ID: 1190475745

View in Genome Browser
Species Human (GRCh38)
Location X:50825646-50825668
Sequence CTGGGTACCCAGTTCAGACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190475739_1190475745 6 Left 1190475739 X:50825617-50825639 CCAATATGTGGGCTGAAAGATGG No data
Right 1190475745 X:50825646-50825668 CTGGGTACCCAGTTCAGACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190475745 Original CRISPR CTGGGTACCCAGTTCAGACA GGG Intergenic
No off target data available for this crispr