ID: 1190464012

View in Genome Browser
Species Human (GRCh38)
Location X:50707929-50707951
Sequence GGGCCCTGGACCCACCCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 470
Summary {0: 1, 1: 0, 2: 2, 3: 40, 4: 427}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190464008_1190464012 -6 Left 1190464008 X:50707912-50707934 CCAATTCACCCTAACATGGGCCC 0: 1
1: 0
2: 0
3: 7
4: 78
Right 1190464012 X:50707929-50707951 GGGCCCTGGACCCACCCTGCAGG 0: 1
1: 0
2: 2
3: 40
4: 427
1190464005_1190464012 7 Left 1190464005 X:50707899-50707921 CCATCAGATATATCCAATTCACC 0: 1
1: 0
2: 0
3: 8
4: 122
Right 1190464012 X:50707929-50707951 GGGCCCTGGACCCACCCTGCAGG 0: 1
1: 0
2: 2
3: 40
4: 427
1190464003_1190464012 24 Left 1190464003 X:50707882-50707904 CCCTTTTCTCTGCAGTGCCATCA 0: 1
1: 1
2: 5
3: 108
4: 776
Right 1190464012 X:50707929-50707951 GGGCCCTGGACCCACCCTGCAGG 0: 1
1: 0
2: 2
3: 40
4: 427
1190464004_1190464012 23 Left 1190464004 X:50707883-50707905 CCTTTTCTCTGCAGTGCCATCAG 0: 1
1: 2
2: 6
3: 78
4: 661
Right 1190464012 X:50707929-50707951 GGGCCCTGGACCCACCCTGCAGG 0: 1
1: 0
2: 2
3: 40
4: 427

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190464012 Original CRISPR GGGCCCTGGACCCACCCTGC AGG Intronic
900165881 1:1244130-1244152 GGGCCCTGTGCTGACCCTGCTGG - Intronic
900210600 1:1454055-1454077 GGGCCCTGGGCAGACCCAGCTGG - Intronic
900216472 1:1484726-1484748 GGGCCCTGGGCAGACCCAGCTGG - Intronic
900223555 1:1522454-1522476 GGGCCCTGGACAGACCCAGCCGG - Intronic
900225695 1:1532778-1532800 GGGCCCCGGACCCACAGTGGTGG + Intronic
900342313 1:2194878-2194900 GGGCCCTGATCCCAGCCTGTAGG + Intronic
900660214 1:3778344-3778366 GGGAACTGGCCTCACCCTGCTGG - Intergenic
900660458 1:3779594-3779616 GCGCCCAGGACCCACCTTTCTGG + Exonic
900992528 1:6104517-6104539 GGGCCCATGACCCTCCTTGCTGG + Exonic
901056639 1:6451433-6451455 GGGCCCTGAAACCTGCCTGCAGG + Intronic
901069708 1:6511119-6511141 GGGCACTGGACCCACGCATCTGG - Intronic
901490558 1:9594398-9594420 GGGCCCTGGGCCTTCCCCGCAGG + Intronic
901781812 1:11599206-11599228 GTGCGCTGTACCCACCCTGAGGG - Intergenic
902616418 1:17625899-17625921 GGGCACTGGGCCCTCTCTGCAGG + Intronic
903072393 1:20732771-20732793 GGGCCGTGGCCCCATCCTTCGGG + Intronic
903115398 1:21175828-21175850 GTGCCTGGGACCAACCCTGCAGG - Intronic
903222125 1:21874876-21874898 GGGCCCAGGACTCACCTGGCAGG + Exonic
903285010 1:22271366-22271388 AGGGCCTAGACCCTCCCTGCTGG + Intergenic
903372375 1:22844902-22844924 GGGCCCTGGAACCAGGCAGCAGG + Intronic
903450330 1:23449491-23449513 GGGCCCTGGGCCCTTCCAGCTGG + Intronic
903801866 1:25974763-25974785 GGGCCCTGGTACCCCCCTCCTGG - Intronic
904078626 1:27858215-27858237 GGGCACAGGGCCCAGCCTGCTGG - Intergenic
904210688 1:28885167-28885189 GGGCCCTGCCCCCTCCCTGCTGG - Intergenic
904559780 1:31388682-31388704 GATGCCTGGACCCACCCAGCTGG - Intergenic
904587699 1:31589051-31589073 GGCCCCGGGACCCGCCCCGCCGG + Intergenic
904826598 1:33277337-33277359 AGGCTCTGGAGCCACACTGCCGG - Intronic
908598965 1:65718677-65718699 TGGCCTTGGACTCACCCTTCAGG + Intergenic
908902727 1:68974687-68974709 GGGCACTTGACGCTCCCTGCTGG + Intergenic
909592734 1:77370160-77370182 GGGTTCTGATCCCACCCTGCTGG + Intronic
910113137 1:83702973-83702995 GGGCCTTGTACCCACACTGCAGG - Intergenic
912467333 1:109883085-109883107 GGCCCCAGGCCCCTCCCTGCTGG + Intergenic
913112072 1:115665852-115665874 GAGCCCTGGACACACCAGGCTGG + Intronic
915142606 1:153776586-153776608 GGCCCAGGAACCCACCCTGCTGG + Exonic
915625462 1:157111634-157111656 GGGGCCTTGTCCCTCCCTGCAGG - Intergenic
916678797 1:167086217-167086239 GGGGCCTGGGCCCCACCTGCTGG - Intronic
919751662 1:201041511-201041533 GAGCCCTTGGCCAACCCTGCAGG - Exonic
919816639 1:201445020-201445042 GTGACGTGGACCCACCCTACAGG + Intergenic
919857532 1:201715908-201715930 CAGCCCTGCACCCACCCTTCAGG - Intronic
920712177 1:208305729-208305751 AGGCCCTGCACTCACCCAGCAGG - Intergenic
921296130 1:213705494-213705516 GGGCCTGGGACTCACCCTTCAGG + Intergenic
921971905 1:221158971-221158993 GGGCCCTGGAAACATACTGCTGG - Intergenic
922056732 1:222049382-222049404 GGGCCTTGGCCTTACCCTGCAGG - Intergenic
922468629 1:225861912-225861934 CTGCCCTGGACCCATCCTGTTGG - Intronic
1062769280 10:86572-86594 GGGCCCAGGCCTCATCCTGCAGG + Intergenic
1062848449 10:725730-725752 GGGCTCCAGACACACCCTGCTGG - Intergenic
1063822240 10:9849824-9849846 GGGCCTTGTATCCTCCCTGCTGG + Intergenic
1066451016 10:35530275-35530297 GGGCCCTGGACCACCTCGGCTGG - Intronic
1067089685 10:43260259-43260281 GTGCCCTCGGTCCACCCTGCCGG - Intronic
1067481112 10:46598148-46598170 GGGCGCTGGAGACACGCTGCGGG - Intergenic
1067613640 10:47743674-47743696 GGGCGCTGGAGACACGCTGCGGG + Intergenic
1067918554 10:50427753-50427775 AAGCCCTGGACCCAGCCTTCAGG - Intronic
1068663393 10:59647121-59647143 GGGCTCTGGCTCCACACTGCTGG + Intergenic
1070808206 10:79283266-79283288 AGGCCCTGGAGCCAGGCTGCTGG + Intronic
1070891742 10:79946430-79946452 GGGCCCTGGGCTTATCCTGCTGG - Intronic
1070948050 10:80409035-80409057 GGGCCCGGGGGCCGCCCTGCTGG + Intronic
1071570057 10:86691834-86691856 GAGCCCAGTTCCCACCCTGCTGG - Intronic
1071629049 10:87203646-87203668 GGGCGCTGGAGACACGCTGCGGG + Intergenic
1072040072 10:91598515-91598537 GGGCTCTGGAGCCAAACTGCTGG - Intergenic
1072145724 10:92634807-92634829 GGGTCCTGGACCCAACCAGAAGG + Intronic
1072862723 10:99023120-99023142 TGGCCCAGGACTCACCCTTCAGG - Intronic
1074121598 10:110497787-110497809 GGGCCGTGGCCACGCCCTGCAGG - Intergenic
1074377802 10:112952766-112952788 GGGCGCGGGACCGACCCTGCAGG - Intronic
1074684463 10:115947794-115947816 GGGCACTGGACCCAGCTTTCAGG + Exonic
1074775287 10:116763577-116763599 GTCCCCTGGCCCCACCCTGCTGG - Intergenic
1075201521 10:120408601-120408623 GGTCCCTCGGCCCACCCTGGAGG + Intergenic
1075244270 10:120806545-120806567 GGGTCCTGGAACCAGACTGCTGG + Intergenic
1075485451 10:122818789-122818811 GGGCACCGGGCCCATCCTGCTGG + Intergenic
1075724859 10:124606004-124606026 GGCAGCAGGACCCACCCTGCAGG + Intronic
1076302941 10:129441754-129441776 AGTCCCTGGTCCCACCCTGGGGG - Intergenic
1076404991 10:130205732-130205754 GAACCCTGGCCCCTCCCTGCAGG - Intergenic
1076776846 10:132702775-132702797 GGGCTCTGGCCCCATCCAGCAGG + Intronic
1076839999 10:133041230-133041252 GGACCCTAGACCCATCCTCCTGG + Intergenic
1076888453 10:133273062-133273084 GGGGCCTGGACCCTCCCTCAGGG + Intronic
1076901829 10:133343149-133343171 GGCCGCGGGACCCACTCTGCTGG + Intronic
1076934632 10:133559286-133559308 GGCCCCTGAACTCACCTTGCTGG + Exonic
1077116094 11:885273-885295 GATCCCTGGACCCACCTGGCAGG + Intronic
1077169388 11:1159508-1159530 GGGGTCTGGTCCCACCATGCTGG + Intronic
1077169420 11:1159615-1159637 GGGGTCTGGTCCCACCATGCTGG + Intronic
1077169452 11:1159729-1159751 GGGGTCTGGTCCCACCATGCTGG + Intronic
1077169465 11:1159776-1159798 GGGGTCTGGTCCCACCATGCTGG + Intronic
1077169525 11:1159992-1160014 GGGGTCTGGTCCCACCATGCTGG + Intronic
1077194382 11:1272101-1272123 GGGCCCGGGCCACCCCCTGCAGG + Intergenic
1077432783 11:2524292-2524314 GGGCCCAGGGCCCAGCCTCCAGG + Intronic
1077491087 11:2861389-2861411 GGGCCCCGGACCCAGCCTGAGGG - Intergenic
1077533214 11:3106926-3106948 GGGCCCTTGACCCCATCTGCTGG - Intronic
1077998626 11:7475274-7475296 GGGCCCAGCACCCTCCCTGTGGG - Intergenic
1078830495 11:14972764-14972786 GGGCCCAGAACCCACCCTTAGGG - Intronic
1079079730 11:17405887-17405909 GGGCCCTGGGGACAGCCTGCCGG + Intronic
1081675523 11:44966849-44966871 GGCCCCTGGGCCCGGCCTGCTGG + Intergenic
1081938130 11:46918565-46918587 GGGCCCGGGACACCCCCTCCCGG - Exonic
1083301132 11:61740133-61740155 GGGCCCTGGCTCCTCCCTCCAGG + Intronic
1083544450 11:63538241-63538263 GGGCCCAGGACACACCCTGTGGG - Intronic
1083766425 11:64843614-64843636 GTTCCCTGGTCACACCCTGCCGG - Intronic
1083775027 11:64890430-64890452 GGGCCCAGGACCCCAGCTGCTGG - Intergenic
1084416103 11:69033769-69033791 TGGCCGTGGCCCCACCCTACTGG + Intergenic
1084422523 11:69067419-69067441 AGGCCCCGGACCCAACCGGCTGG - Intronic
1085051419 11:73382106-73382128 GGGCCCTGGAGCAACCCACCAGG - Intronic
1085258512 11:75190922-75190944 GGGCCCTGGAATTCCCCTGCAGG + Intronic
1085523204 11:77150078-77150100 TGGCCCTGGAAGTACCCTGCAGG - Intronic
1085572092 11:77568666-77568688 AGGCCCGGGACTCACCCTTCAGG + Intronic
1085644563 11:78214600-78214622 GGGCACTTCACCCAACCTGCAGG - Exonic
1086575763 11:88337658-88337680 GGGCCCAGCACCCATGCTGCAGG + Exonic
1087094546 11:94306684-94306706 GGGCCCTGGATCCAGCCAGTGGG + Exonic
1088623354 11:111709267-111709289 GGGCCCTGATCCCACACAGCGGG - Intronic
1088906110 11:114156560-114156582 GTTCCCTGGACCCTCCCTCCAGG + Intronic
1089201225 11:116725796-116725818 GGGCGATGGAGCCACTCTGCAGG - Intergenic
1089848779 11:121479579-121479601 GGGTCCTGGACGTCCCCTGCTGG + Intronic
1090065274 11:123498106-123498128 AGGCCTGGGACCCACCCTTCAGG + Intergenic
1090807628 11:130212235-130212257 GGCCACTGGCCCCACCCAGCGGG - Intergenic
1091035604 11:132230432-132230454 GGGACCTGCACCCAGCCTCCTGG + Intronic
1091380084 12:52219-52241 GGCCTCTGGACCCATCCTGGAGG + Intergenic
1091666526 12:2422690-2422712 GTGCCCTTTACCCTCCCTGCAGG - Intronic
1091780148 12:3208488-3208510 GGGGCCTGGACCCAGCCAGCTGG + Intronic
1095098926 12:38161993-38162015 GGGCCCTGGGCCCACGGTCCTGG + Intergenic
1096526344 12:52212449-52212471 GGGCCCTGGTCCCACTACGCAGG - Intergenic
1096532100 12:52248681-52248703 GAGCCCAGGACCCGCACTGCTGG - Exonic
1096882920 12:54687218-54687240 GGACCCTGGACCCACTCTGAAGG + Intergenic
1100713641 12:97283505-97283527 GGGCGCTGGAGGGACCCTGCAGG + Intergenic
1101967542 12:109291682-109291704 GGGCCCTGGGCCCACAAAGCTGG + Intronic
1102107463 12:110337554-110337576 GGGCCCTGCAGCGATCCTGCTGG - Intronic
1102471837 12:113163719-113163741 AGGCCCAGGACCCACCCACCAGG + Intronic
1103327535 12:120131396-120131418 GGCCCATGGGCCCACCCCGCTGG + Intronic
1103862731 12:124027350-124027372 GGGGCCTGGACACTCACTGCAGG - Intronic
1103986718 12:124772305-124772327 TGGCCCTGGACCCACCCACGGGG + Intergenic
1104639008 12:130455484-130455506 GGACCCTGGTCCCTGCCTGCTGG + Intronic
1104728154 12:131090363-131090385 GGGCCCTGGGCTCGCACTGCTGG + Intronic
1104780653 12:131417806-131417828 GAGCCCTAGACACACCCTCCAGG - Intergenic
1104926108 12:132314704-132314726 GGGCACTGGGCACACCCTGCTGG + Intronic
1104929513 12:132330155-132330177 GGGCCCTGGAGCCACCAGGAGGG + Intergenic
1104966379 12:132510346-132510368 TGGCCCTGGGCCATCCCTGCCGG + Intronic
1106120097 13:26852902-26852924 GGGACCTGGTCCCACCCTGGGGG - Intergenic
1110095949 13:71521053-71521075 GGGCTCTGGAGCCAAACTGCTGG + Intronic
1111291971 13:86182850-86182872 AGGCCTGGGACTCACCCTGCAGG - Intergenic
1112175432 13:97018775-97018797 GGGCCCTGTGCTCACCCTGAAGG + Intergenic
1113404030 13:110021640-110021662 GGTGCCTGGACCTAACCTGCGGG + Intergenic
1113877474 13:113603313-113603335 GCCCCCTGGACACACCCTGGCGG + Intronic
1113901479 13:113800637-113800659 GGGGCCAGGACCCTTCCTGCAGG - Intronic
1114627045 14:24136603-24136625 GGCCCCGGGACCCTCCCTGAGGG - Intronic
1114644745 14:24249180-24249202 GAGCCCTGGACTCCCCCTCCGGG + Exonic
1117805240 14:59484172-59484194 GGTGTCTGGGCCCACCCTGCTGG - Exonic
1118818790 14:69331331-69331353 TGGCCCTGGGCATACCCTGCAGG + Intronic
1119420077 14:74503173-74503195 GGGGCCTGGCCCAGCCCTGCAGG + Intronic
1121573757 14:94966899-94966921 GGGCCCTGGGCTCAGCCAGCTGG - Intergenic
1121994639 14:98592846-98592868 GGGCGCTGGTCCCACCCTCCTGG + Intergenic
1122011616 14:98753877-98753899 AGCCCCTGCACCCACCCTCCAGG + Intergenic
1122809451 14:104280853-104280875 AGGCCCTGGGCCCAGCATGCAGG + Intergenic
1123024515 14:105418485-105418507 GGTCCCAGGACACATCCTGCGGG - Intronic
1123223228 14:106875714-106875736 CAGCCCTGCCCCCACCCTGCAGG + Intergenic
1202872663 14_GL000225v1_random:178000-178022 GGTCCCTGGAGCCCCCCTGACGG + Intergenic
1123705957 15:22951379-22951401 GGACCCTGCACCCACCCGGCCGG - Intronic
1123977598 15:25567928-25567950 GAGCCCTTGACCGTCCCTGCAGG + Intergenic
1124202717 15:27692200-27692222 GGGCGCTGCACCCATCATGCTGG + Intergenic
1124687825 15:31797565-31797587 GGGCCCAGGCCCCACCATGCAGG + Intronic
1125719663 15:41839262-41839284 GGGCCCTGGGCTGACCCTGGTGG + Intronic
1126112216 15:45181994-45182016 GAGTCCTGGAGGCACCCTGCTGG - Intronic
1127547628 15:60005223-60005245 GGGCGCTGCACCCAAGCTGCGGG + Exonic
1127783419 15:62335575-62335597 AGGCCTGGGACTCACCCTGCAGG + Intergenic
1129387191 15:75202489-75202511 GGGCCCTGGACGCGCCCTGCTGG + Intronic
1130269851 15:82440472-82440494 GGGCCCTGAACTCAGCCTGGAGG - Intergenic
1130462190 15:84167773-84167795 GGGCCCTGAACTCAGCCTGGAGG - Intergenic
1130490487 15:84427000-84427022 GGGCCCTGAACTCAGCCTGGAGG + Intergenic
1130502075 15:84505770-84505792 GGGCCCTGAACTCAGCCTGGAGG + Intergenic
1130899041 15:88193214-88193236 GGGCCCTGGTCTGACCCTACAGG + Intronic
1131095674 15:89652999-89653021 AGGAGCTGGACTCACCCTGCAGG + Intronic
1131152272 15:90054487-90054509 CGGCCCTGGGCCCACCCAGCTGG + Intronic
1131424051 15:92330939-92330961 GAGGCCTGGTCCCTCCCTGCAGG + Intergenic
1131968170 15:97867300-97867322 GGGCACTGCAACCACCATGCAGG + Intergenic
1131975133 15:97936798-97936820 GGGTCCTGGAGGCAGCCTGCAGG - Intergenic
1132225143 15:100134471-100134493 GGTCCCTGGCCACACCCTGGAGG - Intronic
1132351738 15:101143558-101143580 AGGGCCTGGACCCACCCTGGGGG + Intergenic
1132458391 16:36816-36838 GGGCCCAGGCCCCATTCTGCAGG + Intergenic
1132554891 16:568067-568089 AGGCCCTGGGCCCACCCAGCAGG - Exonic
1132658166 16:1049890-1049912 GGCCCCTGTCCCCATCCTGCAGG + Intergenic
1132675449 16:1119457-1119479 GGGGCCTGCTCCCACCCTGCTGG - Intergenic
1132701253 16:1223052-1223074 GGGCAGTGGCCTCACCCTGCAGG + Intronic
1132731391 16:1363913-1363935 GAGCCCTGGAGACACCCTGAGGG + Exonic
1132845497 16:1999215-1999237 TGGCCCTGCACCTGCCCTGCAGG - Intronic
1132871781 16:2118618-2118640 GGGCCCAGGTCCCACCTGGCTGG + Intronic
1132904959 16:2277834-2277856 GGGCCCAGGGCCCACCCAGTGGG + Intronic
1132915603 16:2341703-2341725 ACGCCCGGGACCCTCCCTGCAGG - Intergenic
1132925027 16:2424790-2424812 GGGCCCAGGGCCCACCCAGTGGG - Intergenic
1134234102 16:12452085-12452107 GGGTGCTGGACCCACCCTGAGGG + Intronic
1134520746 16:14918277-14918299 GGGCCCAGGTCCCACCTGGCTGG - Intronic
1134550829 16:15137696-15137718 GGGCCCAGGTCCCACCTGGCTGG + Intronic
1134708418 16:16316928-16316950 GGGCCCAGGTCCCACCTGGCTGG - Intergenic
1134715633 16:16356961-16356983 GGGCCCAGGTCCCACCTGGCTGG - Intergenic
1134951184 16:18351717-18351739 GGGCCCAGGTCCCACCTGGCTGG + Intergenic
1134959124 16:18395198-18395220 GGGCCCAGGTCCCACCTGGCTGG + Intergenic
1136594913 16:31241574-31241596 GGACCCAGGTCCCACCCTGATGG - Intergenic
1136654908 16:31703841-31703863 GGGCCCTGGAGCACCCCTTCAGG + Intergenic
1137988939 16:53131954-53131976 GAGCCCTGGAGCCATCCCGCAGG - Intronic
1138166299 16:54804815-54804837 GGGCCCTGGGGCCAGACTGCTGG + Intergenic
1138180676 16:54938370-54938392 TGTCCCTAGACCCACCCCGCGGG + Intergenic
1138263009 16:55639100-55639122 AGGCCCTGGAGCCACCCAGGAGG - Intergenic
1138506442 16:57480529-57480551 GGGCCCGGGCCCCACCCTCACGG - Intronic
1138557948 16:57783889-57783911 GGGTCCAGGGCCCACCCTGAAGG - Intronic
1139333296 16:66210955-66210977 GGGCCCAGGACCCATCCTCAAGG - Intergenic
1139653043 16:68372115-68372137 GGGCCCAGGACACACAGTGCAGG + Exonic
1139801900 16:69529735-69529757 GGGCCTTGGCCCCACCCACCTGG + Intergenic
1140525040 16:75615727-75615749 GGTCTATGGACCCACACTGCTGG + Intronic
1141482022 16:84313146-84313168 GGGCCCAGGACCTACCTGGCGGG - Exonic
1141490129 16:84367329-84367351 GGGCACTGGAACTGCCCTGCAGG + Intergenic
1141550311 16:84802570-84802592 GGGCTCTGGACTCACCCTATGGG - Intergenic
1141594591 16:85089516-85089538 AGGCTCTGGACCCAGCATGCAGG - Exonic
1141656865 16:85421274-85421296 GGGCCCTGGCCCCAGATTGCAGG + Intergenic
1141715119 16:85722577-85722599 GGGCCCTGGGCCCACTCAGCGGG - Intronic
1141757128 16:85998658-85998680 GGGGCCTGGGCTCACCCTGCAGG - Intergenic
1141760749 16:86026931-86026953 TTGCCCTGGGACCACCCTGCTGG + Intergenic
1141952188 16:87346247-87346269 AGGCCCTGGCCCCGGCCTGCGGG - Intronic
1142363248 16:89637064-89637086 GGGCTCAGCACCCACCCTGGGGG - Intronic
1143106535 17:4533137-4533159 CAGCCCTGGGCCCACCCCGCGGG - Intronic
1144947414 17:18977004-18977026 GGGCACTGAACCCAGGCTGCAGG + Intronic
1145007206 17:19344553-19344575 GGCTGCTGGACCCACCCGGCCGG - Intronic
1146283912 17:31561621-31561643 CTGCCCTGCACCCACCCTGGAGG + Intergenic
1146799664 17:35808622-35808644 CGGCCTTGGGCCCACCCCGCTGG + Intronic
1146812893 17:35917875-35917897 GGGCCCTGGACCCACTCCAGAGG + Intergenic
1146970104 17:37065611-37065633 GGGCCTTCCACCCAGCCTGCTGG - Intergenic
1147166071 17:38594109-38594131 TGCCCCTGAGCCCACCCTGCAGG + Intronic
1147767281 17:42845363-42845385 GGGCCCTGGACCCTGCCCACTGG + Exonic
1148062860 17:44848590-44848612 GGGCCCTTGAGCCACACTGCTGG - Intronic
1148239141 17:45988484-45988506 GGGCCCTGGAACCAGGATGCAGG - Intronic
1148443512 17:47724287-47724309 GGGCCCTGGACCCACGTCTCTGG - Intergenic
1151320394 17:73349160-73349182 GGGCCCCGGAGCCAGCCTGGCGG + Intronic
1152037123 17:77880367-77880389 AGGCCCTGAACCTGCCCTGCTGG - Intergenic
1152335664 17:79699204-79699226 CAGCCCTGGACCCACCCCACTGG + Intergenic
1152631844 17:81414013-81414035 TGGCCCTGGACCTGGCCTGCTGG + Intronic
1152636489 17:81432613-81432635 CAGCCCTGGACCCACCCTCCCGG + Intronic
1152829679 17:82489446-82489468 GCCCCCTGCACCCACCCAGCTGG - Exonic
1152900572 17:82938671-82938693 GAGCCCCGGGCCCACCCTGGAGG - Intronic
1152962350 18:87373-87395 GGGCCCAGGCCCCATCCTGCAGG + Intergenic
1153636322 18:7117048-7117070 GTGCCCTGGACGCCGCCTGCGGG + Intronic
1154199635 18:12290278-12290300 GGGCCCTGATGCAACCCTGCAGG - Intergenic
1154490679 18:14919738-14919760 GCCCACTGGCCCCACCCTGCTGG + Intergenic
1155058473 18:22206317-22206339 GTGCTCTGGAGCCACACTGCAGG - Intergenic
1157202547 18:45671605-45671627 GGGCTCTGGCCTCACCATGCAGG - Intronic
1157339973 18:46769897-46769919 GGGCTCTGGAATCACACTGCTGG + Intergenic
1157464140 18:47930360-47930382 GGGACCTGGCGCCACCTTGCAGG - Exonic
1158129402 18:54136212-54136234 GGACCCTGGCACCACACTGCTGG + Intergenic
1159040563 18:63319999-63320021 GGGCTCCGGGCCCTCCCTGCCGG - Exonic
1159619415 18:70620168-70620190 GGTCCACAGACCCACCCTGCTGG - Intergenic
1160007315 18:75076861-75076883 GGGCCCTGGAGCCTGGCTGCTGG - Intergenic
1160346701 18:78138083-78138105 GGGCCCTGGACACACCATCATGG - Intergenic
1160707648 19:536910-536932 GACGCCTGGACCCACCCAGCAGG - Intronic
1160716891 19:580804-580826 GGGTCCTGGACCCAGCCCTCAGG + Intronic
1160731668 19:644083-644105 GGGCCCTGGACCCCCCACCCTGG - Intergenic
1160777599 19:863085-863107 GGCCCCCGGAGTCACCCTGCCGG - Exonic
1160890290 19:1374094-1374116 GACACCTGGACCCAGCCTGCTGG + Intronic
1161055994 19:2190870-2190892 GAGCCCGGCAGCCACCCTGCAGG + Intronic
1161216049 19:3095492-3095514 AGGCCCTGTACCCTCCATGCAGG + Intronic
1161358315 19:3831943-3831965 GGGCCCTGGACTCAACTGGCTGG + Intronic
1162922832 19:13913511-13913533 CAGCCCTGCACCCACCCAGCCGG + Exonic
1163023445 19:14495938-14495960 CGGCGCCGGCCCCACCCTGCAGG + Intronic
1163689723 19:18731936-18731958 GAGCCCAGGACTCTCCCTGCAGG - Intronic
1165109467 19:33493461-33493483 GGGCGCTGCCCTCACCCTGCAGG + Intronic
1165149146 19:33750787-33750809 GGGCCCTGGGCCAAGCCTCCTGG + Intronic
1165851615 19:38852846-38852868 GGGGACTGGAGCCACCCTACCGG + Intergenic
1165990875 19:39812696-39812718 GGGCCCCCCACCCACCCTGGGGG + Intergenic
1167119570 19:47508417-47508439 GGGCTCAGGCCCCGCCCTGCAGG - Intronic
1167516055 19:49923820-49923842 GGGCCCTAGAGCCAGCCTGCTGG - Intronic
1168484327 19:56748120-56748142 GGGCCCTGGACTCCCTCTTCTGG + Intergenic
1168650107 19:58087181-58087203 AGGCCCAGAACCCACCCTGGTGG - Intronic
1168691545 19:58380647-58380669 AGGCCCGGGACCCATCCTGGCGG - Intronic
925030645 2:648026-648048 TGGGCCTGGACCCACCCTCAGGG - Intergenic
925164120 2:1705201-1705223 GGGCCCTGGGCCTCCCCTGAGGG + Intronic
926161993 2:10495782-10495804 GTGCCCCGGCCCCATCCTGCAGG + Intergenic
928082871 2:28326060-28326082 GGGGCCTGGACCCACATTCCAGG + Intronic
928322719 2:30296150-30296172 GAGCCCCCGGCCCACCCTGCAGG + Intronic
929943483 2:46352753-46352775 GGTCCCTGGGGCCAACCTGCTGG + Intronic
930111879 2:47685637-47685659 TGGCTCAGGACTCACCCTGCAGG - Intergenic
931006051 2:57850613-57850635 GGGCCCTGGGCCCAGCCGTCAGG + Intergenic
932246675 2:70202408-70202430 GGTCCCTGGGCCCACCCTTGGGG - Intronic
932494568 2:72140037-72140059 TGGCCCTGGGCCCCCCATGCTGG - Intronic
932593645 2:73081240-73081262 GGCCTCTGGACGCAGCCTGCTGG + Intronic
932703536 2:74006491-74006513 GGGCCCTGGACCTGCCCTCAGGG + Intronic
933167653 2:79093735-79093757 GGGCCCTCCACACACCCTACAGG - Intergenic
934527004 2:95058262-95058284 GGGCCCGGGAGCCACTCTGCTGG - Intergenic
934753487 2:96809530-96809552 GGGCCCCCTGCCCACCCTGCGGG + Exonic
936085201 2:109462766-109462788 TGGCCCTGAACCCATCCTGTGGG - Intronic
937087693 2:119182198-119182220 GGGCTCTGGACTCAGCCTCCAGG + Intergenic
937220014 2:120337327-120337349 GGGGGCTGGAGCCACCCTGGAGG - Intergenic
937224497 2:120360406-120360428 GGGCCCGGGACAGACCCTGCAGG - Intergenic
937284974 2:120744864-120744886 GATTCCTGGACCCACTCTGCAGG - Intronic
937308475 2:120886763-120886785 GGGCCCTGGGTCCACCCACCAGG - Intronic
937559514 2:123205218-123205240 GGGCACTGGGCTCACCCTTCAGG + Intergenic
937980018 2:127609303-127609325 GGGCTCTCTACACACCCTGCCGG - Intronic
942814266 2:180033742-180033764 AGGCCTTGGACTCACCCTTCAGG + Intergenic
944788035 2:203093888-203093910 GGGACCTGGGCCTTCCCTGCTGG + Intronic
946361973 2:219224375-219224397 GGGCCCTGGGAGCACGCTGCTGG - Exonic
947080378 2:226389316-226389338 TGGCCCTTTACCCACCCTTCAGG + Intergenic
947932272 2:233973881-233973903 GAGCCCTGGAGCCACGGTGCGGG + Intronic
948553378 2:238790992-238791014 GGGCCCTGGTCTCTCCCAGCTGG + Intergenic
948635433 2:239331634-239331656 CTGCACTGGACCCACCGTGCGGG + Intronic
948883227 2:240870791-240870813 CGGCCATGATCCCACCCTGCTGG - Intronic
949035609 2:241814574-241814596 GCCCCCCGGGCCCACCCTGCTGG + Exonic
1168954928 20:1828133-1828155 AGGCCCTGGCCCCATCTTGCCGG + Intergenic
1169486969 20:6042017-6042039 GGGCCTTGGAGACACTCTGCTGG + Exonic
1170140127 20:13117598-13117620 GGGCCGTGGGCCCAACCGGCCGG + Exonic
1170155725 20:13267503-13267525 GAGCCCTGTACCCTCCCCGCAGG - Intronic
1171202858 20:23255921-23255943 GTGGCCTGGGGCCACCCTGCAGG + Intergenic
1171484167 20:25475782-25475804 GGGTCCTGAACCCACCTTCCGGG - Intronic
1172306857 20:33886868-33886890 GGGCCATGTACACAGCCTGCAGG + Intergenic
1172406700 20:34695056-34695078 GGGCACTGGAGCCAGGCTGCAGG + Intergenic
1172649635 20:36493584-36493606 GGGCCCTGGGACCAGTCTGCAGG - Intronic
1174040133 20:47693787-47693809 GAGCCCCTGACCCACCCTCCTGG - Intronic
1174168694 20:48603349-48603371 GGGCCCTGTTCCCACCCTCAGGG - Intergenic
1174823568 20:53748276-53748298 GTGCTCTGGTCACACCCTGCAGG + Intergenic
1175162937 20:57022214-57022236 GGGCTCTGGACCCAACTTCCCGG - Intergenic
1175722522 20:61295831-61295853 GACCCCAGGACACACCCTGCTGG - Intronic
1176132693 20:63502958-63502980 GAGCCCAGCACCCACCCTGGTGG + Intergenic
1176362166 21:6006696-6006718 GGCTCCTGGACCCTCCCTGAGGG + Intergenic
1176383871 21:6127401-6127423 GGTCCCTGGGCCCAGCCTGGAGG + Intergenic
1176868572 21:14070439-14070461 GGGCCCTGGGCCCACGGTCCTGG - Intergenic
1179302717 21:40126984-40127006 GGGCCCTGGAGCCTCACTGCTGG + Intronic
1179642748 21:42758013-42758035 GGGCACTGGGCCATCCCTGCTGG - Intronic
1179739602 21:43410837-43410859 GGTCCCTGGGCCCAGCCTGGAGG - Intergenic
1179761352 21:43531849-43531871 GGCTCCTGGACCCTCCCTGAGGG - Intronic
1179899302 21:44380741-44380763 GGGCCCGGGGACCTCCCTGCAGG + Intronic
1179991853 21:44952481-44952503 GGGCCCTGGGGCCAACCTTCTGG - Intronic
1180037486 21:45257268-45257290 GGGCTCTGCTCCCACCCGGCAGG - Intergenic
1180921151 22:19522338-19522360 AGAGCCTGTACCCACCCTGCTGG - Intergenic
1181050271 22:20235067-20235089 GGGGGCTGCCCCCACCCTGCCGG + Intergenic
1181064393 22:20298872-20298894 GGGCTCCGGACCCACCTGGCTGG + Intergenic
1181287033 22:21759864-21759886 AGGCCTTGGACCCATCCAGCTGG - Exonic
1181549337 22:23628015-23628037 GGCCCCTCTACCCACCCTGTGGG + Intronic
1181599555 22:23941393-23941415 GGGCCCTGGACTCAATCTGGGGG + Intergenic
1181646738 22:24235423-24235445 GGTCCCTGCACCCACCCCGTGGG + Intronic
1181915902 22:26279626-26279648 GTGCCCTGGCCCCATCCTGATGG - Intronic
1182469570 22:30539866-30539888 TGGCCCTGGGCCCACCCTGCAGG + Intronic
1182752629 22:32654053-32654075 GGGCCCAGTACCCACACTGGGGG + Intronic
1183440103 22:37818226-37818248 GGGCTCTGGCCCAGCCCTGCAGG + Intergenic
1183582764 22:38735581-38735603 GGGCCCAGGGCCAACCCTGTAGG - Exonic
1183742538 22:39676918-39676940 GGACCCTGGGGCCAGCCTGCTGG + Intronic
1183753399 22:39735908-39735930 GGCCTATGGTCCCACCCTGCGGG - Intergenic
1184121370 22:42452675-42452697 AGGGCCTGGAGCCAGCCTGCTGG + Intergenic
1184479765 22:44739382-44739404 AGGCCCAGCACCCACCCTCCTGG - Intronic
1184837470 22:47032405-47032427 AGGCCCTGGACCCAGTCTGGGGG - Intronic
949186248 3:1195281-1195303 GGGGGCAGGACCCACCATGCAGG - Intronic
954106156 3:48410795-48410817 TGGCCCCGGACCAACTCTGCAGG - Intronic
954327892 3:49873481-49873503 GGGCCCTGGTGCCACTGTGCTGG - Intergenic
954809357 3:53238620-53238642 GGGCCCTTCTCACACCCTGCGGG + Intronic
955352352 3:58203193-58203215 GGGCCCTGGATGCAGCCTGCTGG - Intronic
955475036 3:59327754-59327776 GGTCCCTGGACCCGCACTGTTGG + Intergenic
957126247 3:76164937-76164959 TGGCCATGGACCCAGCCTCCTGG + Intronic
957965866 3:87321901-87321923 GGGCCTGGGACCCACCCTTCAGG - Intergenic
961514867 3:127426253-127426275 TGCTCCTGGAGCCACCCTGCTGG - Intergenic
965481965 3:169229617-169229639 TGGCCCTGGTCCCCTCCTGCAGG + Intronic
966452092 3:180074191-180074213 TGGCCTGGGACCCACCCTTCCGG - Intergenic
966883703 3:184363052-184363074 GGGCCCTAGCCCTACCCCGCCGG - Intronic
966933717 3:184691957-184691979 GGGCCCTGCACCCTGCCCGCCGG - Intergenic
967306131 3:188061311-188061333 GGCCCATTGACCCCCCCTGCTGG + Intergenic
967877194 3:194275588-194275610 GGTCCCTGGACTCCCCTTGCTGG - Intergenic
968521600 4:1036902-1036924 GGTCCCTGCACCCCCCCTGCTGG + Intergenic
968596862 4:1490233-1490255 GGGCCCTGGACCTGCCGGGCTGG + Intergenic
968616501 4:1579814-1579836 GGCCCCTGCGCCCTCCCTGCGGG - Intergenic
968725870 4:2247604-2247626 TGGACCTGGGGCCACCCTGCTGG + Exonic
969527928 4:7713476-7713498 GGTCCCTGTACCCACCGTGATGG - Intronic
969618972 4:8269609-8269631 CGGGCCTGGACCCACCCGGCAGG - Intergenic
970435882 4:16034824-16034846 GGGACCTGGAAGCCCCCTGCTGG - Intronic
972456960 4:39264237-39264259 AGGCTCTGGAGCCAGCCTGCTGG - Intronic
973852810 4:54977704-54977726 AGGCCTGGGACTCACCCTGCAGG - Intergenic
973907589 4:55546749-55546771 AGGCCCTGGGCCCACCGGGCGGG + Intronic
974456083 4:62130773-62130795 TGGTCCTGGGCCCACACTGCAGG + Intergenic
974593226 4:63983210-63983232 AGGCCTTGGACTCACCCTTCAGG + Intergenic
975880301 4:78898209-78898231 AGACCCTAGACCCACCCTGTGGG + Intronic
975920492 4:79380457-79380479 GGGGACTGCACCCACTCTGCTGG + Intergenic
976218775 4:82739452-82739474 GGGTGCTGCACCCACACTGCTGG - Intronic
976273519 4:83252980-83253002 GGGCGCTGGAGGGACCCTGCAGG - Intergenic
981390966 4:144191102-144191124 GGGTCCTGGTGCCACCCTTCGGG + Intergenic
982468434 4:155759238-155759260 GGGCCCTGGGCGCTCACTGCCGG + Intronic
985493005 5:190095-190117 GGGCCCTGACCCCACCCTTCAGG - Intergenic
985541415 5:489258-489280 GGTCCCTGGACCCTCACGGCCGG - Intronic
985604263 5:850097-850119 TGGCGCAGGACCCGCCCTGCTGG - Intronic
986939691 5:12935703-12935725 GGTCCCTGGGCCCACCCTTCGGG - Intergenic
990545406 5:56816224-56816246 GCGCCCCGGACCCAGCCTGGGGG + Intronic
992077590 5:73205523-73205545 GGGCCCAGGCCCCACTCTACAGG + Intergenic
998382529 5:141735873-141735895 AGGACCTGGGCCCACACTGCTGG - Intergenic
999002502 5:147939626-147939648 TGGCCTGGGACTCACCCTGCAGG + Intergenic
999736654 5:154517988-154518010 GGGCTCTGGGCTCACCCTGCTGG + Intergenic
1001400007 5:171440805-171440827 GGGCTCTGTACCCAGCCTGGGGG - Intronic
1001575199 5:172758694-172758716 GGACCCAGGACCCACCCAGGAGG + Intergenic
1001732674 5:173972008-173972030 GGGACCTGGCCCAACCCTGAAGG - Intergenic
1002067831 5:176661093-176661115 AGACCCTGGGCCCACCCCGCTGG + Intergenic
1002106163 5:176880330-176880352 GGGCCCTGCTCCAAGCCTGCAGG + Exonic
1003548078 6:7077888-7077910 GGGTCCTGGAACCAGTCTGCTGG + Intergenic
1005882381 6:30071308-30071330 GGCACCCGAACCCACCCTGCTGG - Exonic
1006142829 6:31941030-31941052 AGGCCCTGGACCCACACAACAGG - Intronic
1007630675 6:43271598-43271620 GGGCCCTGGCCCCTGCCTGGGGG + Intronic
1007951400 6:45875760-45875782 GGACTCTAGAGCCACCCTGCTGG - Intergenic
1011734294 6:90296465-90296487 GGGCCCGGGACTCACCTCGCCGG + Exonic
1012488111 6:99744841-99744863 GGTCCCTGGTCCCACCCTTGAGG + Intergenic
1013018048 6:106179127-106179149 GGTCTCTGGACCCATTCTGCTGG + Intergenic
1013576109 6:111484111-111484133 GTGCCCGGGACGCAGCCTGCGGG - Intergenic
1013638934 6:112054328-112054350 GGACCGTGGAGCCACCCTGAGGG - Exonic
1017326890 6:153150669-153150691 GGGCTCTGGGCCCACCCTTGGGG - Intergenic
1017897198 6:158690948-158690970 GGTTCCTGGACCCACGCTCCAGG + Intronic
1017914289 6:158819397-158819419 GGTCCCGGGACCCGCCCCGCCGG - Exonic
1018126824 6:160690547-160690569 AGGCCCTGGCCCCACCTGGCTGG - Intergenic
1018149728 6:160926545-160926567 GGTCCCTGGCCCCACCTGGCTGG + Intergenic
1018820509 6:167370213-167370235 GGGCCCGGCAGCCACCTTGCAGG - Intronic
1019151039 6:170006090-170006112 GAGGCCAGGACCCACCCTGTGGG + Intergenic
1019285447 7:220884-220906 GTGCCCTGGGCCCACCATCCGGG - Intronic
1019337239 7:491229-491251 AGGCCCTAGACCCAGGCTGCAGG - Intergenic
1019357887 7:590460-590482 GGGCCCCGCCCCCACCCTGCTGG - Intronic
1019379012 7:711866-711888 AGGCCCTGGAACCCCCCGGCTGG - Intronic
1019430709 7:997669-997691 GGGCTCTGATCCCCCCCTGCCGG - Exonic
1019731690 7:2632517-2632539 GGGCCGTGGACCCTCACTGGGGG - Intronic
1020109340 7:5439538-5439560 GGGCCCTGTACCCACACCCCAGG + Intronic
1020760361 7:12261435-12261457 TCACCCTGGACACACCCTGCCGG - Intergenic
1022293961 7:29032307-29032329 GAGCCCTGGGCCCCCACTGCAGG + Intronic
1022982087 7:35613263-35613285 GGGCCCTGGAGCCACCCTCAGGG + Intergenic
1023833118 7:44051758-44051780 TGGCCCTGGTCCCACCATGAAGG - Intronic
1023996051 7:45159437-45159459 GAGGCCTGCACCCTCCCTGCTGG - Intronic
1026982581 7:74535556-74535578 GGGCTCTGGAGTCACACTGCTGG - Intronic
1029312267 7:99678276-99678298 GGGTCCTGGCCCCACCGTGGAGG - Intronic
1029529922 7:101118540-101118562 GTGGCCTGGAGGCACCCTGCAGG + Intergenic
1029542487 7:101192377-101192399 GGGCCCTGGACCAGCCTGGCAGG + Intergenic
1032388782 7:131542274-131542296 GGCCTCTGCACCCACCTTGCAGG - Intronic
1033613051 7:142984414-142984436 TGGCCATGGAGCCACCCAGCTGG + Intergenic
1034275361 7:149821569-149821591 GGGGGCTGGAACCGCCCTGCTGG + Intergenic
1035391854 7:158509413-158509435 AAGCCATGCACCCACCCTGCAGG + Intronic
1035563971 8:628965-628987 GGGCCCGGCACCCACCAAGCTGG + Intronic
1037835624 8:22213308-22213330 GGGCCCTGGGGCCACACTGGTGG - Intergenic
1037896478 8:22659673-22659695 GGGCCCTGGAGCCAGACAGCTGG + Intronic
1039626671 8:39061341-39061363 GGTCCCTGAACCCACCTTGTGGG - Intronic
1040600932 8:48883305-48883327 GGGTCCTGCACACTCCCTGCTGG + Intergenic
1042872686 8:73412565-73412587 GGGCACTGGAGCCAGCCTGGGGG + Intergenic
1045231960 8:100314447-100314469 GAGCTCTGGAGCCAGCCTGCCGG - Intronic
1048209648 8:132444085-132444107 GGACCCTGGAACCAGACTGCTGG - Intronic
1049202011 8:141344964-141344986 AGGCCCAGAACCCACCCTGCTGG + Intergenic
1049273109 8:141706572-141706594 GGACCCCTAACCCACCCTGCTGG - Intergenic
1049378787 8:142301803-142301825 AGGCCCTGGCTCCTCCCTGCAGG - Intronic
1049632806 8:143667944-143667966 GGGCACTGGAGGGACCCTGCAGG + Intergenic
1049888741 9:47498-47520 GGCCTCTGGACCCATCCTGGAGG + Intergenic
1053018029 9:34675216-34675238 AGGCACTGGACGCCCCCTGCAGG - Intergenic
1056550276 9:87647298-87647320 CGGCATTGGACCCGCCCTGCAGG - Exonic
1056793140 9:89639185-89639207 GGCCCCAGGAGCCACACTGCGGG - Intergenic
1057147130 9:92765502-92765524 GGCCCCTGGGCGCCCCCTGCTGG - Intergenic
1057878039 9:98772586-98772608 GGGCCCTGGCCCCCCACTGTGGG + Intronic
1058780195 9:108325473-108325495 TGGCCTTGGACTCACCCTTCAGG - Intergenic
1060295701 9:122341453-122341475 TGGCCCTGTACGGACCCTGCTGG - Intergenic
1060821027 9:126661685-126661707 GGGCCCCGCAGCCACACTGCAGG - Intronic
1061012242 9:127962503-127962525 GGACCCTGGGCCCTCCCTCCAGG - Intronic
1061095792 9:128456267-128456289 GGGCGCTGGATCCCGCCTGCCGG - Intronic
1061499152 9:130992287-130992309 GGGGCCTGGCACGACCCTGCAGG - Intergenic
1062383595 9:136299351-136299373 CCGACCTGGACCCACCCGGCCGG + Intronic
1062589250 9:137266086-137266108 GGGCCCTGTGGCCGCCCTGCTGG + Intronic
1062625901 9:137441458-137441480 GGGCGCTGGCCTCAGCCTGCGGG - Intronic
1062735791 9:138136744-138136766 GGGCCCAGGCCCCATCCTGCAGG - Intergenic
1203731796 Un_GL000216v2:98543-98565 GGTCCCTGGAGCCCCCCTGACGG - Intergenic
1185750705 X:2608452-2608474 GGGCCCCTGACGCAGCCTGCTGG + Intergenic
1185757261 X:2661697-2661719 GGCCATTGGACCCTCCCTGCAGG - Intergenic
1185852051 X:3498379-3498401 CCGCCCTGGACTCACCCTACTGG - Intergenic
1187488997 X:19732340-19732362 GGGTCCTGGAACCAATCTGCCGG - Intronic
1187844953 X:23525330-23525352 TGGCCTGGGACCCACCCTTCAGG - Intergenic
1190464012 X:50707929-50707951 GGGCCCTGGACCCACCCTGCAGG + Intronic
1191184145 X:57592249-57592271 GGGCCCTGGCCCAAGCCTGTTGG + Exonic
1191198642 X:57752582-57752604 CTGCCTTGGACCCACCCTTCAGG - Intergenic
1192218058 X:69177692-69177714 GGACCCTGGGCCCACTCTGTAGG + Intergenic
1195014623 X:100766195-100766217 TGGCCTTGGACTCACCCTTCAGG + Intergenic
1196582010 X:117390871-117390893 GGGGCCTCTAGCCACCCTGCTGG + Intergenic
1196858216 X:120003009-120003031 GGACCCTGGAGCCAGACTGCTGG + Intergenic
1196860031 X:120017877-120017899 GGACCCTGGAGCCAGACTGCTGG + Intergenic
1200023595 X:153234370-153234392 GGACTCTGGAACCACACTGCTGG - Intergenic
1200110477 X:153738246-153738268 AGGCCCAGGCCCCACCCTTCAGG + Intronic
1200277838 X:154751096-154751118 GGGCGCTGGGCCCGCCCCGCCGG - Intronic
1200398008 X:156002535-156002557 GGGCCCAGGCCCCATCCTGCAGG - Intronic
1202367743 Y:24178553-24178575 GGGCCCTGAACTCAGCCTGGAGG - Intergenic
1202377091 Y:24247359-24247381 GGGCCCTGAACTCAGCCTGGAGG + Intergenic
1202493689 Y:25422762-25422784 GGGCCCTGAACTCAGCCTGGAGG - Intergenic
1202503040 Y:25491570-25491592 GGGCCCTGAACTCAGCCTGGAGG + Intergenic