CACTCCTGTGAGCCTGCTGCTGG + Exonic
939118413 2:138088111-138088133 GTAGCCTGGGTGCCAGCTTCTGG - Intergenic
939226488 2:139371188-139371210 CTCTACTGAGAGCCAGATTGGGG + Intergenic
940885808 2:158988424-158988446 CTCTCCCGGGAGCAAGATTTGGG + Intronic
946242873 2:218367641-218367663 CTCTCCTTGGAGCGAGCGGCTGG + Intronic
946466052 2:219913211-219913233 CAACCCTGGGAGCCAGCCTCAGG - Intergenic
946819207 2:223613131-223613153 TTCTTCTGGGAGTCTGCTTCTGG + Intergenic
947665802 2:231904647-231904669 CAGCCCTGGGAGCCAGGTTCTGG + Intergenic
948206026 2:236163387-236163409 CGCTCCTGGGACCGAGCTCCGGG - Intergenic
948447854 2:238046901-238046923 CTCTCCCAGGAGTCAGCATCTGG + Intronic
948451820 2:238080466-238080488 CTTTCCTGGGAGACACCTCCTGG - Intronic
948688916 2:239689973-239689995 CACTCCTGCCAGCCTGCTTCAGG - Intergenic
948696644 2:239736271-239736293 TCCTCCTTGGAGCCAGCTCCGGG - Intergenic
949081947 2:242108658-242108680 TTCTCTTGAGAGCCAGCTTTTGG + Intergenic
1169208528 20:3753325-3753347 TTGTCTTGGCAGCCAGCTTCTGG + Intergenic
1172099236 20:32475489-32475511 CTCTCCTCGCTGCCGGCTTCGGG + Intronic
1173170414 20:40718881-40718903 CTCTCCTGGGTGCCAGGTCAAGG + Intergenic
1173530794 20:43767861-43767883 CTCTGCTGCGAGAGAGCTTCTGG + Intergenic
1173919246 20:46731524-46731546 CGCTGGTGGGAGCCAGCTTTGGG + Intronic
1174070442 20:47895691-47895713 CTCCCCAGGGTGCCAGCTACCGG - Intergenic
1174149056 20:48473304-48473326 CTCTCCTGGTCTCCAGCTCCAGG + Intergenic
1174154026 20:48505236-48505258 CTCCCTGGGTAGCCAGCTTCCGG + Intergenic
1174156164 20:48516726-48516748 CTCCCCTGGGCTCCAGCTCCAGG + Intergenic
1174558474 20:51413044-51413066 CTCTCCAGGCAGCCAGCTCCCGG + Intronic
1175178414 20:57127869-57127891 CTCTCCTGGGAGCAGCCCTCAGG + Intergenic
1175470459 20:59223478-59223500 CTCTGCTGGGAGGCTGCTGCCGG - Intronic
1175829492 20:61954349-61954371 CCCTCCTGGGCTCCAGCTCCAGG - Intronic
1175871500 20:62211500-62211522 CTCTCCTGGGTGCCAGGTCCAGG - Intergenic
1175952084 20:62588913-62588935 CTCTCCTGGGAGGCAGCTCCAGG - Intergenic
1176740462 21:10596714-10596736 CTCTTCTAGCAGCCAGCTTGTGG + Intronic
1176970181 21:15255962-15255984 ATCTCCAGGGAGACAGATTCTGG + Intergenic
1179593923 21:42429745-42429767 ATCTCCTGGGGAACAGCTTCAGG - Intronic
1180149007 21:45938175-45938197 CTCTCCTCGGAGCCTGCTGGAGG - Intronic
1182287174 22:29255335-29255357 CCCTCCTGGAAGCCATCATCTGG + Intronic
1182446767 22:30394180-30394202 CTCTCTTGTTAGCCAGCTCCAGG + Intronic
1182681410 22:32082790-32082812 ATCTCCTTTGAGCCATCTTCTGG + Intronic
1182774802 22:32823202-32823224 CTTTCCTAGGCGCCACCTTCTGG + Intronic
1182813810 22:33140143-33140165 CTCTCCTGGAATTCAGCCTCTGG + Intergenic
1183104787 22:35608054-35608076 CCATCCTGGGAGCCAGCCGCGGG - Intronic
1183364471 22:37399742-37399764 ATCTCATGGGAGCCAGCAGCCGG - Intronic
1184433466 22:44455345-44455367 CTCTAAAGGGAGCCAGCTTTAGG + Intergenic
1184471655 22:44699372-44699394 CTCTCCTGAGAGCCAGCCTCCGG + Intronic
1184644864 22:45890165-45890187 CTCCCCTGGGAACCAGCGCCAGG + Intergenic
1184650492 22:45917382-45917404 CTCTCCCGGGAGCAAGCTGGCGG + Intergenic
1184671057 22:46012540-46012562 CTTGCCTCGGAGGCAGCTTCCGG - Intergenic
1185403299 22:50629781-50629803 CTCTCCTGGGAGCCTCCGTCAGG + Intergenic
949159193 3:859902-859924 CTCTCCTGGTCTCCAGCTGCAGG + Intergenic
950529550 3:13545357-13545379 CACTCCTGGGAGCCGAGTTCAGG - Intergenic
950898771 3:16477631-16477653 TTTTCCTGGGTGCCAGCATCTGG - Intronic
951261226 3:20512050-20512072 CTCTGTTGAGAGCCAGCCTCAGG + Intergenic
952982302 3:38746826-38746848 CACTGCTGTGACCCAGCTTCTGG + Intronic
953686132 3:45079712-45079734 TTCTCCTGGGAGCCACAGTCGGG - Intergenic
953740826 3:45537749-45537771 CTCTCCTGGTGGCCATCTTCAGG - Intronic
956689462 3:71862360-71862382 CTCTCCTTGGGGTCTGCTTCTGG + Intergenic
956897072 3:73673206-73673228 CTCCTCTGGCAACCAGCTTCTGG + Intergenic
957367280 3:79242697-79242719 CTCCCCTGCTAACCAGCTTCAGG - Intronic
962281179 3:134053162-134053184 GTCCCCTGGCAGCCAGCTGCAGG - Intergenic
963127592 3:141829561-141829583 CTGTCCTCGGATACAGCTTCTGG + Intergenic
966378891 3:179323556-179323578 GTCTCCTTGGCGCCGGCTTCTGG + Intronic
966433106 3:179853482-179853504 CACTCCTGGGAGGCAGCTTTGGG + Intronic
966893031 3:184421381-184421403 CTTATGTGGGAGCCAGCTTCTGG + Intronic
966971421 3:185048838-185048860 CCCTCCTGGGATCAACCTTCTGG - Intronic
967640913 3:191861985-191862007 CTCTCCAGGGGAACAGCTTCTGG - Intergenic
967989823 3:195122556-195122578 CTCTCCTAGGACCCAGCTCTGGG - Intronic
968734478 4:2288285-2288307 TTTTCCTGGGAGCCAGCTCTGGG - Intronic
968850231 4:3073825-3073847 CCCTGCGGGGAGCCAGCTGCGGG - Intergenic
968870452 4:3239400-3239422 AACTCCTGGCAGCCAGCATCTGG - Intronic
968910097 4:3473144-3473166 CAGTCATGGGAGCCAGCGTCGGG + Intronic
969505987 4:7588061-7588083 CTCTCCAGGGACCCAGCGACTGG - Intronic
970497592 4:16642597-16642619 CTTTCCATGGACCCAGCTTCAGG + Intronic
971013587 4:22464942-22464964 CTCACCTGGGGACCTGCTTCTGG + Intronic
973567454 4:52202520-52202542 CTCTCCTTTATGCCAGCTTCAGG + Intergenic
978230020 4:106386394-106386416 CTCTCCAAGGAGATAGCTTCTGG - Intergenic
978238419 4:106487848-106487870 CTGTGCTGGGAGTCCGCTTCAGG + Intergenic
979863821 4:125727964-125727986 TTCTCCTGGGAGCCCACTTAGGG + Intergenic
983456251 4:167968585-167968607 GTCTTCTGGGAGCCAGGTCCTGG - Intergenic
984442258 4:179787182-179787204 ATCTCCTGGGAACCAGGGTCAGG - Intergenic
985715777 5:1460231-1460253 CTCTCCTCCCAGCCAGCTTCTGG + Intronic
985796222 5:1964079-1964101 GTGTCCTGGGAGGCTGCTTCTGG + Intergenic
988664914 5:33315909-33315931 CTCTACTCAGGGCCAGCTTCAGG + Intergenic
992194831 5:74328731-74328753 CTCTCCTTGGAGGCATCTTGTGG - Intergenic
992852732 5:80827315-80827337 CTCTTCTGACACCCAGCTTCAGG + Intronic
993502821 5:88681093-88681115 CCCTCCTGCTAGCCAGCTTCGGG + Intergenic
995869944 5:116734209-116734231 CACTCCTAGGAGCCGGCTCCAGG - Intergenic
997582612 5:135027263-135027285 CTCTCCTCGGAGCCAGGGCCAGG - Intergenic
997594934 5:135100824-135100846 CTCTCATGGGAACCAGCCTGTGG - Intronic
998525939 5:142843291-142843313 CACTCCTGGGAGCCAAATTGAGG + Intronic
999259734 5:150230599-150230621 CTCTCCCGGGGGCCAGCTGAGGG + Intronic
999340038 5:150762418-150762440 CTCTCCTAGAAGCAAGCCTCGGG - Intergenic
1001413653 5:171528236-171528258 GTCTCCTGGGAGGGAGCTCCTGG + Intergenic
1001753173 5:174146862-174146884 CTCTCCTGTGTGCCAGATCCTGG - Intronic
1002087164 5:176783291-176783313 CTTTCTTGGGAGCCAGTGTCTGG + Intergenic
1003171440 6:3724634-3724656 CCCTCCTGGGAGCCACCTCGGGG + Intronic
1006029673 6:31170111-31170133 CTCTCCTGGGTGCCAGGTCTGGG + Intronic
1006154337 6:32006199-32006221 CTCAAGTGGGAGCCACCTTCGGG + Intergenic
1006418705 6:33920312-33920334 CTCTCCTTTGAGACACCTTCCGG + Intergenic
1008413651 6:51214027-51214049 CCTTCCTGGGAGCCAGCTGTCGG - Intergenic
1008535430 6:52503433-52503455 CCCTCCTGGGAGCCGTCTGCTGG - Intronic
1008663961 6:53697553-53697575 CAGTGCTGGGACCCAGCTTCAGG + Intergenic
1010791507 6:80070294-80070316 CCCTCCTCGGAGCCTGCTTGTGG - Intergenic
1011437826 6:87357694-87357716 CTCTCCTGCCAGCCATCTGCAGG + Intronic
1011488156 6:87864552-87864574 CTCCCCTGGGAGGAAGCCTCTGG + Intergenic
1012247136 6:96938420-96938442 CTCTTCTGGGCTCCACCTTCCGG + Intronic
1012953952 6:105548481-105548503 CTCTCCTGCAAGCCGACTTCTGG + Intergenic
1012976585 6:105786720-105786742 GTCTCCAGGGAGCCAGCTCTGGG - Intergenic
1012981534 6:105835550-105835572 CCCTCCTGGTGGGCAGCTTCAGG + Intergenic
1013102398 6:106998032-106998054 CTCTCCTGGGAGCCCACGTCTGG - Intergenic
1015570252 6:134613577-134613599 CTCTCCTGACAGACACCTTCTGG + Intergenic
1015822864 6:137281887-137281909 CTCTCCAGGGACCCATCTTGAGG - Intergenic
1020248335 7:6447852-6447874 CTCTCCTGAGTGCGAGCTACGGG - Exonic
1023173114 7:37409099-37409121 CTCTGCTGTGTGTCAGCTTCCGG - Intronic
1024235552 7:47394888-47394910 CTTAGCTGGGAGCCAGCTTGGGG + Intronic
1025233126 7:57216245-57216267 CTCCCCTGGGCTCCAGCTCCAGG - Intergenic
1026688625 7:72533667-72533689 GACTCCTGGGGGCCAGCCTCGGG + Intergenic
1032344423 7:131106126-131106148 CTCTCCCGGGAGACCGTTTCCGG - Intergenic
1032582286 7:133114686-133114708 CTCTCCAGGGAGCAAGCTGATGG - Intergenic
1032649031 7:133857722-133857744 CTCTTGTGGGTGCCAGCATCTGG + Intronic
1033335884 7:140451990-140452012 CTCCCCTGGGAGTTAGCTGCTGG + Intergenic
1034558590 7:151865308-151865330 CTGTCCTGGGGCCCAGCTGCTGG + Intronic
1034998536 7:155593650-155593672 TTCTCCTGGGGGCAAGCTCCCGG - Intergenic
1035045769 7:155964343-155964365 CTCTCCAGGCAGCCACCTCCTGG + Intronic
1035324217 7:158054603-158054625 CTCTCCTGGTTGCCAGATTCTGG - Intronic
1035608151 8:942886-942908 CTCTCCTGGGAGGGAGTTTTGGG - Intergenic
1038668417 8:29561832-29561854 CTCTTCTGGGAACCAACTCCAGG + Intergenic
1039240653 8:35552736-35552758 CTCTCCTGGGTCCCAGCCTTGGG - Intronic
1039892466 8:41694665-41694687 CTCTTCAGGGAGCCCCCTTCGGG + Exonic
1040410151 8:47145693-47145715 CTCTCCTAGGAGAAAGCGTCTGG + Intergenic
1040575916 8:48651430-48651452 CTCCCCCGGCTGCCAGCTTCCGG + Intergenic
1042337151 8:67640609-67640631 CGCTCCTGGGAGCCAGGAACAGG - Intronic
1045368092 8:101494121-101494143 CTCTCCGGCGAGACACCTTCAGG - Intronic
1045641347 8:104255024-104255046 TTCTCATGGGAGTCTGCTTCAGG + Intronic
1046602792 8:116337280-116337302 CTCTCCTTGAGGCCAGCTACTGG + Intergenic
1047343948 8:124009422-124009444 CTCCCCTGGGCTCCAGCTCCAGG - Intronic
1047896488 8:129372066-129372088 CAATCCTGGTAGCCAGATTCTGG - Intergenic
1048923974 8:139254287-139254309 CTTCCCTGGGAGGCAGCTTTAGG - Intergenic
1049305230 8:141899315-141899337 CTCTCCAGGGATCAAGCTTGGGG + Intergenic
1049628264 8:143636358-143636380 CTCTCCAGCGAGCCCGCCTCGGG + Intronic
1049729943 8:144171408-144171430 CCCTCCTGGGAACCACCTCCAGG + Intronic
1049746033 8:144263698-144263720 CTCTCCTGGGGGCCAGTGGCTGG - Exonic
1051873990 9:21771271-21771293 TTCTACTGACAGCCAGCTTCTGG + Intergenic
1055636244 9:78282055-78282077 CTCACCTGGAAGCCTGCTCCGGG - Intergenic
1056061665 9:82889596-82889618 CTCTCCTAGGGGCCATCCTCTGG + Intergenic
1057252023 9:93511273-93511295 CTCTTCTGGGCGCCGGCCTCTGG + Intronic
1057276642 9:93679714-93679736 CACTCCTGCCAGCCAGCTTGGGG - Intergenic
1057601126 9:96458380-96458402 CTCTTCTAGGAGTCCGCTTCTGG - Exonic
1057890166 9:98863952-98863974 CTCTCTTGGGAGCCAGATCTGGG + Intergenic
1058495534 9:105554870-105554892 ATATCCTGGAAGCAAGCTTCAGG - Intergenic
1059308051 9:113370029-113370051 CTCTTCTATGAGCCAGCCTCCGG + Exonic
1061780310 9:132992074-132992096 CTCTCCTGGGAGCCTGCTGCAGG - Intergenic
1062220053 9:135410179-135410201 CTCTCCTGGGACCACACTTCTGG + Intergenic
1062604739 9:137341640-137341662 CTCCCCTGGGAGACGGCTCCTGG - Intronic
1062604774 9:137341774-137341796 CTCCCCTGGGAGACGGCTCCTGG - Intronic
1062604790 9:137341834-137341856 CTCCCCTGGGAGACGGCTCCTGG - Intronic
1062604802 9:137341880-137341902 CTCCCCTGGGAGACGGCTCCTGG - Intronic
1062604847 9:137342058-137342080 CTCCCCTGGGAGACGGCTCCTGG - Intronic
1062604903 9:137342280-137342302 CTCCCCTGGGAGACGGCTCCTGG - Intronic
1062604915 9:137342326-137342348 CTCCCCTGGGAGACGGCTCCTGG - Intronic
1062604937 9:137342416-137342438 CTCCCCTGGGAGACGGCTCCTGG - Intronic
1185591353 X:1279587-1279609 CGCTTCTTGGAGCCTGCTTCTGG - Intronic
1186586135 X:10875087-10875109 CTCTCCAGGCATCCAGGTTCTGG + Intergenic
1186979860 X:14947199-14947221 CACCCCTGGGAGCAATCTTCAGG + Intergenic
1187032616 X:15503515-15503537 TGGCCCTGGGAGCCAGCTTCAGG - Intronic
1189324807 X:40105851-40105873 CACCCCTGGGATCCGGCTTCTGG + Intronic
1189520503 X:41762416-41762438 TTCTCCTGGGGGCCAGACTCAGG + Intronic
1190458272 X:50645869-50645891 CTCTCCTGGGAGCCAGCTTCTGG - Intronic
1192207977 X:69108730-69108752 CTCTCCTGGGGGTCAGCTTTGGG - Intergenic
1192730786 X:73800846-73800868 CTCTCCTGGGGGCCTGGATCAGG - Intergenic
1194875412 X:99181159-99181181 CTATACTGGGACCCAGCTGCTGG + Intergenic
1197321493 X:125037194-125037216 ATCTCCTGGGTTCCAGCATCTGG + Intergenic
1200092140 X:153641017-153641039 CCCTCCTGGGAGCAGGCCTCTGG - Intergenic
1200097344 X:153670402-153670424 CTCTCCAAGGAGCCAGCTCCTGG + Intronic
1200227883 X:154429129-154429151 CATTCCTGGGACCCAGCTCCAGG - Exonic
1201065135 Y:10089575-10089597 CTTTCCTGGGATCAAGCTGCCGG - Intergenic