ID: 1190465578

View in Genome Browser
Species Human (GRCh38)
Location X:50722418-50722440
Sequence GCACTCAGTAGATTTTCCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 106}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190465575_1190465578 21 Left 1190465575 X:50722374-50722396 CCTGACTCTCAGGCCAGCTTCAG 0: 1
1: 0
2: 3
3: 32
4: 239
Right 1190465578 X:50722418-50722440 GCACTCAGTAGATTTTCCTCTGG 0: 1
1: 0
2: 1
3: 14
4: 106
1190465574_1190465578 22 Left 1190465574 X:50722373-50722395 CCCTGACTCTCAGGCCAGCTTCA 0: 1
1: 0
2: 4
3: 30
4: 259
Right 1190465578 X:50722418-50722440 GCACTCAGTAGATTTTCCTCTGG 0: 1
1: 0
2: 1
3: 14
4: 106
1190465576_1190465578 8 Left 1190465576 X:50722387-50722409 CCAGCTTCAGTCCTTGACTTGTT 0: 1
1: 0
2: 1
3: 21
4: 232
Right 1190465578 X:50722418-50722440 GCACTCAGTAGATTTTCCTCTGG 0: 1
1: 0
2: 1
3: 14
4: 106
1190465577_1190465578 -3 Left 1190465577 X:50722398-50722420 CCTTGACTTGTTTGCATTTAGCA 0: 1
1: 0
2: 4
3: 20
4: 182
Right 1190465578 X:50722418-50722440 GCACTCAGTAGATTTTCCTCTGG 0: 1
1: 0
2: 1
3: 14
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190465578 Original CRISPR GCACTCAGTAGATTTTCCTC TGG Intronic
900665835 1:3814954-3814976 ACACGCAGTAGAATTTCCGCAGG - Exonic
901908811 1:12437621-12437643 CCAATGAGTAGATTTTTCTCTGG + Intronic
907526436 1:55056661-55056683 ACACTCTGTGGATGTTCCTCGGG - Intronic
907933187 1:59018981-59019003 GAACTAAGTAGAGTTTCCTTTGG + Intergenic
908398163 1:63745364-63745386 TCACTGATGAGATTTTCCTCTGG - Intergenic
910363730 1:86441490-86441512 GCTTTCAGTAGAATTTCCTCTGG + Exonic
910996612 1:93111611-93111633 GAACTAAGTAGCTTTTACTCTGG + Intronic
911459372 1:98170229-98170251 GTACTCAGTTGCTTTTCCTGTGG + Intergenic
911502270 1:98702787-98702809 GCACTCAGTAGAAGTTCGTTAGG - Intronic
913270813 1:117091538-117091560 GCAATCAGTAGATTTTACTCTGG - Intronic
914395893 1:147268162-147268184 GACCTCAGTAAATTTTCCCCTGG + Intronic
915391872 1:155551257-155551279 GCACACAGTATCTTTTCCTCGGG + Intronic
917780733 1:178393372-178393394 TCACGCAGTAGATTCTCATCAGG + Intronic
918346233 1:183609675-183609697 GCCCTCTGGAGATTTTCATCCGG - Intergenic
919764750 1:201119564-201119586 AAACTCAGTAGCTTTTCCTAAGG - Intronic
1064092913 10:12400258-12400280 GCACTCAGAAGACTTTCCAATGG - Intronic
1064937910 10:20699756-20699778 GTATTTAGTAGAATTTCCTCTGG - Intergenic
1075995184 10:126871351-126871373 GCACTCAGCAGATTTTCTGTGGG + Intergenic
1084064806 11:66697720-66697742 GCACTCATCAGATTCTGCTCTGG + Intronic
1085301251 11:75460026-75460048 CCAGGCAGTAGATTTTCCCCTGG - Intronic
1086820338 11:91428701-91428723 GCACTGCCTAGATTTTCTTCCGG + Intergenic
1088846932 11:113676129-113676151 GAAGTCAGTAAATTATCCTCGGG - Intergenic
1089736824 11:120555498-120555520 TCACTCAGTAAAATTTGCTCTGG + Intronic
1093307863 12:17541801-17541823 GCACACAGATGATTTTCCTTTGG + Intergenic
1093415037 12:18909895-18909917 GAGCTCAGTAGATTTTCTTGAGG - Intergenic
1096155354 12:49338680-49338702 GCAGCCAGTAGCTTTTTCTCTGG - Intergenic
1104142164 12:125998670-125998692 GGACTCAGAAGATTTAGCTCTGG + Intergenic
1106403757 13:29455315-29455337 GCACTGAGTGGAGGTTCCTCTGG + Intronic
1111337718 13:86844975-86844997 GCTCTCAGTAGCTATTCCTGTGG - Intergenic
1117581127 14:57152800-57152822 GCACTCATTAGATTCTCATAAGG - Intergenic
1117592714 14:57290639-57290661 GGACACCCTAGATTTTCCTCCGG - Exonic
1126670455 15:51110920-51110942 GCACTCAGTACATTTCCCCAGGG - Intergenic
1129279870 15:74476043-74476065 GCTCTCAGTGTATTTGCCTCTGG - Intergenic
1130272850 15:82461346-82461368 CCACTCAGTAGAATTTCTGCTGG - Intergenic
1130465200 15:84188699-84188721 TCACTCAGTAGAATTTCTGCTGG - Intergenic
1130487488 15:84406103-84406125 TCACTCAGTAGAATTTCTGCTGG + Intergenic
1130499065 15:84484837-84484859 TCACTCAGTAGAATTTCTGCTGG + Intergenic
1130587491 15:85193312-85193334 CCACTCAGTAGAATTTCTGCTGG - Intergenic
1131748771 15:95482118-95482140 GAAATCAATAGATTTTACTCAGG - Intergenic
1140982253 16:80122066-80122088 GCACTCAATAGAATTCCCTTAGG + Intergenic
1141480983 16:84306805-84306827 GTACTCAGTAAATATTCTTCGGG - Intronic
1144264730 17:13556935-13556957 GCACCCAGCAGAATATCCTCAGG + Intronic
1146966579 17:37036339-37036361 GAACTCAGTAAATTTGCCCCTGG + Intronic
1150432491 17:65129468-65129490 GCAATTAGTACATTTTCCTGAGG + Intergenic
1150808920 17:68341068-68341090 TCACTCAGTAGCTGTTCCACTGG - Intronic
1156246765 18:35307861-35307883 GCATTCATTAGATTTTTTTCTGG - Intergenic
1156953194 18:42930167-42930189 GAACTCAGGAGATTTTTGTCAGG + Intronic
1158138241 18:54228943-54228965 GGACTGAGTGGATTTTCCTTAGG - Intergenic
1164000108 19:21090585-21090607 GCACACAGATGATTTTCCTTTGG + Intronic
1164006318 19:21152786-21152808 GCACACAGATGATTTTCCTTTGG + Intronic
1164753903 19:30675652-30675674 GCACTCATTACCTTTGCCTCTGG - Intronic
1164996807 19:32726538-32726560 TCACTCAGTATAATGTCCTCAGG + Intronic
1165164479 19:33841905-33841927 GCACACAGTAAAGTTCCCTCTGG - Intergenic
1166327027 19:42057305-42057327 GCACTTAGAAGATTTCCTTCTGG + Intronic
1167982463 19:53286384-53286406 GAATTCAGGAGAGTTTCCTCAGG - Intergenic
1168622748 19:57892269-57892291 GCACACAGATGATTTTCCTCTGG - Intronic
927235261 2:20867885-20867907 GCACACAGCAGATTCTCCTTTGG + Intergenic
927935518 2:27073788-27073810 GGACTCAGTAGGTTGTCCTAGGG + Intergenic
929625486 2:43402619-43402641 GTACTCAGTAGATGTCCCTACGG - Intronic
930856075 2:56020049-56020071 ACGCTTAGTAGAATTTCCTCTGG - Intergenic
933228569 2:79779422-79779444 GCAGGCAGTAGATTCACCTCAGG - Intronic
935271354 2:101436872-101436894 GCACACAGTTGCTTTTCCTCTGG - Intronic
937878806 2:126849871-126849893 GCACTCAGGTGGTTTTCCTGGGG - Intergenic
939035081 2:137121311-137121333 GCACTGAGTAGAGGTTGCTCTGG + Intronic
939843913 2:147220831-147220853 GCATGCAGATGATTTTCCTCTGG + Intergenic
941716455 2:168768553-168768575 CTAGTCAGTGGATTTTCCTCAGG + Intronic
941913004 2:170784234-170784256 TCACTCAGTAGTATTTCCCCAGG + Intronic
943532457 2:189100464-189100486 TCTTTCAGTAGTTTTTCCTCTGG - Intronic
947228661 2:227863784-227863806 GCACACAGCAGACTGTCCTCTGG + Intergenic
947680619 2:232028819-232028841 TAACACAGTAGCTTTTCCTCAGG + Intronic
1170235027 20:14093702-14093724 GCACTCAATACATTTTCCTGGGG - Intronic
1170279961 20:14635009-14635031 GCACTCAATAAATATTCATCAGG - Intronic
1173831589 20:46092287-46092309 TCACTCAGTGGATCTTCCACTGG - Intergenic
1179290017 21:40010209-40010231 CCACTCAGTAGAGGTCCCTCTGG - Intergenic
1179493988 21:41760152-41760174 GCACTCACTTGATTTACATCGGG - Intronic
951810257 3:26690577-26690599 GCTCTGAGTTGATTTTCCTCTGG - Intronic
952356148 3:32586321-32586343 TCTCTCAGTAGATTTTCTTGTGG + Intergenic
956625576 3:71263240-71263262 GCTCTCAGTAGGTATTCCACAGG - Intronic
958038227 3:88194795-88194817 GCACTCAGTAATTTTTTTTCAGG - Intergenic
963155877 3:142096473-142096495 ATACTCAGCATATTTTCCTCAGG - Intronic
964823633 3:160801650-160801672 GCACTCTCTTGATTTTACTCAGG + Intronic
968532602 4:1101662-1101684 ACACTCAGTAGAGGTTTCTCAGG - Intronic
973320706 4:48807672-48807694 GCTCTCAGTTGATTTTGCTTGGG - Intronic
974809240 4:66924167-66924189 GCACTGAGTAGATTTTTCTGAGG - Intergenic
979549271 4:121972204-121972226 GCTCTCACAAGATTGTCCTCAGG - Intergenic
984952887 4:185019809-185019831 GCACTCCGCTGATTTTCCCCGGG + Exonic
985420963 4:189784935-189784957 TCACTTAATAGATTTTTCTCAGG - Intergenic
988679120 5:33467022-33467044 GGTTTCAGTAGATTTTCCTGAGG - Intronic
990415513 5:55582271-55582293 GCACTCTTCAGATTTTCCTATGG - Intergenic
993268225 5:85757054-85757076 GCTCTCAGTAGATATTGATCAGG + Intergenic
994401997 5:99292127-99292149 GCACTATGTATGTTTTCCTCTGG - Intergenic
994890145 5:105623071-105623093 GCACTCAGGAGAATTACCTGAGG - Intergenic
995401885 5:111751627-111751649 ACATTCAGTACATTTTCCTCTGG + Intronic
1005749003 6:28866417-28866439 TCACCCAGTGGATTTTCCACCGG + Intergenic
1010192515 6:73208920-73208942 ACACTCAGGAGACTTCCCTCAGG + Intergenic
1010963375 6:82173537-82173559 GCACTCATTTAATTTGCCTCTGG - Intronic
1014505992 6:122257128-122257150 GCACTGCTGAGATTTTCCTCTGG + Intergenic
1015659483 6:135559159-135559181 TCACTCAGTATAATGTCCTCAGG - Intergenic
1017780685 6:157713197-157713219 GCAGTCAGCATATTTGCCTCAGG + Intronic
1018693108 6:166365324-166365346 GCATTCAGTGTATTTTCCTTAGG + Exonic
1019583952 7:1786093-1786115 GCAGTCTGTGGATTTTCCGCAGG + Intergenic
1030627973 7:111864847-111864869 CAACTAAGTTGATTTTCCTCAGG + Intronic
1031407450 7:121403701-121403723 GCACTCAGTAGGTGTACCACTGG - Intergenic
1040423260 8:47260339-47260361 GCACCCCGTAGCCTTTCCTCAGG + Intergenic
1043070581 8:75631142-75631164 GCACACAGATGATTTTCCTTTGG + Intergenic
1045976067 8:108131662-108131684 GAATCCAGTAGATTTTTCTCAGG + Intergenic
1056407189 9:86285757-86285779 GCCCTCAGTAGTTTTTTCTTTGG - Intergenic
1056628797 9:88275812-88275834 GCATTCACTAGATTTGCCACAGG - Intergenic
1059666390 9:116450312-116450334 GGAGTCAGTAGGCTTTCCTCTGG - Intronic
1187149886 X:16671872-16671894 GCACACAGACGATTTTCCTTTGG - Intronic
1188786803 X:34356659-34356681 ACATTCAGCAGTTTTTCCTCTGG - Intergenic
1190465578 X:50722418-50722440 GCACTCAGTAGATTTTCCTCTGG + Intronic
1191612945 X:63136337-63136359 GCACACAGAAGATTTTCCTTTGG - Intergenic
1191623352 X:63242589-63242611 GCACACAGAAGATTTTCCTTTGG + Intergenic
1192634401 X:72804166-72804188 GCAGTCTGTAGAATTACCTCAGG + Intronic
1192647309 X:72916635-72916657 GCAGTCTGTAGAATTACCTCAGG - Intronic
1192705312 X:73523423-73523445 GTTCTCATTAGATTTTGCTCGGG - Intergenic
1202063234 Y:20910250-20910272 GCACACAGATGATTTTCCTTTGG - Intergenic
1202171887 Y:22058267-22058289 GCACTCAGTTTTTTTTCCTCAGG - Intergenic
1202219475 Y:22528105-22528127 GCACTCAGTTTTTTTTCCTCAGG + Intergenic
1202323703 Y:23667976-23667998 GCACTCAGTTTTTTTTCCTCAGG - Intergenic
1202547068 Y:26002078-26002100 GCACTCAGTTTTTTTTCCTCAGG + Intergenic