ID: 1190462533

View in Genome Browser
Species Human (GRCh38)
Location X:50692725-50692747
Sequence TCCTATCCATGTACATGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 169}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190462533 Original CRISPR TCCTATCCATGTACATGGGC AGG Intronic
900811903 1:4809765-4809787 TTCTATCCATGAACATGGACTGG - Intergenic
901639878 1:10687773-10687795 TCCTAACCATGACCATGGCCTGG - Intronic
904108780 1:28108434-28108456 CCCTACCCATGAATATGGGCTGG - Intergenic
907568534 1:55460633-55460655 TCCTATCCATGAGCATGGAATGG - Intergenic
907580016 1:55563443-55563465 TCCTATCCATGAGCATGGAATGG + Intergenic
909275994 1:73687667-73687689 TCCTATCCATGAGCATGGAATGG + Intergenic
909387049 1:75069255-75069277 TTCTATCCATGTACGTGGAATGG - Intergenic
915426427 1:155830842-155830864 ACCTATCCCTGTACATTGGGAGG - Intronic
915600839 1:156922348-156922370 TCCTATCCAGGTGCCTGTGCAGG - Intronic
915936498 1:160092930-160092952 GCCTCTCCCTGTACATGTGCGGG - Exonic
917500869 1:175583727-175583749 TCCTCTGACTGTACATGGGCAGG + Intronic
918272690 1:182918526-182918548 TCCAATCCATGAACATGGGATGG - Intronic
918522491 1:185430171-185430193 TGCTATACAGGTACATGTGCAGG - Intergenic
919071364 1:192759598-192759620 TCCTATCCAAGAACATGGAATGG + Intergenic
919541517 1:198851863-198851885 TACTTTTCATGTACATGGACTGG - Intergenic
920633926 1:207680190-207680212 GGCTATCCATGTATAGGGGCAGG + Intronic
921017371 1:211204691-211204713 TCCTGTCTATGTTCATGGGAAGG + Intergenic
921042255 1:211444525-211444547 TCCAATCCATGAACATGGGGTGG - Intergenic
922386785 1:225094001-225094023 TCCTATCCATGAGCATGGAATGG - Intronic
1062933849 10:1370823-1370845 TCCAATCCATGAGCATGGGATGG - Intronic
1065080136 10:22121048-22121070 TCCTATCCATGAGCATGGAATGG + Intergenic
1065213516 10:23427444-23427466 TGCTGTCCATATACATTGGCAGG - Intergenic
1065405805 10:25362567-25362589 TTCAATCCATGAACATGGGATGG + Intronic
1066157493 10:32693673-32693695 TCCTAGCCAGGCACATGGTCTGG + Intronic
1066158211 10:32700675-32700697 TCCTATCCATGAGCATGGAATGG + Intronic
1066235960 10:33484883-33484905 GCCTAACAATGTACATGGACAGG + Intergenic
1067337243 10:45375309-45375331 TCTTTTCCATGAGCATGGGCAGG + Intronic
1069112453 10:64464375-64464397 TCCTAGCCATTTTCATGGGCTGG + Intergenic
1070159387 10:73856690-73856712 TCCTGTCTATGGACATGGCCTGG - Intronic
1070832127 10:79424558-79424580 CCCTATCCATGTTCAGGGGCTGG + Intronic
1071212532 10:83360765-83360787 TCCTATCCATGAGCATGGATGGG + Intergenic
1073635976 10:105199582-105199604 CCCTGTCCATGGACATGGGTAGG + Intronic
1073635977 10:105199583-105199605 GCCTACCCATGTCCATGGACAGG - Intronic
1073962772 10:108953037-108953059 TCCTATCCATGAGCATGGAATGG - Intergenic
1078834186 11:15010967-15010989 TTTTATCCATGAACATGAGCTGG - Intronic
1080915346 11:36652172-36652194 TCCTATCCATGAACATGGAATGG + Intronic
1081081606 11:38747281-38747303 TACTTTCCAAGTACAGGGGCAGG - Intergenic
1083487031 11:62989763-62989785 TACTTTCCAGGTACATGGTCAGG - Intronic
1083815711 11:65131275-65131297 TCATGGCCAGGTACATGGGCCGG + Exonic
1084726119 11:70943338-70943360 TCCTAGCCAGTTTCATGGGCAGG - Intronic
1087555406 11:99713105-99713127 TCCTATCCATGAGCATGGAATGG + Intronic
1088557933 11:111081582-111081604 TGCTTTACATGTACATGGGGGGG + Intergenic
1091050844 11:132369418-132369440 TCCTATCCATGAGCATGGAATGG - Intergenic
1092433624 12:8428495-8428517 TCCTGTCCATGTGCCTGGTCAGG - Intergenic
1095218955 12:39585140-39585162 TCCTATCCATGAACATGGGATGG + Intronic
1095542621 12:43328715-43328737 TCCTATCCATGAGCATGGGATGG + Intergenic
1095780560 12:46054482-46054504 TCCAATCCATGAACATGGAAAGG - Intergenic
1097414731 12:59300999-59301021 TCCTATCCATGAGCATGGAATGG + Intergenic
1097956018 12:65485778-65485800 CTCTATCCATGTTCATGGGTTGG - Intronic
1099314868 12:81071488-81071510 TCCTATCCATAAGCATGGGATGG - Intronic
1101215986 12:102583480-102583502 TCCTATCCATGAGCATGGAATGG - Intergenic
1103022210 12:117543661-117543683 TCCAATCCATGAACATGGTATGG + Intronic
1105653970 13:22414246-22414268 TCTGATCCATGAACATGGGATGG + Intergenic
1107116229 13:36748852-36748874 TCCTATCCATGAACATGGAATGG + Intergenic
1109615817 13:64832539-64832561 TCCTATCCATGAGCATGGAGTGG - Intergenic
1111370106 13:87306332-87306354 TCCTATCCATGAGCATGGAATGG + Intergenic
1111575170 13:90144147-90144169 TCCTATCCATGAGCATGGAATGG + Intergenic
1112681535 13:101771910-101771932 TTTTATACATGTATATGGGCTGG - Intronic
1115161121 14:30395638-30395660 TCCTATGGATATCCATGGGCAGG + Intergenic
1116004006 14:39272778-39272800 GCCAATCCACGTCCATGGGCTGG - Intronic
1116588468 14:46740281-46740303 TTTTTTCCATGGACATGGGCGGG - Intergenic
1117060252 14:51954974-51954996 TCCCATTCCTCTACATGGGCAGG - Intronic
1121003406 14:90469310-90469332 TCCTATCCATGAGCATGGAATGG + Intergenic
1121514859 14:94542808-94542830 TCCTGTCCTTGTAGACGGGCTGG - Intergenic
1125178411 15:36852536-36852558 TCCTTTCTCTGTACCTGGGCTGG - Intergenic
1125299801 15:38242840-38242862 TCCTATCCATTTAAATGGCATGG - Intergenic
1126783668 15:52159471-52159493 TCCTCTCCCTGGACATGGGAAGG - Intronic
1127095062 15:55504292-55504314 TCCTATCCATGAGCATGGAATGG - Intronic
1129002264 15:72344565-72344587 TCGCATCCATGTTCATGGACAGG - Intronic
1130005619 15:80094195-80094217 TCCTATCCCAGTCCCTGGGCTGG + Intronic
1137565283 16:49528854-49528876 TTCTATCAATATCCATGGGCTGG - Intronic
1141304833 16:82852443-82852465 TCCTATCCATGGAAATAGGAAGG - Intronic
1141516079 16:84546006-84546028 GCCTCTTCATGCACATGGGCAGG - Intronic
1142404497 16:89879991-89880013 TGCTGTCCATGTACACAGGCAGG + Intronic
1143274872 17:5703020-5703042 TTCTATCCATGTAAATGGCAAGG + Intergenic
1144608003 17:16684978-16685000 TCAAATGCATGTACATGGGTGGG - Intergenic
1145196834 17:20901210-20901232 TCAAATGCATGTACATGGGTGGG + Intergenic
1150484975 17:65537259-65537281 TCCCAGCCAGGTCCATGGGCAGG - Intronic
1154481420 18:14829951-14829973 TGCTTTACATGTACATGGGTAGG - Intronic
1155091169 18:22513139-22513161 TCCTATCCATGAGCATGGAAAGG + Intergenic
1155758404 18:29531984-29532006 TCCTATCCATGAGCATGGAATGG - Intergenic
1155774140 18:29737673-29737695 TGCTGTGCATGTACATGGACAGG - Intergenic
1156443370 18:37214770-37214792 TCCTATCCATGAGCATGGAATGG + Intronic
1156551037 18:38017160-38017182 TCCTATCCATGAGCATGGAATGG + Intergenic
1157398188 18:47361422-47361444 TCCTATCCATGAACATGACATGG + Intergenic
1164049446 19:21571700-21571722 TCCTATCCATGCCTATTGGCAGG - Intergenic
926258904 2:11238308-11238330 TCCAATCCGTGTACATGAGGTGG - Intronic
928433598 2:31239626-31239648 TCCTAACCAGGTCCCTGGGCAGG - Intronic
930723880 2:54664241-54664263 TCATTTCCCTGTAAATGGGCGGG + Intronic
932437773 2:71712877-71712899 TCCCATCCATGTTCATGGACAGG + Intergenic
933022351 2:77209619-77209641 TCATATGCAGGTATATGGGCAGG - Intronic
933790811 2:85882399-85882421 TCCTAGCCACTTTCATGGGCTGG - Intronic
935744563 2:106179180-106179202 TCCTGTCCAGGAACATGAGCAGG - Intronic
936438078 2:112525411-112525433 TCCTATCCATGAGCATGGAATGG + Intronic
939305618 2:140406713-140406735 TTCCATCCATGAACATGGGCTGG - Intronic
939415966 2:141897578-141897600 TCATATCTTTGTACATGGGCAGG - Intronic
940812486 2:158260886-158260908 TCCTATCCATGAGCATGGTATGG - Intronic
943257511 2:185614856-185614878 TGCAATCCATAAACATGGGCTGG + Intergenic
1169789263 20:9392387-9392409 TCCTATTCATTTACATAGACCGG - Intronic
1171748025 20:29018877-29018899 TCCTATCCATGAGCATGGGGTGG - Intergenic
1174293375 20:49525027-49525049 TCCTCCTCATGCACATGGGCTGG - Intronic
1174332711 20:49832486-49832508 TCTTATCCCTCTACATGGGTTGG + Intronic
1175020354 20:55840880-55840902 TCCAATCCATGAACATGAGATGG - Intergenic
1176317501 21:5260807-5260829 TCCTATCCATGAGCATGGGGTGG + Intergenic
1176350413 21:5789988-5790010 TCCTATCCGTGAGCATGGGATGG + Intergenic
1176357227 21:5910572-5910594 TCCTATCCGTGAGCATGGGATGG + Intergenic
1176544734 21:8188058-8188080 TCCTATCCGTGAGCATGGGATGG + Intergenic
1176563685 21:8371103-8371125 TCCTATCCGTGAGCATGGGATGG + Intergenic
1176799186 21:13406653-13406675 TGCTTTACATGTACATGGGTAGG + Intergenic
1178388030 21:32171866-32171888 TCTGATCCATGAACATGGGATGG - Intergenic
1180395172 22:12325221-12325243 TCCTATCCATGAGCATGAGGTGG + Intergenic
1180404568 22:12539530-12539552 TCCTATCCATGAGCATGAGGTGG - Intergenic
1183655464 22:39181995-39182017 GCCTTTCCATGTGCAGGGGCTGG - Intergenic
1203249604 22_KI270733v1_random:104295-104317 TCCTATCCGTGAGCATGGGATGG + Intergenic
949160269 3:873730-873752 AGCTATCAATGTACATGGTCAGG + Intergenic
950175423 3:10870118-10870140 TCCTGTCTGTGAACATGGGCTGG - Intronic
959766849 3:110041364-110041386 TCCTATCCATGAGCATGGAATGG + Intergenic
964705624 3:159615851-159615873 TGCTTTCAATGTACATGTGCTGG + Intronic
964877259 3:161381858-161381880 TCTGATCCATGAACATGGGAGGG + Intergenic
966644121 3:182224100-182224122 TCCTATTCATGAACATGGAATGG + Intergenic
967591444 3:191280128-191280150 TGCTTTCCATCTACATGGGAAGG + Intronic
971690073 4:29822371-29822393 TCCTATCCATGAGCATGGAATGG + Intergenic
975951547 4:79777914-79777936 TCCTATCCATGAACACAGACAGG - Intergenic
976136392 4:81941626-81941648 TCCTATTCATGAACATGGAATGG - Intronic
980261606 4:130456511-130456533 TCCTATCCATGAGCATGGAATGG + Intergenic
981556195 4:145997662-145997684 TCCAATCCATGAACATGAGATGG + Intergenic
984457199 4:179985481-179985503 TCCTATCCATGAGCATGGAATGG + Intergenic
984482544 4:180324453-180324475 TCCTATCCATGAGCATGGACTGG + Intergenic
985193169 4:187399958-187399980 TGCTGTCCATGGACATGGGGAGG + Intergenic
986104008 5:4642677-4642699 TCCTATCAATGTACATTGGGAGG - Intergenic
986485018 5:8227306-8227328 TCCTCTCCATTTACATAGGGCGG - Intergenic
991532081 5:67626746-67626768 TAGTATCCATGTAAAAGGGCTGG + Intergenic
995797011 5:115952099-115952121 TCCTTTCCATGTCCAAGGGGTGG + Intergenic
996881728 5:128304951-128304973 TCTTACCCATGCACATGGTCTGG + Exonic
999826991 5:155283054-155283076 TTCCATCCATGAACATTGGCAGG - Intergenic
1003625236 6:7735262-7735284 TCCTGTACGTGAACATGGGCTGG + Intronic
1003777084 6:9379592-9379614 TTTTATCCATGTACATTGCCAGG + Intergenic
1004343630 6:14828786-14828808 ACCCATCCATATGCATGGGCTGG + Intergenic
1006479625 6:34281258-34281280 TCCTATCCAATGACATGGTCAGG - Exonic
1008608407 6:53163421-53163443 TCCAATCCATGAACATGGAATGG - Intergenic
1009263823 6:61529302-61529324 TCCTATGCATGAACATGGAATGG - Intergenic
1009393632 6:63171483-63171505 TCCTATCCATGAGCATGGAATGG - Intergenic
1009454013 6:63833580-63833602 TCCTATCCATGAGCATGGAATGG - Intronic
1010903927 6:81462278-81462300 ACCCATCCATGAACATGGGATGG + Intergenic
1011551539 6:88535240-88535262 GCCTATCCATATTCATAGGCTGG - Intergenic
1012766370 6:103371407-103371429 TCCTATCCATGAGCATGGAATGG - Intergenic
1014294474 6:119601852-119601874 GCCTATACATCAACATGGGCGGG - Intergenic
1015367064 6:132408040-132408062 TCCTATCCATGAGCATGGACAGG + Intergenic
1016076460 6:139802403-139802425 TCTTCTCCATATACCTGGGCAGG + Intergenic
1016585306 6:145677799-145677821 TCCTATCCATGAGCATGGAATGG - Intronic
1017213730 6:151884745-151884767 TTCTATCCTAGTACATGTGCTGG + Intronic
1017372692 6:153732056-153732078 TCCTATCCATGAACATGAAATGG - Intergenic
1018251132 6:161871735-161871757 TCCTATCCATATCCATGGAAGGG - Intronic
1019205021 6:170353792-170353814 TCCTATCCATGAGCATGGAATGG - Intronic
1021004763 7:15380532-15380554 TGCTATCCATGAACATGGAATGG - Intronic
1021051882 7:15995396-15995418 TCCCATCCATGAACATGGAATGG + Intergenic
1021557595 7:21937164-21937186 TCCAATCCATGAACATGGGATGG - Intronic
1024197833 7:47076960-47076982 TCCAATCCATGAACATGGTATGG - Intergenic
1026599276 7:71762281-71762303 TCCTAACTACGTTCATGGGCAGG + Intergenic
1028629650 7:92920831-92920853 TCCTATCCATGAGCATGGAATGG + Intergenic
1030542683 7:110851935-110851957 CCCTACCCTTGAACATGGGCAGG + Intronic
1032078773 7:128848459-128848481 TCCTCCCCATAGACATGGGCAGG - Intronic
1037154254 8:15680204-15680226 TCCAATCCATGAGCATGGGTTGG + Intronic
1041356320 8:57004409-57004431 TCCTATCCATGAGCATGGAATGG + Intergenic
1041653461 8:60324095-60324117 TCCTATCCATGAGCATGGAATGG + Intergenic
1048942554 8:139414239-139414261 TCCTATCCTTGAATCTGGGCTGG - Intergenic
1050360131 9:4822344-4822366 TTCTGTCCTTGTTCATGGGCAGG + Intronic
1050891177 9:10826404-10826426 GCCTATCCATGAGCATGGGATGG + Intergenic
1050957203 9:11679777-11679799 TCCTATCTATGAGCATGTGCGGG - Intergenic
1053180383 9:35962940-35962962 TCCTCTCCATGTCCAGTGGCTGG - Intergenic
1055244619 9:74224808-74224830 TCCTATCCATGAGCATGGATAGG + Intergenic
1055244620 9:74224809-74224831 TCCTATCCATGCTCATGGATAGG - Intergenic
1058819651 9:108717975-108717997 TCCTATCCATGAGCATGGAATGG - Intergenic
1059745327 9:117194663-117194685 TCCTGTCCATTTATATGAGCAGG - Intronic
1061879422 9:133561337-133561359 CCATTTCCATGGACATGGGCTGG + Intronic
1203465998 Un_GL000220v1:87556-87578 TCCTATCCGTGAGCATGGGATGG + Intergenic
1203410806 Un_KI270579v1:264-286 TCCTATCCATGAGCATGGGGTGG + Intergenic
1203410225 Un_KI270581v1:1441-1463 TCCTATCCATGAGCATGAGGTGG - Intergenic
1203415763 Un_KI270582v1:5854-5876 TCCTATCCATGAGCATGGGGTGG + Intergenic
1186793935 X:13025589-13025611 TCCTATGCATGTACATCAGAGGG + Intergenic
1190462533 X:50692725-50692747 TCCTATCCATGTACATGGGCAGG + Intronic
1191883431 X:65864595-65864617 TCCTATTCATGAACAATGGCTGG + Intergenic
1192042660 X:67639438-67639460 TCCTATCCATGAGCATGGAATGG + Intronic
1192815206 X:74583369-74583391 TGCTATTCATGTACAAGGTCAGG - Intergenic
1194274287 X:91860081-91860103 TCCTATCCATGAGCATGGTAAGG + Intronic
1194825813 X:98561712-98561734 TCCTATCCATGAGCATGGAATGG + Intergenic
1195509145 X:105694189-105694211 TCCTATCCCTGAATCTGGGCTGG - Intronic
1197548609 X:127859929-127859951 TCCTATCCATGAGCATGGAATGG + Intergenic
1199819910 X:151434118-151434140 GGCTATGCATGTACAGGGGCAGG - Intergenic
1200591525 Y:5081487-5081509 TCCTATCCATGAGCATGGTAAGG + Intronic