ID: 1190483504

View in Genome Browser
Species Human (GRCh38)
Location X:50901015-50901037
Sequence ATGAACAAACAAATGCACAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190483503_1190483504 -2 Left 1190483503 X:50900994-50901016 CCTACTTCACAGTTGTAATTAAT No data
Right 1190483504 X:50901015-50901037 ATGAACAAACAAATGCACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190483504 Original CRISPR ATGAACAAACAAATGCACAA AGG Intergenic
No off target data available for this crispr