ID: 1190469664

View in Genome Browser
Species Human (GRCh38)
Location X:50765713-50765735
Sequence TCTGTTTGCCAGACAGTTTA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 168}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190469664_1190469665 9 Left 1190469664 X:50765713-50765735 CCGTAAACTGTCTGGCAAACAGA 0: 1
1: 0
2: 2
3: 15
4: 168
Right 1190469665 X:50765745-50765767 GCCTTCCAAATGACATGAACTGG 0: 1
1: 0
2: 0
3: 14
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190469664 Original CRISPR TCTGTTTGCCAGACAGTTTA CGG (reversed) Intronic
901481803 1:9530325-9530347 TCTGTTTCCCAAACTGTTGAGGG - Intergenic
902238684 1:15074110-15074132 TCTGTTTTAGAGACAGCTTAAGG - Intronic
903416094 1:23184215-23184237 TCCCTTTTCCAGACAGTTGATGG - Intergenic
904496970 1:30892470-30892492 TCTGTTTGGTAGACTGTTTTAGG - Intronic
904676561 1:32202260-32202282 CCTTTTTGCCACACAGTTGAGGG - Intronic
906378094 1:45313175-45313197 TTTTTTTGCCAGGCAGCTTAGGG - Intergenic
908382255 1:63607805-63607827 TCTTTCAGCCAGTCAGTTTATGG + Intronic
908999971 1:70206185-70206207 TCTGTGTATCAGACAGTTTAGGG + Intronic
909055807 1:70819717-70819739 TCTAGTAGCCAGACAGATTAAGG - Intergenic
909676132 1:78241086-78241108 TCTTTTCTCCAGTCAGTTTAAGG - Intergenic
910370028 1:86505641-86505663 TCAGTTTGCCAGATAGTGTTAGG - Intergenic
911300910 1:96172788-96172810 TCTGATTGCTAGCCAGTTTATGG + Intergenic
911378810 1:97086388-97086410 TCTGTTTGATATAAAGTTTAAGG + Intronic
911951785 1:104182420-104182442 TCTGTTTGCATGACAGTGAATGG + Intergenic
912191803 1:107349170-107349192 GCTGTTTGCCTGACATTTCATGG + Intronic
912945837 1:114083385-114083407 TCTTTTTTCCACACAGTTTGGGG - Intergenic
923359148 1:233190806-233190828 TCTGTTTTCTATTCAGTTTATGG - Intronic
924749289 1:246870687-246870709 TCTTTTAGCTAGAAAGTTTAGGG - Intronic
924940034 1:248806837-248806859 TCCATTTGCCAGCCAGTGTATGG + Intergenic
1065968582 10:30787984-30788006 GCTGTTTCCCAGACAGTGCAAGG - Intergenic
1066053943 10:31663014-31663036 GCTGTTTGCAAGGAAGTTTAGGG - Intergenic
1068498034 10:57809616-57809638 TATTTTTGCCAGAAAGCTTATGG - Intergenic
1069357402 10:67602746-67602768 ACTTATTACCAGACAGTTTATGG + Intronic
1070206894 10:74273143-74273165 TCTGTAGGCCAGACAGCTGAAGG - Intronic
1072715039 10:97745487-97745509 TCTGCTGGAGAGACAGTTTAGGG + Intronic
1072850694 10:98888662-98888684 TCTTTATGCCAGCCAGTTTGGGG - Intronic
1073965139 10:108980060-108980082 TCTGTTTGGTAGAAAGCTTAAGG + Intergenic
1074918290 10:117980563-117980585 TCTGTTTGCCAAATACTTTCTGG + Intergenic
1075312404 10:121425521-121425543 TCTGTTTGCCTGACATTTTAAGG - Intergenic
1075670962 10:124263914-124263936 TCTCTTTGCCAGACAGCTGCGGG - Intergenic
1079578779 11:22036094-22036116 TCTGTTTGCCATTGAGTTTAGGG + Intergenic
1080306515 11:30842971-30842993 TGTTTTTGCCAGACAGCTTTGGG + Intronic
1080496509 11:32825772-32825794 TCTGATTGCCACACAATTTTTGG - Intergenic
1082709550 11:56537717-56537739 ACTGTTTGCCTGACAGTTATTGG + Intergenic
1085451710 11:76637904-76637926 TCTGTTTGCCAGGCTGTGTCAGG + Intergenic
1086232707 11:84589702-84589724 TCTGTTTGCCAGAAGTTTTGAGG + Intronic
1087349523 11:97013896-97013918 TCAGTTTACCAGGCATTTTAAGG - Intergenic
1090646005 11:128767088-128767110 TGTGTTTGCCAGCCAGCTTCAGG + Intronic
1091401834 12:185856-185878 TGTGTTTGCCAGACAGGATGGGG - Intergenic
1096838600 12:54367738-54367760 TCTGTTTTCCAGACAGATGGTGG + Intergenic
1097232123 12:57519417-57519439 ACTGTGTGCCACACAGTTTGGGG - Intronic
1098905707 12:76160080-76160102 ATTGCTTGGCAGACAGTTTAGGG - Intergenic
1100599283 12:96099090-96099112 GCTCTTTGGGAGACAGTTTAAGG + Intergenic
1107952855 13:45480113-45480135 TCTGTTTTCTAGACAGATGAGGG + Exonic
1110830134 13:80021134-80021156 TCTGTCTCCCAGAAATTTTAAGG + Intergenic
1112742785 13:102494120-102494142 TTTGTTAGCCACCCAGTTTATGG + Intergenic
1116574201 14:46552243-46552265 TCTGCAAGCCAGACAGTTCAGGG - Intergenic
1117833633 14:59779354-59779376 TATGTTTCCCAGGCAGTTTAAGG - Intronic
1121862301 14:97329796-97329818 TCTGGTTTCCAGGCATTTTATGG - Intergenic
1127457338 15:59167131-59167153 TTTTATTGCCAGAAAGTTTAGGG + Intronic
1128616196 15:69111923-69111945 TGTGTATGCCACCCAGTTTATGG + Intergenic
1130764515 15:86856529-86856551 TCTGTTTGGCAGAAAGTGTAGGG - Intronic
1131499130 15:92944399-92944421 TCTGTCTGCCATTCAGGTTAGGG + Exonic
1131794097 15:95995756-95995778 TCTGTTTGCAAAACATTTTATGG - Intergenic
1134803313 16:17105177-17105199 TCTTTTTGGCAGAAAGCTTAAGG + Exonic
1135051547 16:19196974-19196996 TCTGTTTACCAGGCAGTTTTTGG - Intronic
1135344652 16:21678633-21678655 TGTGGTTTCCACACAGTTTAGGG + Intronic
1135845340 16:25913494-25913516 TTTATTAGCCACACAGTTTATGG + Intronic
1141374418 16:83517204-83517226 AGTGCTTGCAAGACAGTTTAAGG + Intronic
1142749958 17:1981451-1981473 TCTGCTTTCCAGAGACTTTAGGG + Intronic
1143784279 17:9245111-9245133 TCAGTTGGCCAGACAGGCTAAGG + Intergenic
1146468370 17:33105063-33105085 TCTGTGAGCCAGACAGTCCAAGG + Intronic
1147150656 17:38511721-38511743 CCTGTTCCCCAGACAGTTTTTGG + Exonic
1149010558 17:51852192-51852214 TTTGTTTGCAAGACAGTATCAGG + Intronic
1149265996 17:54928266-54928288 TCTGTATGCCAGACACTGTGGGG + Intronic
1149275709 17:55033012-55033034 TCTGTTTGTCTGATAGTTTTGGG - Intronic
1153759642 18:8318126-8318148 TCTGTTTTCCAACCAGTTTTGGG + Intronic
1154138509 18:11802053-11802075 CCTGTTTCCCTGAAAGTTTAGGG + Intronic
1155358661 18:24979108-24979130 TTTTTTTGCCACACTGTTTAGGG - Intergenic
1156406164 18:36784574-36784596 TGTGTTTGCTAGACAATTTGTGG + Intronic
1156637945 18:39053642-39053664 TTTGTTTTCCTGACATTTTAAGG - Intergenic
1156776894 18:40801427-40801449 ACATTCTGCCAGACAGTTTATGG - Intergenic
1157313313 18:46568575-46568597 TCTGTCTGCCAGACTCTTGAAGG + Intronic
1158557703 18:58488969-58488991 GCTGTGTGCCAGACACTGTAGGG + Intronic
1158935480 18:62360773-62360795 TCAGATTGCCAGAAAGTTGATGG + Intronic
1164681232 19:30135025-30135047 TCTGTCTGGCAGGGAGTTTATGG + Intergenic
1166402254 19:42491643-42491665 TATCTTTGCTAGACGGTTTAAGG - Intergenic
925832753 2:7912217-7912239 TCTGTTGTCCACCCAGTTTATGG - Intergenic
928018999 2:27686215-27686237 TCTGTTTCCCAGACAAATGAAGG - Intronic
928888462 2:36177307-36177329 TCTGGCTGCCAGAAAATTTAGGG - Intergenic
929494336 2:42426814-42426836 TCTGTCTTGCAAACAGTTTATGG - Intergenic
930689420 2:54344959-54344981 ACTATTTGCCAGGCACTTTATGG + Intronic
931309979 2:61068465-61068487 TTTGTATGCCAGACAGTGTGCGG + Intronic
932914589 2:75842575-75842597 ACTGTTTATCAGACACTTTAAGG - Intergenic
933206993 2:79518223-79518245 TTTGTTTGCTAGGCAGTTTTGGG + Intronic
933414753 2:81972512-81972534 TCTGTTTAACAGGCAGTTTCAGG - Intergenic
936994187 2:118396251-118396273 TCTGATTGCCAGCCAGTCTATGG + Intergenic
940587856 2:155677529-155677551 TCTATTTTTCAGACAGTTTTTGG - Intergenic
942320733 2:174733336-174733358 TCCCTTTCTCAGACAGTTTAGGG + Intergenic
943651646 2:190463887-190463909 TCTGTATGGTAGACAGTATATGG - Intronic
945705873 2:213230712-213230734 CCTATATGCCAGACAGTTTCAGG - Intergenic
945882995 2:215345879-215345901 ACTGTTGGGCAGACAGCTTAGGG + Intronic
946177716 2:217931590-217931612 TCTGTTTGCCAGCCAGGACAAGG + Intronic
946595936 2:221306006-221306028 TCTGTTTTCCAGTGATTTTAAGG + Intergenic
947264960 2:228268401-228268423 TTTGTGGGCCATACAGTTTATGG - Intergenic
948176087 2:235944690-235944712 TCTCTTTGCCAGAGCCTTTATGG + Intronic
948743711 2:240069511-240069533 TCTGTTTTCTCTACAGTTTATGG + Intergenic
948841936 2:240655614-240655636 TCTGTTTGAGAGACAATTTGCGG + Intergenic
1171980268 20:31623121-31623143 CCTGTTAGCCAGACAGTGTGAGG + Intergenic
1174730607 20:52912999-52913021 TCTGTTTTCCAGCCAGTTCATGG - Intergenic
1176951658 21:15054761-15054783 TCTGTGTGCCAGACACTTACAGG + Intronic
1180190958 21:46162185-46162207 TCTATTTGCCAGACAGTGGGGGG - Intronic
1184591412 22:45486106-45486128 ACTGTTTGCCAGATACTTTAAGG + Intergenic
949368973 3:3314056-3314078 TATGTTTACCAGGCACTTTATGG + Intergenic
949817648 3:8077070-8077092 TCTGTTTGCCAGACATGTATAGG + Intergenic
950454479 3:13084442-13084464 ACTGTGTGCCAGACAGTTTTAGG + Intergenic
953330181 3:42046173-42046195 TCTGGTTGCCCTTCAGTTTAGGG - Intronic
953502815 3:43454458-43454480 TCTGATGGCCAGACAGTCTTGGG - Intronic
953800194 3:46016919-46016941 AGTGTTTGCCACTCAGTTTATGG + Intergenic
954760912 3:52873126-52873148 TTTATTTGCTAGACAATTTAGGG - Intronic
956124488 3:65998343-65998365 GCTGAATGCCACACAGTTTAGGG + Intronic
956388804 3:68749666-68749688 ACTGTTTGCCAGACAATGTTAGG + Intronic
957235604 3:77585233-77585255 TCTGTTTGCCAGATATTTGGGGG + Intronic
959624913 3:108438787-108438809 TTTATTTGCCACCCAGTTTATGG + Intronic
961053750 3:123768800-123768822 CCTGTTCACCAGACAGTGTATGG - Intronic
963079775 3:141380373-141380395 TCTGCTTGCCAGACAACTTGTGG + Intronic
964989437 3:162788801-162788823 TCTGGTTGCTGGACAGTTTGAGG + Intergenic
966249832 3:177852250-177852272 TTTATTTGGCAGACAGTCTAGGG - Intergenic
966282903 3:178255363-178255385 TCTCTAAGCCACACAGTTTATGG + Intergenic
966627824 3:182037572-182037594 GCTTTTTGCCATACAGTATAAGG + Intergenic
967145603 3:186603363-186603385 TCTCTTTGCCAGCCTGTTGATGG + Intergenic
967534478 3:190586641-190586663 TCTCCTTCCCAGACAGTTGATGG + Intronic
968695477 4:2023856-2023878 TATATTTGCCATACAGTCTAGGG + Intronic
969273539 4:6119176-6119198 TCTGTTTACCACCCAGTTTGTGG + Intronic
969495669 4:7524798-7524820 ACTGCTTGCCAGCCAGTTTCAGG + Intronic
972111608 4:35568094-35568116 TTTGTATGCCACATAGTTTAAGG - Intergenic
975396643 4:73882389-73882411 TATGTTTGCCAGATTGTTTCAGG + Intergenic
977577876 4:98694014-98694036 TGTGTTTGCTAGTCAGATTATGG + Intergenic
977663142 4:99614286-99614308 TTTGTTTGCCAGATAATTTGAGG + Intronic
979059802 4:116043550-116043572 TCTGTTAGCCAGCCAGCTAAAGG - Intergenic
981598052 4:146449486-146449508 TCTTTTTGCTGGACAGGTTAGGG - Intronic
984218135 4:176940329-176940351 TCTATTTGTCAGACACTTTGGGG - Intergenic
984982025 4:185291509-185291531 TGTTTGTGCCAGACAGTTTGTGG - Intronic
986058282 5:4161438-4161460 TGTGTTTGCCAGACACTCAAAGG - Intergenic
986297718 5:6453523-6453545 TCTGTTTGCCTGACAGTTTCTGG + Intronic
986735867 5:10666828-10666850 TCTGTTTCCCAAAAAGGTTATGG + Intergenic
992780689 5:80124388-80124410 TGTGTTTGGCAGACACTTAAAGG - Intronic
994268441 5:97745941-97745963 TCTGTTAGCCAGACAAGATAAGG + Intergenic
996010077 5:118472561-118472583 TATTTTTGTCAGACATTTTATGG + Intergenic
998461575 5:142313970-142313992 TCTGTTTGACACAAAGTTTCAGG + Exonic
1001152148 5:169241178-169241200 TCTGGTTGCCAGAGAGTGGATGG - Intronic
1001291527 5:170466210-170466232 TCTGTTTGCAAGCCAGATTTGGG - Intronic
1001687641 5:173606457-173606479 TGTTTTTGGCAGACAGTTTTTGG - Intergenic
1003197708 6:3929745-3929767 TCTGTTTCCAAGACAGTCCAAGG + Intergenic
1005281591 6:24280423-24280445 TTCTTCTGCCAGACAGTTTATGG - Intronic
1006706091 6:36022682-36022704 GCTGTTAGCCAGACATTTGATGG - Intronic
1008237780 6:49070773-49070795 TCTCACTGCCAGACAGTTTAAGG - Intergenic
1011366714 6:86590359-86590381 TCTTTTTGCAAGACACTCTAAGG - Intergenic
1014219570 6:118786497-118786519 TATGTTTGCCAGAGACTATAGGG - Intergenic
1015333260 6:132005911-132005933 TCAGTCTGCCATACAGTTTGGGG + Intergenic
1016016291 6:139189958-139189980 TTTGTTTGACAGACAGCTAATGG - Intergenic
1016577577 6:145586741-145586763 TCTGTTTGCAAGTTAGGTTAGGG - Intronic
1017641834 6:156502137-156502159 TCTTGTTGCTATACAGTTTATGG + Intergenic
1018572035 6:165222088-165222110 TCTTTATGGCAGACAGTTTATGG - Intergenic
1018833206 6:167462073-167462095 TCTCTTTGCCAGTCACTTAAAGG + Intergenic
1019856163 7:3610231-3610253 TCTGTTTGCTGGTGAGTTTACGG - Intronic
1021526066 7:21589753-21589775 TGTCTTTGCCGGACAGTTTCTGG + Intronic
1022843086 7:34183095-34183117 TCTCTATGCCACCCAGTTTATGG + Intergenic
1023743417 7:43301185-43301207 GCTGTCTGCCAGACAGTGTTGGG - Intronic
1023961380 7:44929459-44929481 TTTGTATGCCACCCAGTTTATGG - Intergenic
1024775643 7:52782419-52782441 TGTGTATGCCAAACAATTTAGGG - Intergenic
1028164574 7:87523325-87523347 TCTGTTTTCCAGAAAGTTTTGGG + Intronic
1028925852 7:96356220-96356242 ACTGTGTGCCAGGCAGTTTTAGG - Intergenic
1031689499 7:124769669-124769691 TCTGTTTTCCAAATAGTTTGTGG + Intergenic
1034882103 7:154770635-154770657 TTTGTGAGCCAGTCAGTTTATGG + Intronic
1036217047 8:6889446-6889468 TTTGTGTGACAGACAGTTTCTGG + Intergenic
1041120230 8:54579150-54579172 TCTGTTTCCTAGACAGACTATGG - Intergenic
1042479629 8:69288603-69288625 TATGTTTTCCAGGCAGTTCAAGG + Intergenic
1043210079 8:77502683-77502705 TCTATTTGCTTGACAGTTTGAGG + Intergenic
1043454103 8:80396600-80396622 TCTGTTTGTCATAAAGTTTTTGG - Intergenic
1045552438 8:103184436-103184458 TCTGTGTGGCAGACAGTGTTAGG + Intronic
1046100465 8:109608377-109608399 TGTGTTTGCCATAAAATTTAGGG - Intronic
1046214176 8:111120115-111120137 TCTGCTTGCCATGTAGTTTAAGG - Intergenic
1051490461 9:17658393-17658415 GCTTTTTGCCAGACATTCTAAGG - Intronic
1052426978 9:28317829-28317851 TCTGTCTGCCACACAGGGTATGG + Intronic
1058525592 9:105854866-105854888 TCTGTGTGCCAGACATTGTTAGG - Intergenic
1060635661 9:125198020-125198042 TCTCTTTGGCAGACAGTCAATGG + Intergenic
1185622673 X:1463101-1463123 TTTGTTTACAAGGCAGTTTAGGG + Exonic
1188220164 X:27531615-27531637 TCTATTTCTCAGACAGTTTTTGG - Intergenic
1188346658 X:29075175-29075197 ACTGCTTGCCAGACTGTTTAGGG + Intronic
1190469664 X:50765713-50765735 TCTGTTTGCCAGACAGTTTACGG - Intronic
1191176585 X:57508853-57508875 TGTTTTTGCTAGACATTTTAAGG + Intergenic
1194972102 X:100355158-100355180 TCAGTTTTCCAGATAGCTTAGGG + Intronic
1198253602 X:134905713-134905735 TCTGTTTAGCCCACAGTTTAAGG - Intronic
1198816858 X:140600617-140600639 TTTGTGTTCCAGACACTTTAGGG + Intergenic
1200106331 X:153715288-153715310 TCTGTTTGCCTGAGAGTATGTGG + Intronic