ID: 1190480800

View in Genome Browser
Species Human (GRCh38)
Location X:50874900-50874922
Sequence ACCAACCTGTGTAAGTGGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190480796_1190480800 16 Left 1190480796 X:50874861-50874883 CCTACATTTCTGCTACTTTCAAG No data
Right 1190480800 X:50874900-50874922 ACCAACCTGTGTAAGTGGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190480800 Original CRISPR ACCAACCTGTGTAAGTGGTC TGG Intergenic
No off target data available for this crispr