ID: 1190466687

View in Genome Browser
Species Human (GRCh38)
Location X:50731512-50731534
Sequence GATCCTCTCTTCCATGAGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 139}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190466687_1190466691 -9 Left 1190466687 X:50731512-50731534 CCCCACTCATGGAAGAGAGGATC 0: 1
1: 0
2: 0
3: 21
4: 139
Right 1190466691 X:50731526-50731548 GAGAGGATCTACCATGGTCATGG 0: 1
1: 0
2: 0
3: 7
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190466687 Original CRISPR GATCCTCTCTTCCATGAGTG GGG (reversed) Intronic
904830413 1:33302882-33302904 GATTCTCTATTCCATGAATTAGG + Intergenic
910360068 1:86407028-86407050 GAACCTGTCTTCCATGACAGAGG - Intergenic
911237344 1:95425635-95425657 GATCCTGTCTTCTGAGAGTGTGG + Intergenic
913554824 1:119954846-119954868 GCCCCTCCCTTCCATAAGTGAGG - Intronic
915834147 1:159161154-159161176 GATCCTCTGCTCCCTCAGTGTGG - Intergenic
918411906 1:184268106-184268128 GATTCTCTGTTCCTTTAGTGAGG - Intergenic
921784838 1:219217835-219217857 GATACTTTCTTACATGAGTGAGG + Intergenic
1063295543 10:4801552-4801574 GATGCTCTCTTCCTGGAATGTGG + Intronic
1069690577 10:70349026-70349048 GATCTTCTCTTCCCTGGGTGGGG - Intronic
1071876189 10:89845975-89845997 CATCCTCTCTTCCCTGTTTGTGG + Intergenic
1072198542 10:93138174-93138196 GATGCTATCTTCCATACGTGGGG - Intergenic
1073602708 10:104862287-104862309 GATCCACACTACCATTAGTGTGG + Intronic
1074840327 10:117344864-117344886 GACCCTCCATTCCATGAGTGGGG - Intronic
1078414501 11:11154340-11154362 AATCCCCTCTACCTTGAGTGAGG - Intergenic
1079114688 11:17633879-17633901 GTTCCTCCCCTCCCTGAGTGGGG + Intronic
1079909857 11:26296370-26296392 GACCCTCTCTTCCATGCTTTGGG + Intergenic
1083702840 11:64491023-64491045 ACTCCTCCCTTCCATCAGTGTGG + Intergenic
1084022755 11:66427501-66427523 GGTCCTCTCTCCCAAGTGTGGGG + Intergenic
1084597153 11:70123661-70123683 AATCCTGCCTTCCCTGAGTGTGG + Intronic
1089358184 11:117869437-117869459 GTGCCCCTCTTCCATGAATGAGG - Intronic
1090403313 11:126462728-126462750 GATCAACCCTTCCATGAGAGTGG + Intronic
1090664717 11:128906830-128906852 AATCCTCACTCCCATGACTGGGG - Intronic
1090964505 11:131586286-131586308 GATCCTCTCCTCCTTGAGTATGG + Intronic
1090973036 11:131659206-131659228 GATCTCTTCTCCCATGAGTGTGG + Intronic
1093501016 12:19812220-19812242 AATCCTTTCTTCCATGACTATGG - Intergenic
1098196394 12:68006461-68006483 GATCCCTTCCTTCATGAGTGAGG - Intergenic
1098815069 12:75149529-75149551 GATCATTTCTTTCATTAGTGTGG - Intronic
1102432258 12:112892767-112892789 AATACTCTCTGCCATGAGTAAGG - Intronic
1103152210 12:118650671-118650693 GATTCTCTCTCTCAGGAGTGTGG - Intergenic
1106177689 13:27345179-27345201 GATATTCTCTTCCATAACTGAGG + Intergenic
1106455426 13:29922775-29922797 GATCCCATCAGCCATGAGTGGGG + Intergenic
1106502098 13:30338831-30338853 GGTCCTCTCTGACATGAGTAAGG - Intergenic
1106763960 13:32895217-32895239 GATCCTCTCTCCAAAGAGCGGGG - Intergenic
1109917852 13:69015504-69015526 GATCCTCTCCTTCCTGGGTGGGG - Intergenic
1112336984 13:98524129-98524151 GAGCATCTCTTGCATGTGTGAGG + Intronic
1113358146 13:109602600-109602622 GACCCTCTCTTCTTTGACTGGGG - Intergenic
1113795159 13:113052601-113052623 GCTCTTCTCCTCCATGCGTGGGG - Intronic
1119455050 14:74748029-74748051 GGTCTTCTAATCCATGAGTGTGG - Intergenic
1119464788 14:74848311-74848333 CCTCTGCTCTTCCATGAGTGTGG - Intronic
1119664413 14:76474208-76474230 GTTTCTCTCTTCCATGAGGAAGG + Intronic
1119904951 14:78293273-78293295 GACCCTCTCATCTATGAATGGGG + Intronic
1122804437 14:104249457-104249479 GTTCCTCTCTTCCACTGGTGAGG - Intergenic
1124475874 15:30034101-30034123 GATCAGCCCATCCATGAGTGGGG + Intergenic
1126203032 15:46010409-46010431 GTTCTTCTGATCCATGAGTGTGG + Intergenic
1127622358 15:60746200-60746222 GATGCTGTCTTCCAAGAGTATGG - Intronic
1128183716 15:65626384-65626406 GATCATCTCTTCCATGTGCATGG + Intronic
1129236830 15:74228774-74228796 GCTCCTCTCTTCCAGGAGACAGG + Intergenic
1130161783 15:81408678-81408700 GATCCTCTCTTCGATGAGAAAGG - Intergenic
1130539266 15:84810302-84810324 GAGCCTCTATTCCAAGAGGGTGG - Intergenic
1131506555 15:93025009-93025031 GATCCCCTGTTCCTTGACTGGGG - Exonic
1134249867 16:12566703-12566725 GATCCTCTCTTCAAAGGATGGGG - Intronic
1137924155 16:52523544-52523566 GTTCCTGTCTTCAATGAGAGGGG - Intronic
1138931244 16:61659547-61659569 GAGCCTCTCTCCCATGAGTAGGG - Intronic
1139188382 16:64833897-64833919 GGTCCTTTCTTCCATGGCTGTGG + Intergenic
1141872858 16:86800767-86800789 GATCATTTGCTCCATGAGTGAGG + Intergenic
1144962306 17:19051735-19051757 GAGCCTCTGTTCCTTGAGTGGGG - Intergenic
1144972855 17:19122785-19122807 GAGCCTCTGTTCCTTGAGTGGGG + Intergenic
1145933919 17:28704150-28704172 CATCCACTCTACCATGAGTGTGG - Exonic
1147161612 17:38572297-38572319 GACCCTCTCTTCCAGATGTGTGG + Intronic
1150660556 17:67072492-67072514 GATTCTCACTTCCATGCATGTGG + Exonic
1151932380 17:77240822-77240844 GATCATCTCTTCCATGAGGAAGG + Intergenic
1152532029 17:80924364-80924386 GATCATCTCAGCAATGAGTGGGG + Intronic
1153127884 18:1817996-1818018 GAGTCTCTATTCCATGAGTGTGG + Intergenic
1156318407 18:35993909-35993931 GAACTTCTTTTCCAGGAGTGGGG - Intronic
1156484177 18:37454405-37454427 GACCCTCTCTTGCTTGGGTGGGG + Intronic
1156551517 18:38024056-38024078 GATCCACTCATCCAGGAGAGGGG - Intergenic
1158442172 18:57486064-57486086 GATCCTCTCTCGTATGGGTGTGG - Exonic
1160223530 18:76994071-76994093 GTTCTTCTCCTCCATGAGAGGGG + Intronic
1160618730 18:80154508-80154530 GATCCTGTCATCCATGTATGTGG + Intronic
1160684681 19:427986-428008 GATCCTCCCTTCCCTGTGCGGGG - Intronic
1166688729 19:44810505-44810527 CTTCCGCTCTCCCATGAGTGAGG - Intronic
1167674830 19:50877629-50877651 GGCCCTCTCTTCCCTGTGTGAGG - Intronic
1167935256 19:52900773-52900795 CAGCCCCTCTTGCATGAGTGGGG - Intergenic
1168093491 19:54100887-54100909 GATACTCTCTTCCGTAAATGAGG - Exonic
926370360 2:12172421-12172443 GATCCTATCTTCCATGCCTGAGG + Intergenic
926701212 2:15804997-15805019 GATCCTCTCTTCCATGTGACTGG + Intergenic
929989735 2:46776261-46776283 GATCCGCCCTTCCATGAGTCAGG + Intergenic
933886527 2:86722769-86722791 GTACCTTTCTTCCATGAGAGAGG + Intronic
933923653 2:87073936-87073958 GTACCTTTCTTCCATGAGAGAGG - Intergenic
934970001 2:98755450-98755472 TATTGTCTCTTCCATGGGTGTGG - Intergenic
935091067 2:99895545-99895567 GATCCTGTCTGCCATGAGCCTGG - Intronic
937890694 2:126936353-126936375 TCCCCTCTCTTCCATGGGTGTGG - Intergenic
938163639 2:129008276-129008298 GATGCTCTCCTGCAGGAGTGGGG - Intergenic
941098759 2:161273926-161273948 AATCCTCTCTTTGATGAGGGTGG + Intergenic
941367598 2:164626119-164626141 GATAATCTTTTCTATGAGTGAGG - Intergenic
944580334 2:201126655-201126677 GATCCTCACTTCCCTGGCTGAGG + Intronic
948359770 2:237412041-237412063 GCTTCTCTCGACCATGAGTGAGG + Intronic
1177190545 21:17846524-17846546 GCTCTTCTCTTGCATTAGTGTGG + Intergenic
1178528998 21:33359025-33359047 GAGCCTCTGTTCCAGCAGTGGGG - Exonic
1179818934 21:43925295-43925317 GATCCTCTCTTGCCTGAGCAGGG - Exonic
1180054418 21:45349858-45349880 AAACCTCTCTTCCCAGAGTGGGG - Intergenic
1183357788 22:37368759-37368781 GAGCCCCCTTTCCATGAGTGTGG - Exonic
949968086 3:9376437-9376459 GATCCTCTCTTCCAGGAATTTGG - Intronic
953429156 3:42822883-42822905 GATCCTAGCTTTCATGACTGGGG - Intronic
953981451 3:47415173-47415195 GTTCTTCTCTTCCAGGATTGTGG - Exonic
956734370 3:72226576-72226598 GAGCCTCTGTCCCATGAGTGGGG + Intergenic
958462158 3:94412625-94412647 TATCCTCTCTCCCAACAGTGGGG - Intergenic
961783258 3:129334037-129334059 GAGCCTCCATCCCATGAGTGGGG - Intergenic
964316366 3:155448763-155448785 GAACCTGACTTTCATGAGTGAGG + Intronic
964733321 3:159890936-159890958 GGTACTCTCTTCCATGTGTCTGG + Intronic
964873281 3:161336793-161336815 GAAACTCTCTTCCATGTCTGTGG - Intergenic
967118704 3:186363791-186363813 GCTCCTCTCTTCCAGGGATGAGG - Intergenic
967303550 3:188039522-188039544 GATCCAGTCATCCATGCGTGGGG - Intergenic
969339300 4:6530289-6530311 GCTCCTCTCCTCCCTGGGTGGGG - Intronic
971362555 4:25951274-25951296 GGTCCTCTCTTGCATTAGTCAGG - Intergenic
972066600 4:34953480-34953502 CATGCTCTCTCCCATGAGGGTGG + Intergenic
972295748 4:37736155-37736177 GATCCTCTCTTCCACCCATGAGG + Intergenic
973030636 4:45333141-45333163 GATCCTCTATCTCATGAGTGTGG - Intergenic
974422206 4:61691412-61691434 GTTCCTGTTTTCCATGAGTTAGG - Intronic
975108732 4:70599600-70599622 ATTCCTCTCTTCCATGGATGAGG + Exonic
975250783 4:72175637-72175659 GATACTATATTCCATGAGGGTGG - Intergenic
977059050 4:92233698-92233720 GATTCTCTCTTCCATGAATTGGG - Intergenic
977087333 4:92618947-92618969 GATCCTGTCTTCTGAGAGTGGGG + Intronic
978932314 4:114330016-114330038 TATCCTATCTTCCCTGTGTGAGG + Intergenic
981063133 4:140448807-140448829 GATCCTTTCTTCTCTGAGTGTGG + Intronic
985149901 4:186936139-186936161 CATCTTCTGTTCCATGAGGGAGG - Intergenic
985402490 4:189606500-189606522 GATCCTGTCTTCAAAGCGTGGGG + Intergenic
986505853 5:8450344-8450366 CCACATCTCTTCCATGAGTGTGG - Intergenic
989152949 5:38318118-38318140 GAGACTCTCTTCCATGAGGCAGG - Intronic
997282857 5:132659535-132659557 GAGCCTCCCTTCCATGGCTGGGG + Intronic
998930066 5:147171680-147171702 GTACCTCTCTCCCATAAGTGGGG - Intergenic
999254461 5:150202370-150202392 GATCTTCTATTCCCTGGGTGTGG + Exonic
1000621333 5:163489683-163489705 GAGCCCCTGTTCCATGAATGGGG + Intronic
1002643763 5:180643127-180643149 AATCATCTCTTCCATCAGCGTGG + Intronic
1010994910 6:82522124-82522146 GCCCCTCTCTTCCCTGAGTAAGG - Intergenic
1013974859 6:116065340-116065362 AATCCTCTTTTCTATGTGTGGGG - Intergenic
1014096829 6:117470339-117470361 GTTGCCCTCTTCCATGAGTATGG + Intronic
1016774191 6:147886503-147886525 AATCCTCTCCCCCTTGAGTGTGG + Intergenic
1020753561 7:12171783-12171805 GATTCTTGCTTCCATGATTGTGG - Intergenic
1021791551 7:24210986-24211008 GATATTCTCTGTCATGAGTGGGG + Intergenic
1021873302 7:25025429-25025451 GATATTCTCTTCCAGGAGTTTGG + Intergenic
1022225180 7:28355386-28355408 GATTCTCTCTACTATGACTGCGG - Intronic
1022592286 7:31675955-31675977 GATACTCTCTTCCATGTCTCAGG - Intergenic
1023581864 7:41692192-41692214 TATCCTCTTTTCCATGACCGTGG + Intronic
1023647073 7:42328927-42328949 GCTCTTCTCTTCCCAGAGTGGGG + Intergenic
1023994097 7:45148326-45148348 GCTCTTCTCATGCATGAGTGCGG - Intergenic
1024522799 7:50321417-50321439 GAGATCCTCTTCCATGAGTGAGG - Intronic
1026669999 7:72381900-72381922 TATCCTCTCTTCTATGGGTTTGG - Intronic
1027455701 7:78388633-78388655 GGTCCTCTCTTCCATTTCTGAGG - Intronic
1029128713 7:98313503-98313525 AATCTTCTCTTCCCAGAGTGAGG - Intronic
1029813159 7:103069197-103069219 GCTCCTCTCTTCCCAGACTGTGG - Intronic
1030937095 7:115598104-115598126 GATTCTTCCTACCATGAGTGTGG - Intergenic
1033897383 7:146090669-146090691 GTTCCTGTCTTCCATGAGTTGGG + Intergenic
1034259996 7:149749204-149749226 GATTCTTTCTTCCAGGAGTCTGG + Intergenic
1036782717 8:11660497-11660519 GAGCTGGTCTTCCATGAGTGTGG - Intergenic
1038058516 8:23885829-23885851 GAACCTCTTTTCCCTTAGTGGGG + Intergenic
1041755698 8:61311047-61311069 TTTCCTTTCTTCCATAAGTGAGG + Intronic
1042953058 8:74220705-74220727 GCTCCTCTCTCCACTGAGTGTGG - Intergenic
1047195907 8:122721257-122721279 GAGGCCCTCTTCCATGAGAGTGG - Intergenic
1047359736 8:124157624-124157646 TATTCTCTAATCCATGAGTGTGG + Intergenic
1047466384 8:125118752-125118774 GATCAACTCTTCCAGGAATGAGG + Intronic
1047486545 8:125336088-125336110 GTTCCTTTCTACCAGGAGTGGGG - Intronic
1048935294 8:139350150-139350172 GATCATCTTGTGCATGAGTGAGG - Intergenic
1052767080 9:32651600-32651622 GCTCCTATCTCCCTTGAGTGTGG - Intergenic
1060257000 9:122040039-122040061 GATTCTCTCTTCCAGGAATCTGG + Intronic
1186363142 X:8863545-8863567 AATCCCCTCTCCCAGGAGTGTGG - Intergenic
1187629559 X:21153756-21153778 GTTCCTCTCCTCCAGGGGTGGGG - Intergenic
1190466687 X:50731512-50731534 GATCCTCTCTTCCATGAGTGGGG - Intronic
1192546563 X:72019054-72019076 GATCCTCTCTGGCGAGAGTGGGG - Intergenic
1193698155 X:84734837-84734859 GAGCCTCCATTCCATGAGTGGGG + Intergenic
1201421062 Y:13799510-13799532 GTTCCTTTCTTCCAGGAGTCAGG + Intergenic