ID: 1190459342

View in Genome Browser
Species Human (GRCh38)
Location X:50656450-50656472
Sequence ATTCACATGCGGAATGAAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 6, 3: 16, 4: 139}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190459342 Original CRISPR ATTCACATGCGGAATGAAAT TGG (reversed) Intronic
904422369 1:30402525-30402547 ATTCACAGGATGAATTAAATGGG - Intergenic
906738547 1:48156895-48156917 ATCCACATGAAGAATGAAGTTGG + Intergenic
906888385 1:49678309-49678331 ATTAATATTAGGAATGAAATAGG - Intronic
909546004 1:76847157-76847179 ATCCACATGCAGAATGAAATTGG - Intergenic
910030745 1:82719448-82719470 ATTCACATTCGCAGTGAAAATGG - Intergenic
910296325 1:85649291-85649313 ACCCACATGCAGAATGAAATTGG + Intergenic
910504835 1:87938293-87938315 TTTCATATGCTGAAGGAAATGGG + Intergenic
912142361 1:106746936-106746958 ATTGACATGCACAATGAAAGAGG + Intergenic
912339986 1:108904678-108904700 ATTCACCTTGGAAATGAAATGGG - Intronic
914088733 1:144476860-144476882 AATAACATGCGAAATGAAAGTGG - Intergenic
914592230 1:149115790-149115812 AATAACATGCGAAATGAAAGTGG - Intergenic
916581032 1:166108953-166108975 AGCCACATGCAGAATGAAACTGG + Intronic
919537372 1:198804991-198805013 ATTCACATACAGAAAGACATGGG - Intergenic
921319678 1:213926557-213926579 CTTCACAGGCAGATTGAAATAGG + Intergenic
921619632 1:217311491-217311513 ATTCATATGCTGAATGAATGTGG + Intergenic
924891778 1:248290277-248290299 ATTCATAAGTGGAATTAAATAGG - Intergenic
1063870049 10:10407492-10407514 AATTACATGCAGAATGAACTTGG - Intergenic
1065273219 10:24058094-24058116 AGCCACATGCAAAATGAAATTGG - Intronic
1066010394 10:31189012-31189034 ATTCACATGTCGAAAGTAATTGG + Intergenic
1066518517 10:36190403-36190425 ATTCTCATGGGGCATGAAATGGG + Intergenic
1067220724 10:44342235-44342257 ATTCACAAGCACAATGAAATGGG + Intergenic
1071738658 10:88331629-88331651 ATTCACATGAGGAGAGAAGTTGG + Intronic
1074249323 10:111728634-111728656 ACACACATGCAGAATGCAATTGG - Intergenic
1074915469 10:117950945-117950967 CCTCACTTGAGGAATGAAATGGG + Intergenic
1076107707 10:127836450-127836472 ACTCACATGCAGAATGGAAATGG + Intergenic
1078243124 11:9548484-9548506 ATACACATCAGGAATGAAAAAGG + Intergenic
1080353996 11:31420154-31420176 ATTCACATTAGGTTTGAAATAGG - Intronic
1080876404 11:36278898-36278920 ATTCTCATGCAGAAGGAAAAGGG - Intronic
1081243953 11:40740829-40740851 ATTCACATGTGGAAAGAAATTGG - Intronic
1083055282 11:59813224-59813246 ATTCACTTGCAGATTGAAATTGG + Intergenic
1084419814 11:69054686-69054708 AGTCACATGAGGCATGACATGGG - Intronic
1086466740 11:87061750-87061772 AATCACATGGGGAAAGAAACGGG + Intronic
1087647025 11:100819941-100819963 ATTAATATGCAAAATGAAATGGG - Intronic
1087868625 11:103264726-103264748 ATTCACATTCGGTATGACATTGG - Intronic
1087883775 11:103452016-103452038 ATTCACATGAGGAAAAAAAGGGG - Intronic
1090294142 11:125571442-125571464 ATTCACCTGAGAAATAAAATGGG + Intronic
1093269212 12:17038167-17038189 TTTCAAATGCTGAATGATATTGG + Intergenic
1093524162 12:20088164-20088186 AGTCATATGCAGAATGAAACTGG + Intergenic
1097249832 12:57626471-57626493 ATTCTCATGGGGCAGGAAATGGG - Exonic
1097764538 12:63510405-63510427 ATTCACATGCAGAATAAAATTGG + Intergenic
1101437756 12:104678869-104678891 TTTCACAAACTGAATGAAATGGG - Intronic
1105479807 13:20763967-20763989 ACTGACATTAGGAATGAAATGGG - Intronic
1107982203 13:45744510-45744532 ATTCACAACCAGAATGAAAGTGG + Intergenic
1109576750 13:64269304-64269326 AGCCACATGTGGAATGAAACTGG + Intergenic
1110419853 13:75294359-75294381 AGTCACATGAGCAATGAAACAGG + Intronic
1113057733 13:106287771-106287793 AGTCAAATCAGGAATGAAATGGG - Intergenic
1113172329 13:107518877-107518899 ATTCACAGGAGAAATGAAAGTGG + Intronic
1115084934 14:29503370-29503392 ATTCATATATGCAATGAAATAGG + Intergenic
1116112372 14:40603032-40603054 ATTCACAAGCGTGATGAAAAAGG + Intergenic
1117360722 14:54971031-54971053 AACCACATGCAGAATGAAACTGG + Intronic
1120793716 14:88608320-88608342 ATTCACTTGCAGGATGAGATGGG - Intronic
1121895339 14:97641727-97641749 GTTCACATGAGGAATGAATAAGG + Intergenic
1121907101 14:97756712-97756734 ATTCAGATGCTGCCTGAAATCGG - Intronic
1123412246 15:20070437-20070459 TTTTACATGCGGAAAGAAAAGGG - Intergenic
1123521590 15:21077557-21077579 TTTTACATGCGGAAAGAAAAGGG - Intergenic
1127689138 15:61377428-61377450 ATTCAAATGGATAATGAAATGGG + Intergenic
1127840876 15:62830529-62830551 ATTAGCATGCAGAATGGAATAGG - Intronic
1128072029 15:64803629-64803651 ATTCTCATGTAGGATGAAATCGG + Intergenic
1129637285 15:77333922-77333944 ATTCAGAAGTGGGATGAAATAGG - Intronic
1130709014 15:86261144-86261166 AGTCACATGTGGAATGAATTAGG + Intronic
1135332376 16:21571430-21571452 ATCCACATCCAGAATGAAATTGG + Intergenic
1137226728 16:46519652-46519674 ATTCACATGAGGAGAGAAAATGG + Intergenic
1139234827 16:65326739-65326761 ATTCGCATGCCTAATGAACTGGG - Intergenic
1148625277 17:49064594-49064616 ATTCACATGGGTCATGAAGTGGG - Intergenic
1150640615 17:66947219-66947241 AGTCACAGGAGGAATGAACTTGG + Intergenic
1152782831 17:82233809-82233831 ATGCACTTGAGGAATGAAACTGG - Exonic
1156229925 18:35143514-35143536 ATTCACATGCTGACTGAAAAGGG - Intergenic
1157295735 18:46441497-46441519 ACTCATATGAGGAATGAAAGAGG - Intronic
1158762980 18:60412273-60412295 GTGCACATGCAGAATGAAAGAGG - Intergenic
1164497044 19:28776007-28776029 ATTCACATAAGAAAAGAAATAGG + Intergenic
1165593776 19:36993748-36993770 ACTAACATCAGGAATGAAATAGG - Intronic
925513419 2:4652893-4652915 ATTCAGAAGATGAATGAAATTGG - Intergenic
930188859 2:48437538-48437560 ATTCGTATGGGGAATGAGATGGG - Intergenic
930565025 2:53007964-53007986 ATTTACATGGGAAAAGAAATGGG - Intergenic
931337470 2:61361602-61361624 ATCCACATACAGAATGAAACTGG + Intronic
932068528 2:68592074-68592096 TTTGAAATGCGGAATTAAATGGG + Intronic
935570110 2:104650794-104650816 ATTCACATCAGCAATGAAAAGGG - Intergenic
935919344 2:107994185-107994207 ACTAACCTGCGGGATGAAATTGG - Intronic
938142260 2:128805054-128805076 ATCCATATCAGGAATGAAATGGG - Intergenic
939210664 2:139171391-139171413 ATCCACATGCCTAGTGAAATGGG - Intergenic
940192132 2:151053038-151053060 ATTGACATGTGGGATGAAACTGG - Intergenic
943232587 2:185274166-185274188 ACTTACATGTGGAATTAAATAGG + Intergenic
943389662 2:187248929-187248951 ATTCTCATGCAAGATGAAATTGG - Intergenic
944506874 2:200421686-200421708 ATTCAGATTCAAAATGAAATAGG - Intronic
944730558 2:202512748-202512770 ACTCACTTGCAGAATGGAATGGG - Intronic
945505731 2:210637990-210638012 AATCACTTGCTGAATAAAATTGG - Intronic
945565919 2:211399168-211399190 ATTCACATGGGGCATATAATGGG - Intronic
1169565931 20:6853608-6853630 CTTCACATCAGGAATGAAAGTGG + Intergenic
1169598749 20:7231853-7231875 AGTTTCATGCGGAAAGAAATAGG - Intergenic
1171232872 20:23501343-23501365 ATTCACATGGAGACTGCAATAGG - Intergenic
1173839562 20:46148596-46148618 ATTCCCATGCTGAGTGAACTTGG - Intergenic
1175594374 20:60219005-60219027 AGTCACATGCAGCATGAAATTGG - Intergenic
1176934599 21:14851553-14851575 ATTCACATTCGCAAAGACATGGG - Intergenic
1179831410 21:43999333-43999355 ATCCACATGCAGAATGAAATTGG - Intergenic
1180175667 21:46086114-46086136 ATTAACATGAGAAATGAAATAGG + Intergenic
950337573 3:12209758-12209780 ATTCTCAAGAGGAATGAAACAGG - Intergenic
951406131 3:22300246-22300268 TTTTGCATGCAGAATGAAATTGG + Intronic
953824399 3:46237626-46237648 AGCCACATGCAGAATGAAACTGG - Intronic
953983553 3:47425024-47425046 ATTTAAATGCCTAATGAAATAGG - Intronic
956493291 3:69797145-69797167 ATTCACATGTGGCATTAAATTGG - Intronic
956990365 3:74755851-74755873 ATTCACATATGGACTGAATTGGG + Intergenic
970186955 4:13466014-13466036 ATCCACATGCAGAACAAAATTGG + Intronic
970435097 4:16025642-16025664 ATTCACATGAGGACAGGAATGGG - Intronic
970460209 4:16267375-16267397 ATTAACATTAGGAATGAAAAAGG + Intergenic
970730601 4:19099181-19099203 ATTAACTTGTGGAATGAATTTGG - Intergenic
970924360 4:21433744-21433766 ATTCAGATTAGGAAGGAAATTGG - Intronic
974465641 4:62251952-62251974 ATTAACAAGCACAATGAAATTGG - Intergenic
978890268 4:113817648-113817670 ATCCACATGCAAAAAGAAATTGG - Intergenic
979348548 4:119619028-119619050 ATTCACATGACTAATGAAAAAGG - Intronic
982833132 4:160088233-160088255 ATTCACATATAGAATAAAATTGG - Intergenic
985249504 4:188009255-188009277 ATTCACAAGCAAAATGAAACTGG - Intergenic
989103666 5:37841217-37841239 ATTCACATGGGGCATGGAATTGG + Intergenic
990935713 5:61146973-61146995 ATCAACATGAGGAAAGAAATGGG - Intronic
991246365 5:64512451-64512473 ATTCACATGTAGTATGAAGTCGG + Intronic
991532709 5:67633523-67633545 ATTCACATGTGGAAATATATTGG + Intergenic
994289028 5:98005023-98005045 ATTAACATGAGGAATTAAACAGG + Intergenic
995379208 5:111512908-111512930 ATCCACAAGCGGGATGAATTTGG - Intergenic
1000028459 5:157380760-157380782 ATTCACATGGTGAATTACATTGG - Intronic
1000636719 5:163652367-163652389 ACTAACATTTGGAATGAAATAGG - Intergenic
1000656428 5:163884654-163884676 GTTCACTTGCGGGAGGAAATGGG + Intergenic
1003627926 6:7760318-7760340 ATTCACATGCAGACTGACAAAGG - Intronic
1004055887 6:12138699-12138721 ACCCACATGTGGAATGAACTGGG - Intronic
1004577422 6:16910600-16910622 ATTCAGATGTGTAATAAAATTGG - Intergenic
1005204643 6:23388101-23388123 ATGCACATACAAAATGAAATTGG - Intergenic
1007562378 6:42820793-42820815 ATTCAGATGCTGAATGATCTGGG - Intronic
1008043647 6:46829584-46829606 ATTCACACGAGGAATGGATTGGG + Intronic
1008632645 6:53378271-53378293 ATTGACATGAGGTATGAATTTGG - Intergenic
1010035377 6:71319804-71319826 ATTCACATGGTAAATGAATTGGG - Intergenic
1011730385 6:90256541-90256563 ATTCACATGAGGTCTTAAATGGG - Intronic
1015168325 6:130224047-130224069 ATCCACAAGGGGAATGGAATGGG + Intronic
1017089460 6:150745702-150745724 AATCACATGCGGAGAAAAATGGG + Intronic
1018957801 6:168422522-168422544 ATCCACATGCAGAATAAAATTGG - Intergenic
1021535811 7:21703198-21703220 ATGGACATGCAGAATGAAACAGG + Intronic
1022146241 7:27544232-27544254 ATTCACAATTTGAATGAAATAGG - Intronic
1026531658 7:71204101-71204123 ATCCACAAGCAGAATGAAGTCGG - Intronic
1026598971 7:71757840-71757862 TTTCACATGCAGAATGAAATTGG - Intergenic
1027443381 7:78244870-78244892 ATGCAGATTCTGAATGAAATGGG + Intronic
1032777739 7:135131835-135131857 ACTAACATGAGGAATGAAACAGG + Intronic
1037864414 8:22431783-22431805 ATCCACCAGCTGAATGAAATTGG + Intronic
1039607609 8:38895403-38895425 ATTTTCATGGGGAATGAAACAGG - Intergenic
1041326656 8:56673817-56673839 ATTAACATTAGGAATGAAAAAGG + Intergenic
1042608499 8:70571736-70571758 ACCCACATGCAGAATGAAATTGG + Intergenic
1042702196 8:71627624-71627646 ATTCACAGGCCTAATGAGATGGG + Intergenic
1043784550 8:84381482-84381504 ATTAAGATGAGAAATGAAATAGG - Intronic
1055023969 9:71699618-71699640 ATTGACTTGGGGAATGAAGTCGG - Intronic
1055088395 9:72337596-72337618 AGCCACATCCGGAATGAAGTGGG - Intergenic
1055283438 9:74700986-74701008 ATTTATATTCGGAATGAAATGGG - Intergenic
1056594999 9:88000655-88000677 CTTCACTTGCGCAATGATATGGG + Intergenic
1056750365 9:89346432-89346454 ATACACATGCGGAAACCAATAGG + Intronic
1057595137 9:96409581-96409603 ATTCCCATGCATAATGAAACAGG + Intronic
1058815793 9:108681690-108681712 AGTGACATGAGCAATGAAATGGG - Intergenic
1186749036 X:12602505-12602527 AATGACATGGGGAATGAAGTTGG + Intronic
1190459342 X:50656450-50656472 ATTCACATGCGGAATGAAATTGG - Intronic
1192088020 X:68120936-68120958 ATCCTCATACGGAAGGAAATTGG + Intronic
1194996880 X:100600761-100600783 ATTGAGATGAGGAATCAAATGGG + Intergenic
1195425455 X:104724595-104724617 ATCCACATGTGTAATGAAACTGG + Intronic
1197431480 X:126371764-126371786 AATCACAGGCAGAATGAAACTGG + Intergenic
1197518264 X:127464118-127464140 ATCCATATGCAGAATGAAACTGG + Intergenic
1197588625 X:128381726-128381748 ATTCACATGCAGAATAAAATTGG + Intergenic
1198238337 X:134758588-134758610 AGCCACATGCAGAATGAAATTGG + Intronic
1198987214 X:142468788-142468810 AGCCACATGGAGAATGAAATTGG + Intergenic
1199426930 X:147712945-147712967 TTTGACATGAAGAATGAAATTGG - Intergenic